Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

ancestral / translate improvements & tests #1348

Merged
merged 7 commits into from
Dec 20, 2023
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
9 changes: 9 additions & 0 deletions CHANGES.md
Original file line number Diff line number Diff line change
Expand Up @@ -8,8 +8,17 @@
* ancestral: Improvements to command line arguments. [#1344][] (@jameshadfield)
* Incompatible arguments are now checked, especially related to VCF vs FASTA inputs.
* `--vcf-reference` and `--root-sequence` are now mutually exclusive.
* translate: Tree nodes are checked against the node-data JSON input to ensure sequences are present. [#1348][] (@jameshadfield)

### Bug Fixes

* translate: The 'source' ID for GFF files is now ignored as a potential gene feature (it is still used for overall nuc coords). [#1348][] (@jameshadfield)
* translate: Improvements to command line arguments. [#1348][] (@jameshadfield)
* `--tree` and `--ancestral-sequences` are now required arguments.
* separate VCF-only arguments into their own group

[#1344]: https://github.com/nextstrain/augur/pull/1344
[#1348]: https://github.com/nextstrain/augur/pull/1348

## 23.1.1 (7 November 2023)

Expand Down
133 changes: 87 additions & 46 deletions augur/translate.py
Original file line number Diff line number Diff line change
Expand Up @@ -19,13 +19,18 @@
from .io.vcf import write_VCF_translation
from .utils import read_node_data, load_features, write_json, get_json_name
from treetime.vcf_utils import read_vcf
from augur.errors import AugurError
from textwrap import dedent

class MissingNodeError(Exception):
pass

class MismatchNodeError(Exception):
pass

class NoVariationError(Exception):
pass

def safe_translate(sequence, report_exceptions=False):
"""Returns an amino acid translation of the given nucleotide sequence accounting
for gaps in the given sequence.
Expand Down Expand Up @@ -124,7 +129,7 @@ def translate_feature(aln, feature):
return translations


def translate_vcf_feature(sequences, ref, feature):
def translate_vcf_feature(sequences, ref, feature, feature_name):
'''Translates a subsequence of input nucleotide sequences.

Parameters
Expand All @@ -144,6 +149,9 @@ def translate_vcf_feature(sequences, ref, feature):
translated reference gene, positions of AA differences, and AA
differences indexed by node name

Raises
------
NoVariationError : if no variable sites within this feature (across all sequences)
'''
def str_reverse_comp(str_seq):
#gets reverse-compliment of a string and returns it as a string
Expand All @@ -160,7 +168,7 @@ def str_reverse_comp(str_seq):
# Need to get ref translation to store. check if multiple of 3 for sanity.
# will be padded in safe_translate if not
if len(refNuc)%3:
print("Gene length of {} is not a multiple of 3. will pad with N".format(feature.qualifiers['Name'][0]), file=sys.stderr)
print(f"Gene length of {feature_name!r} is not a multiple of 3. will pad with N", file=sys.stderr)

ref_aa_seq = safe_translate(refNuc)
prot['reference'] = ref_aa_seq
Expand Down Expand Up @@ -204,11 +212,10 @@ def str_reverse_comp(str_seq):

prot['positions'].sort()

#if no variable sites, exclude this gene
# raise an error if no variable sites observed
if len(prot['positions']) == 0:
return None
else:
return prot
raise NoVariationError()
return prot

def construct_mut(start, pos, end):
return str(start) + str(pos) + str(end)
Expand Down Expand Up @@ -314,77 +321,111 @@ def get_genes_from_file(fname):

return unique_genes

def sequences_vcf(reference_fasta, vcf):
"""
Extract the nucleotide variation in the VCF
Returns a tuple
[0] The sequences as a dict of dicts. sequences → <NODE_NAME> → <POS> → <ALT_NUC> where <POS> is a 0-based int
[1] The sequence of the provided `reference_fasta` (string)
"""
if not reference_fasta:
raise AugurError("A reference Fasta is required with VCF-format input")
compress_seq = read_vcf(vcf, reference_fasta)
sequences = compress_seq['sequences']
ref = compress_seq['reference']
return (sequences, ref)

def sequences_json(node_data_json, tree):
"""
Extract the full nuc sequence for each node in the provided node-data JSON.
Returns a dict, keys are node names and values are a string of the genome sequence (nuc)
"""
node_data = read_node_data(node_data_json)
if node_data is None:
raise AugurError("could not read node data (incl sequences)")
# extract sequences from node meta data
sequences = {}
for k,v in node_data['nodes'].items():
if 'sequence' in v:
sequences[k] = v['sequence']
tree_nodes = {c.name for c in tree.find_clades()}
tree_nodes_missing_sequences = tree_nodes - set(sequences.keys())
if len(tree_nodes_missing_sequences):
raise AugurError(dedent(f"""\
{len(tree_nodes_missing_sequences)} nodes on the tree are missing nucleotide sequences in the node-data JSON.
These must be present under 'nodes' → <node_name> → 'sequence'.
This error may originate from using 'augur ancestral' with VCF input; in this case try using VCF output from that command here.
"""))
return sequences

def register_parser(parent_subparsers):
parser = parent_subparsers.add_parser("translate", help=__doc__)
parser.add_argument('--tree', help="prebuilt Newick -- no tree will be built if provided")
parser.add_argument('--ancestral-sequences', type=str, help='JSON (fasta input) or VCF (VCF input) containing ancestral and tip sequences')
parser.add_argument('--tree', required=True, help="prebuilt Newick -- no tree will be built if provided")
parser.add_argument('--ancestral-sequences', required=True, type=str, help='JSON (fasta input) or VCF (VCF input) containing ancestral and tip sequences')
parser.add_argument('--reference-sequence', required=True,
help='GenBank or GFF file containing the annotation')
parser.add_argument('--genes', nargs='+', help="genes to translate (list or file containing list)")
parser.add_argument('--output-node-data', type=str, help='name of JSON file to save aa-mutations to')
parser.add_argument('--alignment-output', type=str, help="write out translated gene alignments. "
"If a VCF-input, a .vcf or .vcf.gz will be output here (depending on file ending). If fasta-input, specify the file name "
"like so: 'my_alignment_%%GENE.fasta', where '%%GENE' will be replaced by the name of the gene")
parser.add_argument('--vcf-reference-output', type=str, help="fasta file where reference sequence translations for VCF input will be written")
parser.add_argument('--vcf-reference', type=str, help='fasta file of the sequence the VCF was mapped to')
vcf_only = parser.add_argument_group(
title="VCF specific",
description="These arguments are only applicable if the input (--ancestral-sequences) is in VCF format."
)
vcf_only.add_argument('--vcf-reference', type=str, help='fasta file of the sequence the VCF was mapped to')
vcf_only.add_argument('--vcf-reference-output', type=str, help="fasta file where reference sequence translations for VCF input will be written")

return parser

def check_arg_combinations(args, is_vcf):
"""
Check that provided arguments are compatible.
Where possible we use argparse built-ins, but they don't cover everything we want to check.
This checking shouldn't be used by downstream code to assume arguments exist, however by checking for
invalid combinations up-front we can exit quickly.
"""
if not is_vcf and (args.vcf_reference or args.vcf_reference_output):
raise AugurError("Arguments '--vcf-reference' and/or '--vcf-reference-output' are only applicable if the input ('--ancestral-sequences') is VCF")


def run(args):
## read tree and data, if reading data fails, return with error code
tree = Phylo.read(args.tree, 'newick')
is_vcf = any([args.ancestral_sequences.lower().endswith(x) for x in ['.vcf', '.vcf.gz']])
check_arg_combinations(args, is_vcf)

# If genes is a file, read in the genes to translate
if args.genes and len(args.genes) == 1 and os.path.isfile(args.genes[0]):
genes = get_genes_from_file(args.genes[0])
else:
genes = args.genes

