Skip to content
/ Carrot_Genome_DH1_v3 Public

Program versions and custom scripts used for creating the carrot genome DCv3 (PRJNA285926)

License

GPL-3.0 license
7 stars 1 fork Branches Tags Activity
Star
Notifications You must be signed in to change notification settings

dsenalik/Carrot_Genome_DH1_v3

BranchesTags

Repository files navigation

Population genomics identifies genetic signatures of carrot domestication and improvement and uncovers the origin of high carotenoid orange carrots

This repository contains scripts used for the following publication:
Placeholder for reference to publication

Genome Assembly

Genome Assembly Phase I

Polishing

Scaffolding

  • BWA mem (0.7.17)
    reference: Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009).

  • SALSA2 (V2.3)
    200 iterations and GATC as the restriction site
    reference: Ghurye, J. et al. Integrating Hi-C links with assembly graphs for chromosome-scale assembly. PLOS Computational Biology 15, e1007273, doi:10.1371/journal.pcbi.1007273 (2019).

Gap Fill

  • PBJelly (V15.8.24)
    parameters: --minMatch 8 --minPctIdentity 80 --bestn 1 --nCandidates 20 --maxScore -500 --nproc 39 --noSplitSubreads
    reference: English, A. C. et al. Mind the gap: upgrading genomes with Pacific Biosciences RS long-read sequencing technology. PLoS One 7, e47768, doi:10.1371/journal.pone.0047768 (2012).

Genome Assembly Phase II

  • BWA mem (0.7.17)
    filtered for MAPQ>=10 and marker sequences with mapping frequency of >1 were discarded
    reference: Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754-1760, [ doi:10.1093/bioinformatics/btp324 (2009).

  • STAR (V 2.7.10a)
    parameters: --outSAMstrandField intronMotif --outSAMattrIHstart 0 --outFilterMismatchNmax 2 --outSAMtype BAM SortedByCoordinate
    reference: Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21, doi:10.1093/bioinformatics/bts635 (2012).

  • BWA mem (0.7.17)
    parameters: -5 -t 44

  • sort
    parameters: -k3,3d -k7,7d

  • juicer_tools.1.8.9_jcuda.0.8.jar
    parameters: pre -q 10
    reference: Durand, N. C. et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell Syst 3, 95-98, doi:10.1016/j.cels.2016.07.002 (2016).

  • A custom program was used to visualize and identify connections of PE sequences (PE BACs, 10, 20 and 40 kb MPE) to other scaffolds or contigs

Genome Assembly Phase III

  • RaGOO (V1.1)
    parameters: -C -t 43 -i 0.3
    reference: Alonge, M. et al. RaGOO: fast and accurate reference-guided scaffolding of draft genomes. Genome Biology 20, 224, doi:10.1186/s13059-019-1829-6 (2019).

  • LR-Gapcloser (Version 3, 29 June 2007)
    parameters: -s p -t 40 -r 5
    reference: Xu, G.-C. et al. LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly. GigaScience 8, doi:10.1093/gigascience/giy157 (2018).

Organellar Genome Assembly

Assembly Quality Verification

Sequence contamination assessment

  • Fastq-Screen (V0.4.14)
    reference: Wingett, S. & Andrews, S. FastQ Screen: A tool for multi-genome mapping and quality control [version 2; peer review: 4 approved]. F1000Research 7, doi:10.12688/f1000research.15931.2 (2018).

  • GC content distribution estimates also done by Fastq-Screen

Linkage map marker mapping

  • BWA mem (0.7.17)
    reference: Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009).

Gene space coverage

Repetitive Sequence Annotation

De Novo detection

Masking

Identification, annotation, and age analysis of LTR-RTs

  • LTRharvest (GenomeTools v.1.6.1)
    parameters: -seed 80 -maxlenltr 4000 -mindistltr 3000 -mintsd 2 -maxtsd 20 -motif tgca
    reference: Ellinghaus, D., Kurtz, S. & Willhoeft, U. LTRharvest, an efficient and flexible software for de novo detection of LTR retrotransposons. BMC Bioinformatics 9, 18, doi:10.1186/1471-2105-9-18 (2008).

  • SiLiX (v1.2.9)
    parameters: --ident 0.6 --overlap 0.7
    reference: Miele, V., Penel, S. & Duret, L. Ultra-fast sequence clustering from similarity networks with SiLiX. BMC Bioinformatics 12, 116, https://doi.org/10.1186/1471-2105-12-116 (2011).

