Skip to content

Latest commit

 

History

History
executable file
·
110 lines (80 loc) · 2.51 KB

quick_start.md

File metadata and controls

executable file
·
110 lines (80 loc) · 2.51 KB
Raw

Quick start

CeleScope contains interfaces multi_{assay} to generate pipeline scripts for all assays. Assays can be one of:

  • rna
  • vdj
  • tag

Run multi_{assay} -h for help.

Usage Example

  • Single-cell rna

     conda activate celescope
 multi_rna\
 --mapfile ./rna.mapfile\
 --genomeDir /SGRNJ/Public/Database/genome/homo_mus\
 --thread 8\
 --mod shell

--mapfile Required. Mapfile path.

--genomeDir Required. Required. Genome directory.

--thread The recommended setting is 8, and the maximum should not exceed 20.

--mod Create sjm(simple job manager https://github.com/StanfordBioinformatics/SJM) or shell scripts.

Scripts above will generate a shell directory containing {sample}.sh files.

You can start your analysis by running:

sh ./shell/{sample}.sh
  • Single cell vdj
conda activate celescope
multi_vdj \
 --mapfile ./vdj.mapfile \
 --type TCR \
 --thread 8 \
 --mod shell

--type Required. TCR or BCR.

  • Single cell tag
conda activate celescope
multi_tag \
 --mapfile ./tag.mapfile\
 --barcode_fasta ./smk_barcode.fa\
 --fq_pattern L25C45\
 --mod shell

--barcode_fasta Required. Tag barcode fasta file.

>tag_0
GGGCGTCTGTGACCGCGTGATACTGCATTGTAGACCGCCCAACTC
>tag_1
TTCCTCCAGAGGAGACCGAGCCGGTCAATTCAGGAGAACGTCCGG
>tag_2
AGGGCTAGGCGTGTCATTTGGCGAGGTCCTGAGGTCATGGAGCCA
>tag_3
CACTGGTCATCGACACTGGGAACCTGAGGTGAGTTCGCGCGCAAG

--fq_pattern Required. R2 read pattern. The number after the letter represents the number of bases.

L linker(common sequences)
C tag barcode

How to write mapfile

Mapfile is a tab-delimited text file with as least three columns. Each line of mapfile represents paired-end fastq files.

1st column: Fastq file prefix.
2nd column: Fastq file directory path.
3rd column: Sample name, which is the prefix of all output files.
4th column: The 4th column has different meaning for each assay. The single cell rna directory after running CeleScope is called matched_dir.

  • rna Optional, forced cell number.
  • vdj Optional, matched_dir.
  • tag Required, matched_dir.

Example

Sample1 has 2 paired-end fastq files located in 2 different directories(fastq_dir1 and fastq_dir2). Sample2 has 1 paired-end fastq file located in fastq_dir1.

$cat ./my.mapfile
fastq_prefix1	fastq_dir1	sample1
fastq_prefix2	fastq_dir2	sample1
fastq_prefix3	fastq_dir1	sample2

$ls fastq_dir1
fastq_prefix1_1.fq.gz	fastq_prefix1_2.fq.gz
fastq_prefix3_1.fq.gz	fastq_prefix3_2.fq.gz

$ls fastq_dir2
fastq_prefix2_1.fq.gz	fastq_prefix2_2.fq.gz