## check file format and read in sequences
is_vcf = False
if any([args.ancestral_sequences.lower().endswith(x) for x in ['.vcf', '.vcf.gz']]):
if not args.vcf_reference:
print("ERROR: a reference Fasta is required with VCF-format input")
return 1
compress_seq = read_vcf(args.ancestral_sequences, args.vcf_reference)
sequences = compress_seq['sequences']
ref = compress_seq['reference']
is_vcf = True
else:
node_data = read_node_data(args.ancestral_sequences, args.tree)
if node_data is None:
print("ERROR: could not read node data (incl sequences)")
return 1
# extract sequences from node meta data
sequences = {}
for k,v in node_data['nodes'].items():
if 'sequence' in v:
sequences[k] = v['sequence']

## load features; only requested features if genes given
features = load_features(args.reference_sequence, genes)
if features is None:
print("ERROR: could not read features of reference sequence file")
return 1
print("Read in {} features from reference sequence file".format(len(features)))

### translate every feature - but not 'nuc'!
## Read in sequences & for each sequence translate each feature _except for_ the source (nuc) feature
## Note that `load_features` _only_ extracts {'gene', 'source'} for GFF files, {'CDS', 'source'} for GenBank.
translations = {}
deleted = []
for fname, feat in features.items():
if is_vcf:
trans = translate_vcf_feature(sequences, ref, feat)
if trans:
translations[fname] = trans
else:
deleted.append(fname)
else:
if feat.type != 'source':
translations[fname] = translate_feature(sequences, feat)

if len(deleted) != 0:
print("{} genes had no mutations and so have been be excluded.".format(len(deleted)))
if is_vcf:
(sequences, ref) = sequences_vcf(args.vcf_reference, args.ancestral_sequences)
features_without_variation = []
for fname, feat in features.items():
if feat.type=='source':
continue
try:
translations[fname] = translate_vcf_feature(sequences, ref, feat, fname)
except NoVariationError:
features_without_variation.append(fname)
if len(features_without_variation):
print("{} genes had no mutations and so have been be excluded.".format(len(features_without_variation)))
else:
sequences = sequences_json(args.ancestral_sequences, tree)
translations = {fname: translate_feature(sequences, feat) for fname, feat in features.items() if feat.type != 'source'}

## glob the annotations for later auspice export
#
Expand Down
39 changes: 39 additions & 0 deletions tests/functional/ancestral/cram/general.t
Original file line number Diff line number Diff line change
@@ -0,0 +1,39 @@
Setup

$ source "$TESTDIR"/_setup.sh

General running of augur ancestral.
- Note that the (parsimonious) C18T on the branch of Sample_C is inferred by augur
as a root mutation of C18T + T18C reversion on Node_AB. This is reflected in the
node-data JSON we diff against.
- We supply the refererence sequence so mutations are called at the root.
- Ambiguous nucleotides (there are 3 Ns in sample_C) are inferred (default)

$ ${AUGUR} ancestral \
> --tree "$TESTDIR/../data/simple-genome/tree.nwk" \
> --alignment "$TESTDIR/../data/simple-genome/sequences.fasta" \
> --root-sequence "$TESTDIR/../data/simple-genome/reference.fasta" \
> --output-node-data "nt_muts.ref-seq.json" \
> --inference marginal > /dev/null


$ python3 "$TESTDIR/../../../../scripts/diff_jsons.py" \
> "$TESTDIR/../data/simple-genome/nt_muts.ref-seq.json" \
> "nt_muts.ref-seq.json"
{}

Same as above but without a root-sequence so no mutations inferred on the root node
(and thus the inferred reference will be different)

$ ${AUGUR} ancestral \
> --tree "$TESTDIR/../data/simple-genome/tree.nwk" \
> --alignment "$TESTDIR/../data/simple-genome/sequences.fasta" \
> --output-node-data "nt_muts.no-ref-seq.json" \
> --inference marginal > /dev/null


