|
| 1 | +{ |
| 2 | + "cells": [ |
| 3 | + { |
| 4 | + "cell_type": "raw", |
| 5 | + "metadata": { |
| 6 | + "vscode": { |
| 7 | + "languageId": "raw" |
| 8 | + } |
| 9 | + }, |
| 10 | + "source": [ |
| 11 | + "+++\n", |
| 12 | + "title = 'Minimizers are Just Fancy K-mers'\n", |
| 13 | + "date = 2024-09-04T08:00:00+00:00\n", |
| 14 | + "draft = true\n", |
| 15 | + "+++" |
| 16 | + ] |
| 17 | + }, |
| 18 | + { |
| 19 | + "cell_type": "markdown", |
| 20 | + "metadata": {}, |
| 21 | + "source": [ |
| 22 | + "\n", |
| 23 | + "Today I am picking up an old but influential paper. Cited over 400 times, the paper \"Reducing storage requirements for biological sequence comparison\" by [Roberts et al. (2004)](https://academic.oup.com/bioinformatics/article/20/18/3363/202143) has had considerable impact on the sequencing community. If you are using modern aligners, you relied on the ideas published in that paper. \n", |
| 24 | + "\n", |
| 25 | + "One notable paper citing this reference is the publication of Minimap2. It is the first citation in its method section, and as such definitely worth a read. \n", |
| 26 | + "\n", |
| 27 | + "## The Core Idea\n", |
| 28 | + "\n", |
| 29 | + "The core idea in the paper is that to compare sequences in the age of next generation sequencing (NGS) and large datasets one should use a smart way of reducing data to avoid having to compare each sequence to all other sequences. \n", |
| 30 | + "\n", |
| 31 | + "To solve that issue the authors present the concept of minimizer. \n", |
| 32 | + "\n", |
| 33 | + "Today I will implement that concept and see if I can identify meaningful minimizers.\n", |
| 34 | + "\n", |
| 35 | + "\n", |
| 36 | + "### Minimizers, what are they?\n", |
| 37 | + "\n", |
| 38 | + "Minimizers are a relatively simple idea. The key problem they try to solve is to provide good seeds, meaning locations where two sequences are identical, to kick-start an alignment of those two sequences. \n", |
| 39 | + "\n", |
| 40 | + "The most naive way of solving this would be to compute all k-mers of both sequences, find the common k-mers and try to align the sequences starting at each k-mer. But those k-mer databases would become huge. \n", |
| 41 | + "\n", |
| 42 | + "So to reduce that solution space, instead of storing all k-mers, minimizers are the \"smallest\" k-mers in a window. As long as the sequences share stretches of identical nucleotides large enough, they will also share the odd \"smallest\" k-mer. In reality one could also store the \"biggest\" k-mer. It really does not matter as long as the index and the query operation computes the order of the k-mers the same way. \n", |
| 43 | + "\n", |
| 44 | + "All that is left to do for each minimizer is to store its location in the sequence so that one can use it as a seed for an alignment if it is found in the query.\n", |
| 45 | + "\n", |
| 46 | + "\n", |
| 47 | + "## A Simple Implementation" |
| 48 | + ] |
| 49 | + }, |
| 50 | + { |
| 51 | + "cell_type": "code", |
| 52 | + "execution_count": 6, |
| 53 | + "metadata": {}, |
| 54 | + "outputs": [], |
| 55 | + "source": [ |
| 56 | + "import hashlib\n", |
| 57 | + "\n", |
| 58 | + "from pydantic import BaseModel\n", |
| 59 | + "\n", |
| 60 | + "\n", |
| 61 | + "class Kmer(BaseModel):\n", |
| 62 | + " kmer: str\n", |
| 63 | + "\n", |
| 64 | + " def __hash__(self):\n", |
