Removed murmur3 (#33)

lib/mash/example_test.go

@@ -2,15 +2,16 @@ package mash_test
 
 import (
 	"fmt"
+	"hash/crc32"
 
 	"github.com/koeng101/dnadesign/lib/mash"
 )
 
 func ExampleMash() {
-	fingerprint1 := mash.New(17, 10)
+	fingerprint1 := mash.New(17, 10, crc32.NewIEEE())
 	fingerprint1.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
-	fingerprint2 := mash.New(17, 9)
+	fingerprint2 := mash.New(17, 9, crc32.NewIEEE())
 	fingerprint2.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
 	distance := fingerprint1.Distance(fingerprint2)

lib/mash/mash.go

@@ -43,24 +43,28 @@ Tim
 package mash
 
 import (
+	"encoding/binary"
+	"hash"
 	"sort"
+)
 
-	"github.com/koeng101/dnadesign/lib/mash/murmur3"
-) // murmur3 is a fast non-cryptographic hash algorithm that was also used in the original papers-> https://github.com/shenwei356/go-hashing-kmer-bench
+// murmur3 is a fast non-cryptographic hash algorithm that was also used in the original papers-> https://github.com/shenwei356/go-hashing-kmer-bench
 
 // Mash is a collection of hashes of kmers from a given sequence.
 type Mash struct {
-	KmerSize   int      // The kmer size is the size of the sliding window that is used to generate the hashes.
-	SketchSize int      // The sketch size is the number of hashes to store.
-	Sketches   []uint32 // The sketches are the hashes of the kmers that we can compare to other sketches.
+	KmerSize   int       // The kmer size is the size of the sliding window that is used to generate the hashes.
+	SketchSize int       // The sketch size is the number of hashes to store.
+	Sketches   []uint32  // The sketches are the hashes of the kmers that we can compare to other sketches.
+	Hash       hash.Hash // Hash is the go standard library hashing interface. Can be used to switch algorithms.
 }
 
 // New initializes a new mash sketch.
-func New(kmerSize int, sketchSize int) *Mash {
+func New(kmerSize int, sketchSize int, hashInterface hash.Hash) *Mash {
 	return &Mash{
 		KmerSize:   kmerSize,
 		SketchSize: sketchSize,
 		Sketches:   make([]uint32, sketchSize),
+		Hash:       hashInterface,
 	}
 }
 
@@ -73,7 +77,8 @@ func (mash *Mash) Sketch(sequence string) {
 	for kmerStart := 0; kmerStart < len(sequence)-mash.KmerSize; kmerStart++ {
 		kmer := sequence[kmerStart : kmerStart+mash.KmerSize]
 		// hash the kmer to a 32 bit number
-		hash := murmur3.Sum32([]byte(kmer))
+		hashBytes := mash.Hash.Sum([]byte(kmer))
+		hash := binary.BigEndian.Uint32(hashBytes[:4]) // need to convert []byte to uint32
 		// keep the minimum hash value of all the kmers in the window up to a given sketch size
 		// the sketch is a vector of the minimum hash values
 

lib/mash/mash_test.go

@@ -1,16 +1,17 @@
 package mash_test
 
 import (
+	"hash/crc32"
 	"testing"
 
 	"github.com/koeng101/dnadesign/lib/mash"
 )
 
 func TestMash(t *testing.T) {
-	fingerprint1 := mash.New(17, 10)
+	fingerprint1 := mash.New(17, 10, crc32.NewIEEE())
 	fingerprint1.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
-	fingerprint2 := mash.New(17, 9)
+	fingerprint2 := mash.New(17, 9, crc32.NewIEEE())
 	fingerprint2.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
 	distance := fingerprint1.Distance(fingerprint2)
@@ -23,36 +24,36 @@ func TestMash(t *testing.T) {
 		t.Errorf("Expected distance to be 0, got %f", distance)
 	}
 
-	spoofedFingerprint := mash.New(17, 10)
+	spoofedFingerprint := mash.New(17, 10, crc32.NewIEEE())
 	spoofedFingerprint.Sketches[0] = 0
 
 	distance = fingerprint1.Distance(spoofedFingerprint)
 	if distance != 1 {
 		t.Errorf("Expected distance to be 1, got %f", distance)
 	}
 
-	spoofedFingerprint = mash.New(17, 9)
+	spoofedFingerprint = mash.New(17, 9, crc32.NewIEEE())
 
 	distance = fingerprint1.Distance(spoofedFingerprint)
 	if distance != 1 {
 		t.Errorf("Expected distance to be 1, got %f", distance)
 	}
 
-	fingerprint1 = mash.New(17, 10)
+	fingerprint1 = mash.New(17, 10, crc32.NewIEEE())
 	fingerprint1.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
-	fingerprint2 = mash.New(17, 5)
+	fingerprint2 = mash.New(17, 5, crc32.NewIEEE())
 	fingerprint2.Sketch("ATCGATCGATCGATCGATCGATCGATCGATCGATCGAATGCGATCGATCGATCGATCGATCG")
 
 	distance = fingerprint1.Distance(fingerprint2)
 	if !(distance > 0.19 && distance < 0.21) {
 		t.Errorf("Expected distance to be 0.19999999999999996, got %f", distance)
 	}
 
-	fingerprint1 = mash.New(17, 10)
+	fingerprint1 = mash.New(17, 10, crc32.NewIEEE())
 	fingerprint1.Sketch("ATCGATCGATCGATCGATCGATCGATCGATCGATCGAATGCGATCGATCGATCGATCGATCG")
 
-	fingerprint2 = mash.New(17, 5)
+	fingerprint2 = mash.New(17, 5, crc32.NewIEEE())
 	fingerprint2.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
 	distance = fingerprint1.Distance(fingerprint2)
@@ -62,10 +63,10 @@ func TestMash(t *testing.T) {
 }
 
 func BenchmarkMashDistancee(b *testing.B) {
-	fingerprint1 := mash.New(17, 10)
+	fingerprint1 := mash.New(17, 10, crc32.NewIEEE())
 	fingerprint1.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
-	fingerprint2 := mash.New(17, 9)
+	fingerprint2 := mash.New(17, 9, crc32.NewIEEE())
 	fingerprint2.Sketch("ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA")
 
 	for i := 0; i < b.N; i++ {