From 579c95d6e322dc1ea89eab4bd19a376ef25f3ae6 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:07:26 -0500
Subject: [PATCH 01/23] properly specify config overrides in tests
(needs multiple args to --config, not multiple instances of --config)
---
.circleci/config.yml | 4 ++--
1 file changed, 2 insertions(+), 2 deletions(-)
diff --git a/.circleci/config.yml b/.circleci/config.yml
index 9b5d5b8f..3d4670a0 100644
--- a/.circleci/config.yml
+++ b/.circleci/config.yml
@@ -153,7 +153,7 @@ variables:
./run_test.sh --use-conda -j2 -k -p -r \
--configfile $ORIG/test/test_configs/test_chipseq_regression.yaml \
--config sampletable=$ORIG/test/test_configs/chipseq_one_run.tsv \
- --config merged_bigwigs="{}" \
+ merged_bigwigs="{}" \
--until bed_to_bigbed
# Piggy-backing on that test, here we check to make sure it's OK to
@@ -161,7 +161,7 @@ variables:
./run_test.sh -n \
--configfile $ORIG/test/test_configs/test_chipseq_no_peaks.yaml \
--config sampletable=$ORIG/test/test_configs/chipseq_one_run.tsv \
- --config merged_bigwigs="{}" \
+ merged_bigwigs="{}" \
--until bed_to_bigbed
# --------------------------------------------------------------------------
From 07f9583baf0b1ab094cf092589f8a96a076a5145 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:08:16 -0500
Subject: [PATCH 02/23] better error message for chipseq configs, fixes #243
---
lib/common.py | 8 ++++----
1 file changed, 4 insertions(+), 4 deletions(-)
diff --git a/lib/common.py b/lib/common.py
index 921414a4..a1462267 100644
--- a/lib/common.py
+++ b/lib/common.py
@@ -589,10 +589,10 @@ def get_techreps(sampletable, label):
is_chipseq = 'antibody' in sampletable.columns
if is_chipseq:
- err = (
- "No technical replicates found for label '{}'. This looks to "
- "be a ChIP-seq experiment; check the peak-calling section of"
- "the config.".format(label)
+ err = ("""
+ No technical replicates found for label '{}'. Check the ChIP-seq config
+ file to ensure the peak-calling section only specifies values from the
+ sampletable's "label" column.""".format(label)
)
else:
err = "No technical replicates found for label '{}'.".format(label)
From 4d3d15cb0cca75b2a1e8d5d3e32e3375a3874754 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:10:40 -0500
Subject: [PATCH 03/23] use ConfigurationError exception class
---
lib/helpers.py | 5 ++++-
1 file changed, 4 insertions(+), 1 deletion(-)
diff --git a/lib/helpers.py b/lib/helpers.py
index f76f2a22..397d8f65 100644
--- a/lib/helpers.py
+++ b/lib/helpers.py
@@ -6,6 +6,9 @@
from snakemake.io import expand, regex
from lib import common
+class ConfigurationError(Exception):
+ pass
+
def detect_layout(sampletable):
"""
@@ -144,7 +147,7 @@ def check_unique_samplename(df):
"""
ns = df.index
if len(ns.unique()) < len(ns):
- raise ValueError('Samplenames non unique, check the sampletable\n')
+ raise ConfigurationError('Samplenames non unique, check the sampletable\n')
def preflight(config):
"""
From bc24eeb2a13d8fb708dc26c66a12a50d84a43c5f Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:11:07 -0500
Subject: [PATCH 04/23] preflight() only cares that first column contains ids
(rather than requiring column name)
---
lib/helpers.py | 2 +-
1 file changed, 1 insertion(+), 1 deletion(-)
diff --git a/lib/helpers.py b/lib/helpers.py
index 397d8f65..d490e71e 100644
--- a/lib/helpers.py
+++ b/lib/helpers.py
@@ -157,7 +157,7 @@ def preflight(config):
----------
config: yaml config object
"""
- sampletable = pd.read_table(config['sampletable'], index_col='samplename', comment='#')
+ sampletable = pd.read_table(config['sampletable'], index_col=0, comment='#')
check_unique_samplename(sampletable)