| 65 | + " # Hashing function I am using to sort k-mers\n", |
| 66 | + " # Sorting lexicographically will lead to\n", |
| 67 | + " # uninformative k-mers such as AAAA\n", |
| 68 | + " return int(hashlib.md5(self.kmer.encode()).hexdigest(), 16)\n", |
| 69 | + "\n", |
| 70 | + " def __len__(self):\n", |
| 71 | + " return len(self.kmer)\n", |
| 72 | + "\n", |
| 73 | + " def __str__(self):\n", |
| 74 | + " return self.kmer\n", |
| 75 | + "\n", |
| 76 | + "\n", |
| 77 | + "class Minimizer(BaseModel):\n", |
| 78 | + " kmer: Kmer\n", |
| 79 | + " sequence_id: str\n", |
| 80 | + " position: int\n", |
| 81 | + "\n", |
| 82 | + " def __hash__(self):\n", |
| 83 | + " return int(\n", |
| 84 | + " hashlib.md5(f\"{self.kmer}{self.position}\".encode()).hexdigest(), 16\n", |
| 85 | + " )\n", |
| 86 | + "\n", |
| 87 | + " def __lt__(self, other):\n", |
| 88 | + " return hash(self.kmer) < hash(other.kmer)\n", |
| 89 | + "\n", |
| 90 | + " def __eq__(self, other):\n", |
| 91 | + " if not isinstance(other, Minimizer):\n", |
| 92 | + " raise ValueError(\"Can only compare to other Minimizer\")\n", |
| 93 | + " return self.kmer == other.kmer and self.position == other.position\n", |
| 94 | + " \n", |
| 95 | + " def __str__(self):\n", |
| 96 | + " return f\"'{self.kmer}' @ {self.sequence_id}: {self.position}\"\n", |
| 97 | + "\n", |
| 98 | + "\n", |
| 99 | + "minimizer = Minimizer(kmer=Kmer(kmer=\"ATCG\"), sequence_id=\"seq_1\", position=99)" |
| 100 | + ] |
| 101 | + }, |
| 102 | + { |
| 103 | + "cell_type": "markdown", |
| 104 | + "metadata": {}, |
| 105 | + "source": [ |
| 106 | + "These classes of Kmer and Minimizer implement the basic functionality that I need next, when I want to find the smallest Minimizer in a sequence. The way I implemented it, I can sort a list of Minimizers based on the hash." |
| 107 | + ] |
| 108 | + }, |
| 109 | + { |
| 110 | + "cell_type": "code", |
| 111 | + "execution_count": 7, |
| 112 | + "metadata": {}, |
| 113 | + "outputs": [ |
| 114 | + { |
| 115 | + "name": "stdout", |
| 116 | + "output_type": "stream", |
| 117 | + "text": [ |
| 118 | + "The k-mer with the lowest value is: 'B'\n" |
| 119 | + ] |
| 120 | + } |
| 121 | + ], |
| 122 | + "source": [ |
| 123 | + "kmers = [\"A\", \"B\", \"C\"]\n", |
| 124 | + "minimizers = [\n", |
| 125 | + " Minimizer(kmer=Kmer(kmer=kmer), position=position, sequence_id=\"1\")\n", |
| 126 | + " for position, kmer in enumerate(kmers)\n", |
| 127 | + "]\n", |
| 128 | + "sorted_minimizers = sorted(minimizers)\n", |
| 129 | + "print(f\"The k-mer with the lowest value is: '{sorted_minimizers[0].kmer}'\")" |
| 130 | + ] |
| 131 | + }, |
| 132 | + { |
| 133 | + "cell_type": "markdown", |
| 134 | + "metadata": {}, |
| 135 | + "source": [ |
| 136 | + "That's working well. Now I can get the Minimizers for a sequence along its windows and store them:" |
| 137 | + ] |
| 138 | + }, |
| 139 | + { |
| 140 | + "cell_type": "code", |
| 141 | + "execution_count": 8, |
| 142 | + "metadata": {}, |
| 143 | + "outputs": [], |
| 144 | + "source": [ |
| 145 | + "def windows(sequence: str, window_size: int):\n", |
| 146 | + " for i in range(len(sequence) - window_size + 1):\n", |
| 147 | + " yield i\n", |
| 148 | + "\n", |
| 149 | + "\n", |
| 150 | + "def get_minimizer(\n", |
| 151 | + " sequence_id: str, sequence: str, k: int, offset: int\n", |
| 152 | + ") -> Minimizer:\n", |