$ python3 "$TESTDIR/../../../../scripts/diff_jsons.py" \
> "$TESTDIR/../data/simple-genome/nt_muts.ref-seq.json" \
> "nt_muts.no-ref-seq.json" \
> --exclude-paths "root['reference']['nuc']" "root['nodes']['node_root']['muts']"
{}
54 changes: 54 additions & 0 deletions tests/functional/ancestral/data/simple-genome/nt_muts.ref-seq.json
Original file line number Diff line number Diff line change
@@ -0,0 +1,54 @@
{
"annotations": {
"nuc": {
"end": 50,
"start": 1,
"strand": "+",
"type": "source"
}
},
"generated_by": {
"program": "augur",
"version": "23.1.1"
},
"mask": "00000000000000000000000000000000000000000000000000",
"nodes": {
"node_AB": {
"muts": [
"A7G",
"C14T",
"T18C",
"A33G",
"A43T"
],
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTGTCCATAAA"
},
"node_root": {
"muts": [
"A5C",
"C18T"
],
"sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
},
"sample_A": {
"muts": [
"G33C",
"C39T"
],
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAACAACTATTTGTCCATAAA"
},
"sample_B": {
"muts": [
"G42A"
],
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTATCCATAAA"
},
"sample_C": {
"muts": [],
"sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
}
},
"reference": {
"nuc": "AAAAAAAAAATGCCCTGCGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
}
}
2 changes: 2 additions & 0 deletions tests/functional/ancestral/data/simple-genome/reference.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,2 @@
>reference_name
AAAAAAAAAATGCCCTGCGGGTAAAAAAAAAAAAACTACTTGACCATAAA
6 changes: 6 additions & 0 deletions tests/functional/ancestral/data/simple-genome/sequences.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,6 @@
>sample_A
AAAACAGAAATGCTCTGCGGGTAAAAAAAAAACAACTATTTGTCCATAAA
>sample_B
AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTATCCATAAA
>sample_C
AAAACAAAAATGCCCTGTGGGTAAAAANNNAAAAACTACTTGACCATAAA
1 change: 1 addition & 0 deletions tests/functional/ancestral/data/simple-genome/tree.nwk
Original file line number Diff line number Diff line change
@@ -0,0 +1 @@
(sample_C:0.02,(sample_B:0.02,sample_A:0.02)node_AB:0.06)node_root:0.02;
2 changes: 0 additions & 2 deletions tests/functional/translate/cram/_setup.sh

This file was deleted.

38 changes: 38 additions & 0 deletions tests/functional/translate/cram/general.t
Original file line number Diff line number Diff line change
@@ -0,0 +1,38 @@
Setup

$ export AUGUR="${AUGUR:-$TESTDIR/../../../../bin/augur}"
$ export SCRIPTS="$TESTDIR/../../../../scripts"
$ export ANC_DATA="$TESTDIR/../../ancestral/data/simple-genome"
$ export DATA="$TESTDIR/../data/simple-genome"

General running of augur translate. See the cram test general.t for `augur ancestral`
which uses many of the same files.
NOTE: The GFF reference here contains a 'source' ID because without this downstream commands
which validate the output will fail as it's missing a 'nuc' annotation.

$ ${AUGUR} translate \
> --tree "$ANC_DATA/tree.nwk" \
> --ancestral-sequences "$ANC_DATA/nt_muts.ref-seq.json" \
> --reference-sequence "$DATA/reference.source.gff" \
> --output-node-data "aa_muts.json" > /dev/null

$ python3 "$SCRIPTS/diff_jsons.py" \
> "$DATA/aa_muts.json" \
> "aa_muts.json" \
> --exclude-regex-paths "root\['annotations'\]\['.+'\]\['seqid'\]"
{}

Same as above but using a GenBank file. This changes the 'type' of the annotations,
but this is irrelevant for Auspice's use and simply reflects the reference source.

$ ${AUGUR} translate \
> --tree "$ANC_DATA/tree.nwk" \
> --ancestral-sequences "$ANC_DATA/nt_muts.ref-seq.json" \
> --reference-sequence "$DATA/reference.gb" \
> --output-node-data "aa_muts.genbank.json" > /dev/null

$ python3 "$SCRIPTS/diff_jsons.py" \
> "$DATA/aa_muts.json" \
> "aa_muts.genbank.json" \
> --exclude-regex-paths "root\['annotations'\]\['.+'\]\['seqid'\]" "root\['annotations'\]\['.+'\]\['type'\]"
{}
Loading