I would like to add custom barcodes, but retain native (Ligation kit) adapters

[l-yampolsky]

Don't think anyone is answering issues here, but let's try.
I understand that I can add custom barcodes. To do so I would edit adapters.py by removing any barcodes present there and including my custom adapters, names starting with 'Barcode' and with sequence that consists of the OTN adapter sequence followed by my barcode. To do this I need to identify the right adapters (Ligation kit) in adapters.py and add my barcodes to their sequences. The file adapters.py does not mention "Ligation" or "SQK-LSK109" anywere, nor does it include anything close to the sequence that most commonly occurs in the beginning of my reads (which is TCAGTACTTCGTTCAGTTACGTATTGCT or similar).

Any ideas?

[amv33576]

Where you able to solve this problem? I am trying the accomplish something similar.

[Manesskuggen]

Hello,

Same issue here ...