  • DANTE (v.1.1.0)
    reference: Novák, P., Neumann, P. & Macas, J. (2010) Graph-based clustering and characterization of repetitive sequences in next-generation sequencing data. BMC Bioinformatics, 11, 378.
    reference: Novák, P., Neumann, P. & Macas, J. (2020b) Global analysis of repetitive DNA from unassembled sequence reads using RepeatExplorer2. Nature Protocols, 15(11), 3745–3776.

  • Mafft (v.7.471)
    parameters: default settings
    reference: Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30, 772-780, doi:10.1093/molbev/mst010 (2013).

  • R ‘ape’ package (v.5.4-1)
    parameters: “K80” model
    reference: Paradis, E. & Schliep, K. ape 5.0: an environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics 35, 526-528, doi:10.1093/bioinformatics/bty633 (2018).

  • HelitronScanner
    parameters: default settings
    reference: Xiong, W., He, L., Lai, J., Dooner, H. K. & Du, C. HelitronScanner uncovers a large overlooked cache of Helitron transposons in many plant genomes. Proceedings of the National Academy of Sciences 111, 10263-10268, doi:10.1073/pnas.1410068111 (2014).

Quality of the assembled repetitive sequences

  • LTR Assembly Index (LAI)
    reference: Ou, S., Chen, J. & Jiang, N. Assessing genome assembly quality using the LTR Assembly Index (LAI). Nucleic Acids Research 46, e126-e126, doi:10.1093/nar/gky730 (2018).

Detection of centromere repeats

  • Centromere motif used
TCAACTTCAAACGAGTCTGGAATGAAGCTACAAGTTGTTT
CCAACTTCAATCTAGYCAATAATGAAGCWACAAGTTGTTT
CCRGGCTCAAACGAGTCAAGAATGAAACTACAAGTTGATT
CYAATTTYAAAC AACCGAAAATGAAGCTACAAGTTGTTT

Gene Prediction and Genome Annotation

RNA-seq from 20 DH1 tissues

  • STAR (V 2.7.10a)
    parameters: --outSAMstrandField intronMotif --outSAMattrIHstart 0 --outFilterMismatchNmax 2 --outSAMtype BAM SortedByCoordinate
    reference: Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21, doi:10.1093/bioinformatics/bts635 (2012).

  • StringTie (V1.3.5)
    parameters: -m 50 -c 1 -f 0.01
    source: https://ccb.jhu.edu/software/stringtie/
    reference: Pertea, M. et al. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nature Biotechnology 33, 290-295, doi:10.1038/nbt.3122 (2015).

  • Cytoscape (v3.9)
    reference: Shannon, P. et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13, 2498-2504, doi:10.1101/gr.1239303 (2003).
    reference: Szklarczyk, D. et al. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 43, D447-452, doi:10.1093/nar/gku1003 (2015).

  • BioConductor (v4.2.1)
    source: https://www.bioconductor.org/

  • MCODE (v?)
    reference: Bader, G. D. & Hogue, C. W. V. An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinformatics 4, 2, doi:10.1186/1471-2105-4-2 (2003).

PacBio IsoSeq transcripts

Gene Model Prediction with MAKER

  • MAKER (v3.01.03)
    reference: Holt, C. & Yandell, M. MAKER2: an annotation pipeline and genome-database management tool for second-generation genome projects. BMC Bioinformatics 12, 491, doi:10.1186/1471-2105-12-491 (2011).
    parameters:
est_pass=0
altest_pass=0
protein_pass=0
rm_pass=0
model_pass=0
pred_pass=0
other_pass=0
prok_rm=0
softmask=1
est2genome=0
protein2genome=0
trna=0
unmask=1
cpus=1
max_dna_len=500000
min_contig=1
pred_flank=200
pred_stats=0
AED_threshold=1
min_protein=0
alt_splice=0
always_complete=0
map_forward=0
keep_preds=0
split_hit=2500
single_exon=0
single_length=100
correct_est_fusion=0
tries=2
clean_try=0
clean_up=0

Gene Model Prediction with GeMoMa

  • GeMoMa (v1.6)
    reference: Keilwagen, J., Hartung, F. & Grau, J. GeMoMa: Homology-Based Gene Prediction Utilizing Intron Position Conservation and RNA-seq Data. Methods Mol Biol 1962, 161-177, doi:10.1007/978-1-4939-9173-0_9 (2019).

Gene Model Curation

  • GMAP (V2021-08-25)
    reference: Wu, T. D. & Watanabe, C. K. GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 21, 1859-1875, doi:10.1093/bioinformatics/bti310 (2005).

  • GenomeThreader (V2021-08-25)
    reference: Gremme, G., Brendel, V., Sparks, M. E. & Kurtz, S. Engineering a software tool for gene structure prediction in higher organisms. Information and Software Technology 47, 965-978, doi:https://doi.org/10.1016/j.infsof.2005.09.005 (2005).

