We read every piece of feedback, and take your input very seriously.
To see all available qualifiers, see our documentation.
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
If a primer region e.g.
MyRef 23000 23031 my_primer_name 1 + ACCAGCGATCGACGGAGCTAGATCGATCGAT
comes after a reference seq length, e.g. 5000, amplisim aborts with a runtime error from the compiler.
Catch this case and improve error handling.
The text was updated successfully, but these errors were encountered:
Krannich479
No branches or pull requests
Situation:
If a primer region e.g.
comes after a reference seq length, e.g. 5000, amplisim aborts with a runtime error from the compiler.
Todo:
Catch this case and improve error handling.
The text was updated successfully, but these errors were encountered: