Segmentation fault

[karved]

Some FASTA sequences break the code (Irrespective of the size).
So for example, there is a file with n seqs, when it reaches this particular seq 'X', the code breaks and displays segmentation fault.

I am attaching one such sequence and a terminal generated output when only ran for that sequence.

>NODE_275_length_155_cov_101.833333
TCGTCAACCCAGACAATCCGGTCATGGTCATAATCAGCATCAACAGCGATTTCGCGCTTT
TGATACACACAAAACATGGGATCTGACGTTATTCGATTGTCCTGTGTTCGAATATTTTCA
CCGATGATGCCAAACGAATCTGGTGCAGATTTTGT

Saving temp files to /tmp
Importing gene model...
Found MMseqs2 index at /tmp/balrog_mmseqs_index
Reading fasta...

contig 1 of 1 : length 155
Finding open reading frames...
Translating open reading frames...
Scoring longest open reading frames with gene model...
No GPU detected, using CPU...
Loading gene model...
Using cache found in /tmp/Markusjsommer_balrog_models_master
Scoring ORFs with gene model...
2  of  2
Calculating geneiness for all open reading frames...
Scoring potential start sites with TIS model...
No GPU detected, using CPU...
Loading TIS model...
Using cache found in /tmp/Markusjsommer_balrog_models_master
0  of  2
/tmp/balrog.tmp231493870:70: FutureWarning: The input object of type 'Tensor' is an array-like implementing one of the corresponding protocols (`__array__`, `__array_interface__` or `__array_struct__`); but not a sequence (or 0-D). In the future, this object will be coerced as if it was first converted using `np.array(obj)`. To retain the old behaviour, you have to either modify the type 'Tensor', or assign to an empty array created with `np.empty(correct_shape, dtype=object)`.
  y_pred_TIS = np.asarray(TIS_prob_list, dtype=float)
/tmp/balrog.tmp231493870:70: DeprecationWarning: setting an array element with a sequence. This was supported in some cases where the elements are arrays with a single element. For example `np.array([1, np.array([2])], dtype=int)`. In the future this will raise the same ValueError as `np.array([1, [2]], dtype=int)`.
2  of  2                     _prob_list, dtype=float)
Segmentation fault

[dgroves6]

Hi. I'm having the same issue for both the conda install and the source code compilation + build. This is one of my sequences that causes the bug.

>NODE_337_length_211_cov_28.714286
GTTTTCCTGTGCCGTCTTTCAGTACACCTGAAATCTTTACTGCCATATTCACCCCACAAA
AAAGCCCGCCTGAACCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTA
TAGCCGATACCCACGATGAAGCCGTCAGTGCGCCAGTCGCCACTGGCGGAACCTTCATAA
GCAAGGTCAATAACCACCGTCTCTACGGGAC

This is my output from the conda install:

Saving temp files to /tmp
Importing gene model...
Found MMseqs2 index at /tmp/balrog_mmseqs_index
Reading fasta...

contig 1 of 1 : length 211
Finding open reading frames...
Translating open reading frames...
Scoring longest open reading frames with gene model...
No GPU detected, using CPU...
Loading gene model...
Using cache found in /tmp/Markusjsommer_balrog_models_main
Scoring ORFs with gene model...
3  of  3
Calculating geneiness for all open reading frames...
Scoring potential start sites with TIS model...
No GPU detected, using CPU...
Loading TIS model...
Using cache found in /tmp/Markusjsommer_balrog_models_main
0  of  4
/tmp/balrog.tmp1678679881:70: FutureWarning: The input object of type 'Tensor' is an array-like implementing one of the corresponding protocols (`__array__`, `__array_interface__` or `__array_struct__`); but not a sequence (or 0-D). In the future, this object will be coerced as if it was first converted using `np.array(obj)`. To retain the old behaviour, you have to either modify the type 'Tensor', or assign to an empty array created with `np.empty(correct_shape, dtype=object)`.
  y_pred_TIS = np.asarray(TIS_prob_list, dtype=float)
/tmp/balrog.tmp1678679881:70: DeprecationWarning: setting an array element with a sequence. This was supported in some cases where the elements are arrays with a single element. For example `np.array([1, np.array([2])], dtype=int)`. In the future this will raise the same ValueError as `np.array([1, [2]], dtype=int)`.
4  of  4                     _prob_list, dtype=float)
Segmentation fault (core dumped)

And this is my output from the source compilation:

Saving temp files to /tmp
Importing gene model...
Importing TIS model...
Found MMseqs2 index at /tmp/balrog_mmseqs_index
Reading fasta...

contig 1 of 1 : length 211
Finding open reading frames...
Tensorizing open reading frames...
Scoring longest open reading frames with gene model...
  ⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿▏ 100.0% [   3/   3 | 17.3 Hz | 0s<0s]
Calculating geneiness for all open reading frames...
Scoring potential start sites with TIS model...
  ⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿⠿▏ 100.0% [   4/   4 | 22.0 Hz | 0s<0s]
Segmentation fault (core dumped)