Gene Annotation and Quality Verification

  • Blast2Go (OmicsBox 3.0.29)
    reference: Conesa, A. et al. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674-3676, doi:10.1093/bioinformatics/bti610 (2005).

  • PlantTFcat (Downloaded on Dec 2020)
    reference: Dai, X., Sinharoy, S., Udvardi, M. & Zhao, P. X. PlantTFcat: an online plant transcription factor and transcriptional regulator categorization and analysis tool. BMC Bioinformatics 14, 321, doi:10.1186/1471-2105-14-321 (2013).

  • PRGdb (v3.0)
    reference: Osuna-Cruz, C. M. et al. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes. Nucleic Acids Res 46, D1197-d1201, doi:10.1093/nar/gkx1119 (2018).

  • Verification when submitting to NCBI
    A list of genes manually curated based on the validation during the submission to NCBI: gene_prediction/24.report.20220211.tsv
    script: gene_prediction/24.makereport.pl

Non-coding RNAs

  • INFERNAL (v1.1.2)
    parameters: Rfam database (v13.0) and the p-value of <0.05
    reference: Nawrocki, E. P. & Eddy, S. R. Infernal 1.1: 100-fold faster RNA homology searches. Bioinformatics 29, 2933-2935, doi:10.1093/bioinformatics/btt509 (2013).

Isoform Analysis

  • Sqanti3 (v4.1)
    reference: Tardaguila, M. et al. SQANTI: extensive characterization of long-read transcript sequences for quality control in full-length transcriptome identification and quantification. Genome Res 28, 396-411, doi:10.1101/gr.222976.117 (2018).

Resequencing and Phenotyping

Phenotyping

  • Scripts and datafiles related to phenotyping can be found in /phenotype/

Variant Detection

Mapping

  • BWA (v 0.7.17-r1188)
    parameters: -a -M -t 2 -R readgroup
    reference: Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009).

  • The Genome Analysis Toolkit (GATK) v4.0.7.0
    example script for one genotype: variant_detection/job1800.sh
    example joint genotyping script for one region: variant_detection/template.jointgenodcarv3d.sh
    reference: McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297-1303, doi:10.1101/gr.107524.110 (2010).

  • BCFtools (v1.9)
    parameters: view -e 'F_MISSING >= 0.1' -Oz
    reference: Narasimhan, V. et al. BCFtools/RoH: a hidden Markov model approach for detecting autozygosity from next-generation sequencing data. Bioinformatics 32, 1749-1751, doi:10.1093/bioinformatics/btw044 (2016).

Genotyping the Y2 insertion

Population structure, phylogenetic, PCA and gene flow analysis

Population Genetic Ancestry

  • Plink (v1.90b3.44)
    parameters: --indep 50 5 2
    reference: Purcell, S. et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81, 559-575, doi:10.1086/519795 (2007).

  • PHYLIP (v3.696)
    reference: Felsenstein, J. PHYLIP (phylogeny inference package), version 3.5 c. (Joseph Felsenstein., 1993).

  • ggtree
    reference: Yu, G., Smith, D. K., Zhu, H., Guan, Y. & Lam, T. T.-Y. ggtree: an r package for visualization and annotation of phylogenetic trees with their covariates and other associated data. Methods in Ecology and Evolution 8, 28-36, doi:https://doi.org/10.1111/2041-210X.12628 (2017).

Principal Component Analysis

  • snpgdsPCA implemented in the R package SNPRelate (v1.20.1)
    reference: Zheng, X. et al. A high-performance computing toolset for relatedness and principal component analysis of SNP data. Bioinformatics 28, 3326-3328, doi:10.1093/bioinformatics/bts606 (2012).

Gene Flow

  • TreeMix (v1.12)
    reference: Pickrell, J. K. & Pritchard, J. K. Inference of Population Splits and Mixtures from Genome-Wide Allele Frequency Data. PLOS Genetics 8, e1002967, doi:10.1371/journal.pgen.1002967 (2012).

  • OptM (v0.1.6)
    reference: Fitak, R. R. OptM: estimating the optimal number of migration edges on population trees using Treemix. Biology Methods and Protocols 6, bpab017, doi:10.1093/biomethods/bpab017 (2021).

Genetic diversity, FST, linkage disequilibrium and demographic analysis

Pairwise FST and nucleotide diversity (pi)

  • VCFtools (v0.1.14)
    reference: Weir, B. S. & Cockerham, C. C. Estimating F-Statistics for the Analysis of Population Structure. Evolution 38, 1358-1370, doi:10.2307/2408641 (1984).

