Script to reformat the EzBioCloud database to be used with mg_classifier.
The EzBioCloud database is not publicly available (although it is free for academia); you can ask for it here: http://www.ezbiocloud.net/resources/pipelines.
You´ll have to formatted to be able to used it with mg_classifier.
You have to make the script executable (chmod +x db_reformatter.sh) and then run it:
$ ./db_reformatter.sh eztaxon_qiime_full.fasta eztaxon_id_taxonomy.txt
The order of files is important, first the fasta file and then the taxonomy file.
You will get a new fasta file in the following format:
>100000:Eukarya;Viridiplantae;Streptophyta;Jungermanniopsida;Pallaviciniales;Pallaviciniaceae;Pallavicinia;Pallavicinia_lyellii
TTACCTAATTGGTGAGGCAATGGCTCACCAAGGCGACGATCACTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCTTACGGGAGGCAGCAGTGGGGAATTTTCCGCAATGGGCGAGAGCCTGACGGAGCAATGCCGCGTGGAGGTACAAGGCTCACGGGTCGTAAACTCCTTTTCTCGGAGAAGATGCAATGACGGTATCCGAGGAATAAGCATCGGCTAACTCTGTGCCACCAGCCGCGGTAAGACAGAGGA
>100001:Eukarya;Viridiplantae;Streptophyta;Jungermanniopsida;Pallaviciniales;Pallaviciniaceae;Symphyogyna;Symphyogyna_circinata
GTACACATGCAAGTCGGACGGGGAGCATCCTAGTGATGTTTTCAGTGGCGGACGGGTGAGTAACGCGTAAGAACCTGCCCCTGGGAGGGGGACAACAGCTGGAAACGGTTGCTAATACCCCGTAGGCTGAGGAGCAAAAGGAGGGATCCGCCCAAGGAGGGGCTTGCGTCTGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCTTACGGGAGGCAGCAGTGGGGAATTTTCCGCAATGGGCGAGAGCCTGACGGAGCAATGCCGCGTGGAGGTAGAAGGCTCACGGGTCGTAAACTCCTTTTCTCGGAGAAGATGCAATGACGGTATCCGAGGAATAAGCATCGGC
The EzBioCloud database has some illegal characters (. and -) that produce an error when converting it from a fasta file to an udb-type database; the udb is more efficient than a fasta file for many searching purposes. You can convert it with vsearch. You should replace this illegal characters before converting. You can replace them with an underscore (_): sed -i 's/\./_/g; s/-/_/g' EzBioCloud.fasta
vsearch --makeudb_usearch EzBioCloud.fasta --output EzBioCloud.udb