| 153 | + " all_kmers = []\n", |
| 154 | + " for i in range(len(sequence) - k + 1):\n", |
| 155 | + " kmer = sequence[i : i + k]\n", |
| 156 | + " all_kmers.append(\n", |
| 157 | + " Minimizer(\n", |
| 158 | + " kmer=Kmer(kmer=kmer),\n", |
| 159 | + " sequence_id=sequence_id,\n", |
| 160 | + " position=offset + i,\n", |
| 161 | + " )\n", |
| 162 | + " )\n", |
| 163 | + " all_kmers.sort()\n", |
| 164 | + "\n", |
| 165 | + " return all_kmers[0]\n", |
| 166 | + "\n", |
| 167 | + "\n", |
| 168 | + "def minimizers(\n", |
| 169 | + " sequence_id: str, sequence: str, w: int, k: int, unique: bool = True\n", |
| 170 | + ") -> list[dict]:\n", |
| 171 | + " minimizers = []\n", |
| 172 | + "\n", |
| 173 | + " for offset, start in enumerate(windows(sequence, w)):\n", |
| 174 | + " window = sequence[start : start + w]\n", |
| 175 | + " minimizers.append(get_minimizer(sequence_id, window, k, offset))\n", |
| 176 | + "\n", |
| 177 | + " if unique:\n", |
| 178 | + " minimizers = list(set(minimizers))\n", |
| 179 | + " return minimizers" |
| 180 | + ] |
| 181 | + }, |
| 182 | + { |
| 183 | + "cell_type": "markdown", |
| 184 | + "metadata": {}, |
| 185 | + "source": [ |
| 186 | + "These basic functions is all I really need to get the Minimizers of a sequence given a `window size` and a `k`." |
| 187 | + ] |
| 188 | + }, |
| 189 | + { |
| 190 | + "cell_type": "code", |
| 191 | + "execution_count": 15, |
| 192 | + "metadata": {}, |
| 193 | + "outputs": [ |
| 194 | + { |
| 195 | + "name": "stdout", |
| 196 | + "output_type": "stream", |
| 197 | + "text": [ |
| 198 | + "Collected 7 minimizers\n", |
| 199 | + "The first three Minimizers:\n", |
| 200 | + "'Hello W' @ seq_1: 0\n", |
| 201 | + "'llo Wor' @ seq_1: 2\n", |
| 202 | + "' World,' @ seq_1: 5\n" |
| 203 | + ] |
| 204 | + } |
| 205 | + ], |
| 206 | + "source": [ |
| 207 | + "example_sequence = \"Hello World, this is a sequence.\"\n", |
| 208 | + "\n", |
| 209 | + "k = 7\n", |
| 210 | + "window_size = 12\n", |
| 211 | + "\n", |
| 212 | + "sequence_minimizers = minimizers(\n", |
| 213 | + " sequence_id=\"seq_1\",\n", |
| 214 | + " sequence=example_sequence,\n", |
| 215 | + " w=window_size,\n", |
| 216 | + " k=k,\n", |
| 217 | + ")\n", |
| 218 | + "sequence_minimizers.sort(key=lambda x: x.position) # sort by position for displaying\n", |
| 219 | + "\n", |
| 220 | + "print(f\"Collected {len(sequence_minimizers)} minimizers\")\n", |
| 221 | + "print(\"The first three Minimizers:\")\n", |
| 222 | + "for i in range(3):\n", |
| 223 | + " print(sequence_minimizers[i])" |
| 224 | + ] |
| 225 | + }, |
| 226 | + { |
| 227 | + "cell_type": "markdown", |
| 228 | + "metadata": {}, |
| 229 | + "source": [ |
| 230 | + "Now that I can get the Minimizers I can also find the common Minimizers between two sequences." |
| 231 | + ] |
| 232 | + }, |
| 233 | + { |
| 234 | + "cell_type": "code", |
| 235 | + "execution_count": 16, |
| 236 | + "metadata": {}, |
| 237 | + "outputs": [ |
| 238 | + { |
| 239 | + "name": "stdout", |
| 240 | + "output_type": "stream", |
| 241 | + "text": [ |
| 242 | + "Common kmer: ATACGCAT\n", |
| 243 | + "atgctagcATACGCATcacgcatc\n", |
| 244 | + "ggatcagctcgagcATACGCATacgcatcgcatcgat\n", |
| 245 | + "\n", |
| 246 | + "Common kmer: ATACGCAT\n", |
| 247 | + "atgctagcATACGCATcacgcatc\n", |
| 248 | + "ggatcagctcgagcatacgcATACGCATcgcatcgat\n", |
| 249 | + "\n", |
| 250 | + "Common kmer: TACGCATC\n", |
| 251 | + "atgctagcaTACGCATCacgcatc\n", |
| 252 | + "ggatcagctcgagcatacgcaTACGCATCgcatcgat\n", |
| 253 | + "\n", |
| 254 | + "Common kmer: AGCATACG\n", |
| 255 | + "atgctAGCATACGcatcacgcatc\n", |
| 256 | + "ggatcagctcgAGCATACGcatacgcatcgcatcgat\n", |
| 257 | + "\n" |
| 258 | + ] |
| 259 | + } |
| 260 | + ], |
| 261 | + "source": [ |
| 262 | + "def visualize_minimizer(seq: str, minimizer: Minimizer) -> str:\n", |
| 263 | + " before = seq[: minimizer.position].lower()\n", |
| 264 | + " after = seq[minimizer.position + len(minimizer.kmer) :].lower()\n", |
| 265 | + " return f\"{before}{str(minimizer.kmer.kmer).upper()}{after}\"\n", |
| 266 | + "\n", |
| 267 | + "\n", |
| 268 | + "def compare_sequences(seq1: str, seq2: str, w: int, k: int) -> list[dict]:\n", |
| 269 | + " minimizers1 = minimizers(\"seq_1\", seq1, w, k)\n", |
| 270 | + " minimizers2 = minimizers(\"seq_2\", seq2, w, k)\n", |
| 271 | + "\n", |
| 272 | + " minimizer_set1 = {m.kmer for m in minimizers1}\n", |
| 273 | + " minimizer_set2 = {m.kmer for m in minimizers2}\n", |
| 274 | + "\n", |
| 275 | + " common_minimizers = minimizer_set1.intersection(minimizer_set2)\n", |
| 276 | + "\n", |
| 277 | + " # Prepare results\n", |
| 278 | + " comparison_results = []\n", |
| 279 | + " for minimizer in common_minimizers:\n", |
| 280 | + " # find the substrings that match and show that\n", |
| 281 | + " for i in [m for m in minimizers1 if m.kmer == minimizer]:\n", |
| 282 | + " for j in [m for m in minimizers2 if m.kmer == minimizer]:\n", |
| 283 | + " print(f\"Common kmer: {minimizer.kmer}\")\n", |
| 284 | + " print(visualize_minimizer(seq1, i))\n", |
| 285 | + " print(visualize_minimizer(seq2, j))\n", |
| 286 | + " print(\"\")\n", |
| 287 | + "\n", |
| 288 | + " return comparison_results\n", |
| 289 | + "\n", |
| 290 | + "\n", |
| 291 | + "sequence1 = \"ATGCTAGCATACGCATCACGCATC\"\n", |
| 292 | + "sequence2 = \"GGATCAGCTCGAGCATACGCATACGCATCGCATCGAT\"\n", |
| 293 | + "\n", |
| 294 | + "w = 10 # Window size\n", |
| 295 | + "k = 8 # k-mer size\n", |
| 296 | + "comparison_results = compare_sequences(sequence1, sequence2, w, k)" |
| 297 | + ] |
| 298 | + }, |
| 299 | + { |
| 300 | + "cell_type": "markdown", |
| 301 | + "metadata": {}, |
| 302 | + "source": [ |
| 303 | + "This implementation shows how easy it is for this approach to find appropriate seed locations for starting a pairwise alignment. \n", |
| 304 | + "\n", |
| 305 | + "The paper goes more into detail and also introduces the concept of End-minimizers. I can only recommend checking it out.\n", |
| 306 | + "\n", |
| 307 | + "Thats all I have today. I hope it was interesting. " |
| 308 | + ] |
| 309 | + } |
| 310 | + ], |
| 311 | + "metadata": { |
| 312 | + "kernelspec": { |
| 313 | + "display_name": "reproduce_hic", |
| 314 | + "language": "python", |
| 315 | + "name": "python3" |
| 316 | + }, |
| 317 | + "language_info": { |
| 318 | + "codemirror_mode": { |
| 319 | + "name": "ipython", |
| 320 | + "version": 3 |
| 321 | + }, |
| 322 | + "file_extension": ".py", |
| 323 | + "mimetype": "text/x-python", |
| 324 | + "name": "python", |
| 325 | + "nbconvert_exporter": "python", |
| 326 | + "pygments_lexer": "ipython3", |
| 327 | + "version": "3.11.0" |
| 328 | + } |
| 329 | + }, |
| 330 | + "nbformat": 4, |
| 331 | + "nbformat_minor": 2 |
| 332 | +} |
0 commit comments