diff --git a/test/api/detection_test.cpp b/test/api/detection_test.cpp index 459c76e6..4a1b612f 100644 --- a/test/api/detection_test.cpp +++ b/test/api/detection_test.cpp @@ -90,6 +90,155 @@ TEST(junction_detection, cigar_string_del_padding) } } +TEST(junction_detection, cigar_string_dup_detect_tandem_duplication) +{ + seqan3::dna5_vector const & query_sequence = {"AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCGGGTACGTAAC"_dna5}; + int32_t length = 15; + int32_t pos_start_dup_seq = 0; + int32_t pos_end_dup_seq = 0; + size_t tandem_dup_count = 0; + + // Prefix Case: The duplication (insertion) comes after the matched sequence. + // (10, 20] -> pos_start_dup_seq, pos_end_dup_seq + // ref AAAACCGCGTAGCGGGGCGGG---------------TACGTAACGGTACG + // ||||||||||||||||||| |||||||| + // read AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCGGGTACGTAAC -> inserted sequence: GCGGGGCGGGGCGGG + // + // suffix_sequence AAAACCGCGTAGCGGGGCGGG + // |||||||||| + // inserted sequence: GCGGGGCGGGGCGGG + // -> tandem_dup_count = 5, inserted_bases = GCGGG + int32_t pos_ref = 21; + int32_t pos_read = 19; + std::span inserted_bases = query_sequence | seqan3::views::slice(pos_read, pos_read + length); // "GCGGGGCGGG"_dna5 + + auto duplicated_bases = detect_tandem_duplication(query_sequence, + length, + pos_ref, + pos_read, + inserted_bases, + 4, // minimal length of duplication + pos_start_dup_seq, + pos_end_dup_seq, + tandem_dup_count); + EXPECT_EQ(tandem_dup_count, 5); + EXPECT_EQ(pos_start_dup_seq, 10); + EXPECT_EQ(pos_end_dup_seq, 20); + + // Suffix Case: The duplication (insertion) comes before the matched sequence. + // (10, 20] -> pos_start_dup_seq, pos_end_dup_seq + // ref AAAACCGCGTA---------------GCGGGGCGGGTACGTAACGGTACG + // ||||||||| |||||||||||||||||| + // read AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCGGGTACGTAAC -> inserted sequence: GCGGGGCGGGGCGGG + // + // prefix_sequence GCGGGGCGGGTACGTAACGGTACG + // |||||||||| + // inserted sequence: GCGGGGCGGGGCGGG + // -> tandem_dup_count = 5, inserted_bases = GCGGG + pos_ref = 11; // position of first inserted base. + pos_read = 9; + inserted_bases = query_sequence | seqan3::views::slice(pos_read, pos_read + length); + duplicated_bases = detect_tandem_duplication(query_sequence, + length, + pos_ref, + pos_read, + inserted_bases, + 4, // minimal length of duplication + pos_start_dup_seq, + pos_end_dup_seq, + tandem_dup_count); + EXPECT_EQ(tandem_dup_count, 5); + EXPECT_EQ(pos_start_dup_seq, 10); + EXPECT_EQ(pos_end_dup_seq, 20); + + // Special Case: The duplication (insertion) is in between of matching sequences. + // (10, 25] -> pos_start_dup_seq, pos_end_dup_seq + // ref AAAACCGCGTAGCGGG----------GCGGGGCGGGTACGTAACGGTACG + // |||||||||||||| ||||||||||||| + // read AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCGGGTACGTAAC -> inserted sequence: GCGGGGCGGG + // + // suffix_sequence AAAACCGCGTAGCGGG prefix_sequence GCGGGGCGGGTACGTAACGGTACG + // ||||| |||||||||| + // inserted sequence: GCGGGGCGGG GCGGGGCGGG + // -> tandem_dup_count = 5, inserted_bases = GCGGG + length = 10; + pos_ref = 16; + pos_read = 14; + inserted_bases = query_sequence | seqan3::views::slice(pos_read, pos_read + length); // "GCGGG"_dna5 + + duplicated_bases = detect_tandem_duplication(query_sequence, + length, + pos_ref, + pos_read, + inserted_bases, + 4, // minimal length of duplication + pos_start_dup_seq, + pos_end_dup_seq, + tandem_dup_count); + EXPECT_EQ(tandem_dup_count, 5); + EXPECT_EQ(pos_start_dup_seq, 10); + EXPECT_EQ(pos_end_dup_seq, 25); + + // Case with errors at the end: The duplication (insertion) includes some errors at the end. + // (10, 20] -> pos_start_dup_seq, pos_end_dup_seq + // ref AAAACCGCGTAGCGGGGCGGG---------------TACGTAACGGTACG + // ||||||||||||||||||| |||||||| + // read AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCAAATACGTAAC -> inserted sequence: GCGGGGCGGGGCAAA + // + // suffix_sequence AAAACCGCGTAGCGGGGCGGG + // |||||||||| + // inserted sequence: GCGGGGCGGGGCAAA + // + // suffix_sequence AAAACCGCGTAGCGGGGCGGG + // ||--- -> subsequence does not match without mismatches + // inserted sequence: GCAAA + // + seqan3::dna5_vector const & query_sequence_2 = {"AACCGCGTAGCGGGGCGGGGCGGGGCGGGGCAAATACGTAAC"_dna5}; + length = 15; + pos_ref = 21; + pos_read = 19; + inserted_bases = query_sequence_2 | seqan3::views::slice(pos_read, pos_read + length); // "GCGGGGCGGGGCAAA"_dna5 + + duplicated_bases = detect_tandem_duplication(query_sequence_2, + length, + pos_ref, + pos_read, + inserted_bases, + 4, // minimal length of duplication + pos_start_dup_seq, + pos_end_dup_seq, + tandem_dup_count); + EXPECT_EQ(tandem_dup_count, 0); + EXPECT_EQ(pos_start_dup_seq, 20); + EXPECT_EQ(pos_end_dup_seq, 20); + + // Case with a single error: The duplication (insertion) includes a single errors. + // (10, 20] -> pos_start_dup_seq, pos_end_dup_seq + // ref AAAACCGCGTAGCGGGGCGGG---------------TACGTAACGGTACG + // ||||||||||||||||||| |||||||| + // read AACCGCGTAGCGGGGCGGGGCGAGGCGGGGCGGGTACGTAAC -> inserted sequence: GCGAGGCGGGGCGGG + // + // suffix_sequence AAAACCGCGTAGCGGGGCGGG + // |||-|||||| -> single mismatch in the alignment + // inserted sequence: GCGAGGCGGGGCGGG + // + seqan3::dna5_vector const & query_sequence_3 = {"AACCGCGTAGCGGGGCGGGGCGAGGCGGGGCGGGTACGTAAC"_dna5}; + inserted_bases = query_sequence_3 | seqan3::views::slice(pos_read, pos_read + length); // "GCGAGGCGGGGCGGG"_dna5 + + duplicated_bases = detect_tandem_duplication(query_sequence_3, + length, + pos_ref, + pos_read, + inserted_bases, + 4, // minimal length of duplication + pos_start_dup_seq, + pos_end_dup_seq, + tandem_dup_count); + EXPECT_EQ(tandem_dup_count, 0); + EXPECT_EQ(pos_start_dup_seq, 20); + EXPECT_EQ(pos_end_dup_seq, 20); +} + TEST(junction_detection, cigar_string_simple_ins) { std::string const read_name = "read021"; diff --git a/test/api/structures_test.cpp b/test/api/structures_test.cpp index afaa3431..168e3ee9 100644 --- a/test/api/structures_test.cpp +++ b/test/api/structures_test.cpp @@ -1,8 +1,14 @@ #include "api_test.hpp" #include "structures/breakend.hpp" +#include "structures/cluster.hpp" +#include "structures/junction.hpp" #include "variant_detection/method_enums.hpp" +#include + +using seqan3::operator""_dna5; + /* tests for method_enums */ TEST(structures, method_enums_detection_methods) @@ -75,7 +81,7 @@ TEST(structures, method_enums_refinement_methods) /* tests for junctions */ -TEST(structures, breakend_flip_orientation) +TEST(structures, junctions_breakend_flip_orientation) { Breakend forward_breakend{"chr1", 42, strand::forward}; Breakend reverse_breakend{"chr1", 42, strand::reverse}; @@ -88,3 +94,41 @@ TEST(structures, breakend_flip_orientation) forward_breakend.flip_orientation(); EXPECT_EQ(forward_breakend, reverse_breakend); // both are forward now } + +/* tests for clusters */ + +TEST(structures, clusters_get_common_tandem_dup_count) +{ + Junction junction_1{Breakend{"chr1", 123456, strand::forward}, + Breakend{"chr1", 234567, strand::forward}, + ""_dna5, 0, "read_1"}; + Junction junction_2{Breakend{"chr1", 123456, strand::forward}, + Breakend{"chr1", 234567, strand::forward}, + ""_dna5, 1, "read_1"}; + Junction junction_3{Breakend{"chr1", 123456, strand::forward}, + Breakend{"chr1", 234567, strand::forward}, + ""_dna5, 2, "read_1"}; + Junction junction_4{Breakend{"chr1", 123456, strand::forward}, + Breakend{"chr1", 234567, strand::forward}, + ""_dna5, 7, "read_1"}; + + // Tandem duplication with 2 copies: + Cluster cluster_1{{junction_3, junction_3, junction_3}}; + EXPECT_EQ(cluster_1.get_common_tandem_dup_count(), 2); + + // Tandem duplication with different amount of copies: + Cluster cluster_2{{junction_2, junction_3, junction_4}}; + EXPECT_EQ(cluster_2.get_common_tandem_dup_count(), 3); // (1+2+7)/3=3,333 + + // More than two thirds of the junctions have a 0 tandem_dup_count, than its probably no tandem duplication. + Cluster cluster_3{{junction_1, junction_1, junction_1, junction_2}}; + EXPECT_EQ(cluster_3.get_common_tandem_dup_count(), 0); + + // Two thirds of the junctions have a 0 tandem_dup_count, than its probably a tandem duplication. + Cluster cluster_4{{junction_1, junction_1, junction_2}}; + EXPECT_EQ(cluster_4.get_common_tandem_dup_count(), 0); + + // Less than two thirds of the junctions have a 0 tandem_dup_count, than its probably a tandem duplication. + Cluster cluster_5{{junction_1, junction_2}}; + EXPECT_EQ(cluster_5.get_common_tandem_dup_count(), 1); +}