if 'orig_filename' in sampletable.columns:
check_unique_fn(sampletable)
From 537d281f466669eee01c08ee7f4f9f44c0a584b0 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:12:26 -0500
Subject: [PATCH 05/23] back to checking if --configfile provided
This allow the complex ChIP-seq to run; otherwise the merged_bigwigs key
would be *updated* rather than replaced. Not sure I fully understand it
without digging through the Snakemake code, but empiricially this is
working now
---
workflows/chipseq/Snakefile | 7 +++----
workflows/rnaseq/Snakefile | 4 ++--
2 files changed, 5 insertions(+), 6 deletions(-)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index 21abb1f7..5eb03d90 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -17,7 +17,8 @@ from lib.patterns_targets import ChIPSeqConfig
#
# ----------------------------------------------------------------------------
-configfile: 'config/config.yaml'
+if not workflow.overwrite_configfiles:
+ configfile: 'config/config.yaml'
config = common.load_config(config)
@@ -50,8 +51,6 @@ def wrapper_for(path):
return 'file:' + os.path.join('../..','wrappers', 'wrappers', path)
-
-
# ----------------------------------------------------------------------------
# RULES
# ----------------------------------------------------------------------------
@@ -75,7 +74,7 @@ final_targets = utils.flatten((
utils.flatten(c.targets['plotcorrelation']),
))
-if 'merged_bigwigs' in config:
+if config.get('merged_bigwigs', None):
final_targets.extend(utils.flatten(c.targets['merged_bigwig']))
diff --git a/workflows/rnaseq/Snakefile b/workflows/rnaseq/Snakefile
index a006798d..11ba3e03 100644
--- a/workflows/rnaseq/Snakefile
+++ b/workflows/rnaseq/Snakefile
@@ -16,8 +16,8 @@ from lib.patterns_targets import RNASeqConfig
#
# ----------------------------------------------------------------------------
-configfile: 'config/config.yaml'
-
+if not workflow.overwrite_configfiles:
+ configfile: 'config/config.yaml'
config = common.load_config(config)
From 2e37deb65884ae8308ca377b9b159df19313fd1b Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:14:40 -0500
Subject: [PATCH 06/23] add config and sampletable for complex chipseq
---
.../complex-dataset-chipseq-config.yaml | 25 +++++++++++++++++++
.../complex-dataset-chipseq-sampletable.tsv | 20 +++++++++++++++
2 files changed, 45 insertions(+)
create mode 100644 test/test_configs/complex-dataset-chipseq-config.yaml
create mode 100644 test/test_configs/complex-dataset-chipseq-sampletable.tsv
diff --git a/test/test_configs/complex-dataset-chipseq-config.yaml b/test/test_configs/complex-dataset-chipseq-config.yaml
new file mode 100644
index 00000000..e80f2726
--- /dev/null
+++ b/test/test_configs/complex-dataset-chipseq-config.yaml
@@ -0,0 +1,25 @@
+patterns: 'config/chipseq_patterns.yaml'
+organism: 'human'
+references_dir: 'references_data'
+
+aligner:
+ index: 'bowtie2'
+ tag: 'gencode-v28'
+
+rrna:
+ index: 'bowtie2'
+ tag: 'rRNA'
+
+fastq_screen:
+ - label: rRNA
+ organism: human
+ tag: rRNA
+ - label: human
+ organism: human
+ tag: gencode-v28
+
+merged_bigwigs: {}
+chipseq: {}
+
+include_references:
+ - '../../include/reference_configs/Homo_sapiens.yaml'
diff --git a/test/test_configs/complex-dataset-chipseq-sampletable.tsv b/test/test_configs/complex-dataset-chipseq-sampletable.tsv
new file mode 100644
index 00000000..a193ded7
--- /dev/null
+++ b/test/test_configs/complex-dataset-chipseq-sampletable.tsv
@@ -0,0 +1,20 @@
+sampleid label biological_material antibody Run Assay Type AvgSpotLen Bases BioProject BioSample Bytes Experiment GEO_Accession (exp) Instrument LibraryLayout LibrarySelection LibrarySource Organism Platform ReleaseDate Sample Name SAMPLE_TYPE source_name SRA Study Cell_Line Treatment
