Move test data to git submodule.

snakemake-workflows · Oct 11, 2017 · 73b1121 · 73b1121
1 parent e2dbe37
commit 73b1121
Show file tree

Hide file tree

Showing 12 changed files with 12 additions and 28,951 deletions.
diff --git a/.gitignore b/.gitignore
@@ -19,3 +19,5 @@ scripts/.snakemake*
 !.gitignore
 !.editorconfig
 !.gitattributes
+!.test
+!.test/data
diff --git a/.gitmodules b/.gitmodules
@@ -0,0 +1,3 @@
+[submodule ".test/data"]
+	path = .test/data
+	url = https://github.com/snakemake-workflows/ngs-test-data.git
diff --git a/.test/config.yaml b/.test/config.yaml
@@ -3,9 +3,9 @@ adapter: ACGGATCGATCGATCGATCGAT
 
 ref:
   # the STAR index
-  index: "ref/index"
+  index: "data/ref/index"
   # gtf file with transcripts
-  annotation: "ref/Homo_sapiens.GRCh38.90.chr21.gtf"
+  annotation: "data/ref/Homo_sapiens.GRCh38.90.chr21.gtf"
 
 pca:
   labels:

diff --git a/.test/data b/.test/data
diff --git a/.test/reads/a.1.fastq b/.test/reads/a.1.fastq
diff --git a/.test/reads/a.2.fastq b/.test/reads/a.2.fastq
diff --git a/.test/reads/b.1.fastq b/.test/reads/b.1.fastq
diff --git a/.test/reads/b.2.fastq b/.test/reads/b.2.fastq
diff --git a/.test/ref/Homo_sapiens.GRCh38.90.chr21.gtf b/.test/ref/Homo_sapiens.GRCh38.90.chr21.gtf
diff --git a/.test/ref/Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz b/.test/ref/Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz
diff --git a/.test/samples.tsv b/.test/samples.tsv
@@ -1,3 +1,3 @@
 sample	condition	fq1	fq2
-A	treated	reads/a.1.fastq	reads/a.2.fastq
-B	untreated	reads/b.1.fastq	reads/b.2.fastq
+A	treated	data/reads/a.chrMT.1.fastq	data/reads/a.chrMT.2.fastq
+B	untreated	data/reads/b.chrMT.1.fastq	data/reads/b.chrMT.2.fastq
diff --git a/.travis.yml b/.travis.yml
@@ -20,9 +20,8 @@ install:
   - conda create -q -n star star
   - source activate star
   # create STAR index (too big to live in git)
-  - mkdir .test/ref/index
-  - gzip -d .test/ref/Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz
-  - STAR --runMode genomeGenerate --genomeDir .test/ref/index --genomeFastaFiles .test/ref/Homo_sapiens.GRCh38.dna.chromosome.21.fa
+  - mkdir .test/data/ref/index
+  - STAR --runMode genomeGenerate --genomeDir .test/data/ref/index --genomeFastaFiles .test/data/ref/genome.chrMT.fa
 
 script:
   - source activate snakemake