Nucleotide diversity using Pixy

LD Decay

  • PopLDdecay (v3.31)
    parameters: -OutStat
    reference: Zhang, C., Dong, S. S., Xu, J. Y., He, W. M. & Yang, T. L. PopLDdecay: a fast and effective tool for linkage disequilibrium decay analysis based on variant call format files. Bioinformatics 35, 1786-1788, doi:10.1093/bioinformatics/bty875 (2019).

Estimates of effective population size history and divergence times

Genome-Wide Scans for Signatures of Selection

Region Identification

  • VCFtools (v0.1.14)
    reference: Danecek, P. et al. The variant call format and VCFtools. Bioinformatics (Oxford, England) 27, 2156-2158, doi:10.1093/bioinformatics/btr330 (2011).

  • XP-CLR (v1.0)
    reference: Chen, H., Patterson, N. & Reich, D. Population differentiation as a test for selective sweeps. Genome Research 20, 393-402 (2010).

GWA analysis

GWA Analysis

Scripts and parameters for this section can be found in /genotype/

  • vcftools (v0.1.16)
    reference: Weir, B. S. & Cockerham, C. C. Estimating F-Statistics for the Analysis of Population Structure. Evolution 38, 1358-1370, doi:10.2307/2408641 (1984).

  • Beagle (v5.0)
    parameters: default settings
    reference: Browning, S. R. & Browning, B. L. Rapid and Accurate Haplotype Phasing and Missing-Data Inference for Whole-Genome Association Studies By Use of Localized Haplotype Clustering. The American Journal of Human Genetics 81, 1084-1097, doi:10.1086/521987 (2007).

  • Tassel (v5)
    reference: Bradbury, P. J. et al. TASSEL: software for association mapping of complex traits in diverse samples. Bioinformatics 23, 2633-2635, doi:10.1093/bioinformatics/btm308 (2007).

  • GAPIT (custom modified version of 2020.10.24 Gapit 3.0)
    script: GWA/GWA.R.txt
    reference: Lipka, A. E. et al. GAPIT: genome association and prediction integrated tool. Bioinformatics 28, 2397-2399, doi:10.1093/bioinformatics/bts444 (2012).

  • simpleM
    reference: Gao, X., Starmer, J. & Martin, E. R. A multiple testing correction method for genetic association studies using correlated single nucleotide polymorphisms. Genet Epidemiol 32, 361-369, doi:10.1002/gepi.20310 (2008).

  • R package qqman (v0.1.8)
    reference: Turner, S. qqman: an R package for visualizing GWAS results using Q-Q and manhattan plots. (2014).

Significance Threshold

  • simpleM (version July 2, 2009)
    script: GWA/simpleMSigThreshold.R.txt
    reference: Gao, X., Starmer, J. & Martin, E. R. A multiple testing correction method for genetic association studies using correlated single nucleotide polymorphisms. Genet Epidemiol 32, 361-369, doi:10.1002/gepi.20310 (2008).

Manhattan Plots

  • qqman (v0.1.8)
    script: GWA/qqman4Manhattanplots.R
    reference: Turner, S. qqman: an R package for visualizing GWAS results using Q-Q and manhattan plots. (2014).

RNAseq analysis for Or and Y2

Transcriptome profile of candidate genes underlying the Or and Y2 locus

  • TRIMMOMATIC (v0.36)
    reference: Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120, doi:10.1093/bioinformatics/btu170 (2014).

  • Rsubread (v2.14.1) in R 3.5.0
    reference: Liao, Y., Smyth, G. K. & Shi, W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res 47, e47, doi:10.1093/nar/gkz114 (2019).

  • FeatureCounts (v2.14.1) in R 3.5.0
    reference: Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930, doi:10.1093/bioinformatics/btt656 (2014).

  • Limma (v3.56.1)
    reference: Weir, B. S. & Cockerham, C. C. Estimating F-Statistics for the Analysis of Population Structure. Evolution 38, 1358-1370, doi:10.2307/2408641 (1984).

Genetic effect and interaction analysis

Alternative genetic effects including additive, dominance, recessive and over-dominance

  • lm in R 3.5.0
    reference: Everitt, B. Book reviews: Chambers JM, Hastie TJ eds 1992: Statistical models in S. California: Wadsworth and Brooks/Cole. ISBN 0 534 16765-9. Statistical Methods in Medical Research 1, 220-221, doi:10.1177/096228029200100208 (1992).

About

Program versions and custom scripts used for creating the carrot genome DCv3 (PRJNA285926)

Resources

Readme

License

GPL-3.0 license
Activity

Stars

7 stars

Watchers

1 watching

Forks

1 fork
Report repository

Releases

No releases published

Packages

No packages published

Languages