+BRD4-dBET6-1 BRD4-dBET6-1 dBET6-1 BRD4 SRR6202977 ChIP-Seq 51 2888699568 PRJNA415413 SAMN07822419 1088112015 SRX3312884 GSM2828225 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828225 cell line ChIP-seq for BRD4 in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+BRD4-dBET6-2 BRD4-dBET6-2 dBET6-2 BRD4 SRR6202978 ChIP-Seq 51 2817455985 PRJNA415413 SAMN07822418 1073353111 SRX3312885 GSM2828226 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828226 cell line ChIP-seq for BRD4 in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+BRD4-DMSO-1 BRD4-DMSO-1 DMSO-1 BRD4 SRR6202979 ChIP-Seq 51 2649558426 PRJNA415413 SAMN07822417 1004127474 SRX3312886 GSM2828227 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828227 cell line ChIP-seq for BRD4 in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+BRD4-DMSO-2 BRD4-DMSO-2 DMSO-2 IgG SRR6202980 ChIP-Seq 51 2331669408 PRJNA415413 SAMN07822416 883284565 SRX3312887 GSM2828228 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828228 cell line ChIP-seq for BRD4 in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+IgG-dBET6-1 IgG-dBET6-1 dBET6-1 IgG SRR6202981 ChIP-Seq 51 2582802180 PRJNA415413 SAMN07822415 976901766 SRX3312888 GSM2828229 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828229 cell line ChIP-seq with mock IgG antibody in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+IgG-dBET6-2 IgG-dBET6-2 dBET6-2 IgG SRR6202982 ChIP-Seq 51 2518887450 PRJNA415413 SAMN07822414 957269285 SRX3312889 GSM2828230 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828230 cell line ChIP-seq with mock IgG antibody in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+IgG-DMSO-1 IgG-DMSO-1 DMSO-1 IgG SRR6202983 ChIP-Seq 51 2936252988 PRJNA415413 SAMN07822413 1105389590 SRX3312890 GSM2828231 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828231 cell line ChIP-seq with mock IgG antibody in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+IgG-DMSO-2 IgG-DMSO-2 DMSO-2 IgG SRR6202984 ChIP-Seq 51 2668375233 PRJNA415413 SAMN07822412 1008987333 SRX3312891 GSM2828232 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828232 cell line ChIP-seq with mock IgG antibody in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+input-dBET6-1 input-dBET6-1 dBET6-1 input SRR6202985 ChIP-Seq 51 1655658441 PRJNA415413 SAMN07822411 624046569 SRX3312892 GSM2828233 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828233 cell line ChIP-seq for Input in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+input-dBET6-2 input-dBET6-2 dBET6-2 input SRR6202986 ChIP-Seq 51 1696489653 PRJNA415413 SAMN07822410 643171472 SRX3312893 GSM2828234 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828234 cell line ChIP-seq for Input in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+input-DMSO-1 input-DMSO-1 DMSO-1 input SRR6202987 ChIP-Seq 51 1594794837 PRJNA415413 SAMN07822409 600198413 SRX3312894 GSM2828235 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828235 cell line ChIP-seq for Input in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+input-DMSO-2 input-DMSO-2 DMSO-2 input SRR6202988 ChIP-Seq 51 1832520474 PRJNA415413 SAMN07822408 699204870 SRX3312895 GSM2828236 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828236 cell line ChIP-seq for Input in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+MTHFD1-dBET6-1 MTHFD1-dBET6-1 dBET6-1 MTHFD1 SRR6202989 ChIP-Seq 51 2369093667 PRJNA415413 SAMN07822407 901959099 SRX3312896 GSM2828237 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828237 cell line ChIP-seq for MTHFD1 in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+MTHFD1-dBET6-2 MTHFD1-dBET6-2 dBET6-2 MTHFD1 SRR6202990 ChIP-Seq 51 1982794218 PRJNA415413 SAMN07822406 755171006 SRX3312897 GSM2828238 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828238 cell line ChIP-seq for MTHFD1 in HAP1 cell line treated with dBET6 SRP120974 HAP1 dBET6
+MTHFD1-DMSO-1 MTHFD1-DMSO-1 DMSO-1 MTHFD1 SRR6202991 ChIP-Seq 51 2709781470 PRJNA415413 SAMN07822405 1024385435 SRX3312898 GSM2828239 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828239 cell line ChIP-seq for MTHFD1 in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+MTHFD1-DMSO-2 MTHFD1-DMSO-2 DMSO-2 MTHFD1 SRR6202992 ChIP-Seq 51 2468011278 PRJNA415413 SAMN07822404 938165043 SRX3312899 GSM2828240 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828240 cell line ChIP-seq for MTHFD1 in HAP1 cell line treated with DMSO SRP120974 HAP1 DMSO
+H3K27ac-untreated-1 H3K27ac-untreated-1 untreated-1 H3K27ac SRR6202993 ChIP-Seq 61 1060781399 PRJNA415413 SAMN07822403 371528672 SRX3312900 GSM2828241 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828241 cell line ChIP-seq for H3K27ac in HAP1 cell line SRP120974 HAP1
+H3K27ac-untreated-2 H3K27ac-untreated-2 untreated-2 H3K27ac SRR6202994 ChIP-Seq 61 1468837056 PRJNA415413 SAMN07822402 575306586 SRX3312901 GSM2828242 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828242 cell line ChIP-seq for H3K27ac in HAP1 cell line SRP120974 HAP1
+IgG-untreated1 IgG-untreated1 untreated-1 IgG SRR6202995 ChIP-Seq 61 1360415717 PRJNA415413 SAMN07822401 516746459 SRX3312902 GSM2828243 Illumina HiSeq 4000 SINGLE ChIP GENOMIC Homo sapiens ILLUMINA 2019-04-04T00:00:00Z GSM2828243 cell line ChIP-seq with mock IgG antibody in HAP1 cell line SRP120974 HAP1
From 2d466b023f717f4e68819bac1abf0cb9f9db4d12 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:15:01 -0500
Subject: [PATCH 07/23] add driver scripts for complex rnaseq and chipseq
---
workflows/chipseq/run_complex_test.sh | 6 ++++++
workflows/rnaseq/run_complex_test.sh | 5 +++++
2 files changed, 11 insertions(+)
create mode 100755 workflows/chipseq/run_complex_test.sh
create mode 100755 workflows/rnaseq/run_complex_test.sh
diff --git a/workflows/chipseq/run_complex_test.sh b/workflows/chipseq/run_complex_test.sh
new file mode 100755
index 00000000..0d5fe3c1
--- /dev/null
+++ b/workflows/chipseq/run_complex_test.sh
@@ -0,0 +1,6 @@
+#!/bin/bash
+snakemake \
+ --configfile ../../test/test_configs/complex-dataset-chipseq-config.yaml \
+ --config \
+ sampletable=../../test/test_configs/complex-dataset-chipseq-sampletable.tsv \
+ "$@"
diff --git a/workflows/rnaseq/run_complex_test.sh b/workflows/rnaseq/run_complex_test.sh
new file mode 100755
index 00000000..966e4139
--- /dev/null
+++ b/workflows/rnaseq/run_complex_test.sh
@@ -0,0 +1,5 @@
+#!/bin/bash
+snakemake \
+ --configfile ../../test/test_configs/complex-dataset-rnaseq-config.yaml \
+ --config sampletable=../../test/test_configs/complex-dataset-rnaseq-sampletable.tsv merged_bigwigs="{}" \
+ "$@"
From 452994ed781090f8b3a40c48aac844216ca832e4 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:36:05 -0500
Subject: [PATCH 08/23] localrules symlinks only if symlinks rule is created
---
workflows/chipseq/Snakefile | 3 ++-
1 file changed, 2 insertions(+), 1 deletion(-)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index 5eb03d90..3206595c 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -44,7 +44,6 @@ wildcard_constraints:
n = '[1,2]',
sample = '|'.join(SAMPLES)
-localrules: symlinks
def wrapper_for(path):
@@ -93,6 +92,8 @@ rule targets:
if 'orig_filename' in c.sampletable.columns:
+ localrules: symlinks
+
# Convert the sampletable to be indexed by the first column, for
# convenience in generating the input/output filenames.
_st = c.sampletable.set_index(c.sampletable.columns[0])
From 21821e18d44ea6173ae4b838f2a029caa3a35e6a Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:40:14 -0500
Subject: [PATCH 09/23] send fastq-dump output to log (rnaseq and chipseq)
---
workflows/chipseq/Snakefile | 7 +++++--
workflows/rnaseq/Snakefile | 7 +++++--
2 files changed, 10 insertions(+), 4 deletions(-)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index 3206595c..a42e0b7a 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -117,7 +117,6 @@ if 'orig_filename' in c.sampletable.columns:
output:
render_r1_r2(c.patterns['fastq'])
run:
-
assert len(output) == len(input), (input, output)
for src, linkname in zip(input, output):
utils.make_relative_symlink(src, linkname)
@@ -136,6 +135,9 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
rule fastq_dump:
output:
fastq=render_r1_r2(c.patterns['fastq'])
+
+ log:
+ r1_only(c.patterns['fastq'])[0] + '.log'
run:
srr = _st.loc[wildcards.sample, 'Run']
@@ -151,6 +153,7 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
'--gzip '
'--split-files '
# '-X 100000 ' # [TEST SETTINGS]
+ '&> {log}'
)
# The filenames are predictable, so we can move them as needed.
@@ -165,7 +168,7 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
'{srr} '
'-Z '
# '-X 100000 ' # [TEST SETTINGS]
- '| gzip -c > {output[0]}.tmp '
+ '2> {log} | gzip -c > {output[0]}.tmp '
'&& mv {output[0]}.tmp {output[0]} '
)
diff --git a/workflows/rnaseq/Snakefile b/workflows/rnaseq/Snakefile
index 11ba3e03..1f48880e 100644
--- a/workflows/rnaseq/Snakefile
+++ b/workflows/rnaseq/Snakefile
@@ -109,7 +109,6 @@ if 'orig_filename' in c.sampletable.columns:
output:
render_r1_r2(c.patterns['fastq'])
run:
-
assert len(output) == len(input), (input, output)
for src, linkname in zip(input, output):
utils.make_relative_symlink(src, linkname)
@@ -128,6 +127,9 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
rule fastq_dump:
output:
fastq=render_r1_r2(c.patterns['fastq'])
+
+ log:
+ r1_only(c.patterns['fastq'])[0] + '.log'
run:
srr = _st.loc[wildcards.sample, 'Run']
@@ -143,6 +145,7 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
'--gzip '
'--split-files '
# '-X 100000 ' # [TEST SETTINGS]
+ '&> {log}'
)
# The filenames are predictable, so we can move them as needed.
@@ -157,7 +160,7 @@ if 'Run' in c.sampletable.columns and sum(c.sampletable['Run'].str.startswith('S
'{srr} '
'-Z '
# '-X 100000 ' # [TEST SETTINGS]
- '| gzip -c > {output[0]}.tmp '
+ '2> {log} | gzip -c > {output[0]}.tmp '
'&& mv {output[0]}.tmp {output[0]} '
)
From c250eaf21adc7908ba06ddf94d36506d968e153b Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:44:32 -0500
Subject: [PATCH 10/23] use multiple cores for cutadapt in SE mode
---
workflows/chipseq/Snakefile | 1 +
workflows/rnaseq/Snakefile | 1 +
2 files changed, 2 insertions(+)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index a42e0b7a..94845745 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -207,6 +207,7 @@ rule cutadapt:
"-o {output[0]} "
"-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA "
'-q 20 '
+ '-j {threads} '
'--minimum-length 25 '
"{input.fastq[0]} "
"&> {log}"
diff --git a/workflows/rnaseq/Snakefile b/workflows/rnaseq/Snakefile
index 1f48880e..79d40529 100644
--- a/workflows/rnaseq/Snakefile
+++ b/workflows/rnaseq/Snakefile
@@ -257,6 +257,7 @@ rule cutadapt:
"-o {output[0]} "
"-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA "
'-q 20 '
+ '-j {threads} '
'--minimum-length 25 '
"{input.fastq[0]} "
"&> {log}"
From 953006ad8d320a1a0df18e015d514f5354a0c830 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 11:51:27 -0500
Subject: [PATCH 11/23] use multiple threads for fastqc
---
workflows/chipseq/Snakefile | 5 ++++-
workflows/rnaseq/Snakefile | 5 ++++-
2 files changed, 8 insertions(+), 2 deletions(-)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index 94845745..d8ce4d0c 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -218,7 +218,10 @@ rule fastqc:
"""
Run FastQC
"""
- input: '{sample_dir}/{sample}/{sample}{suffix}'
+ input:
+ '{sample_dir}/{sample}/{sample}{suffix}'
+ threads:
+ 6
output:
html='{sample_dir}/{sample}/fastqc/{sample}{suffix}_fastqc.html',
zip='{sample_dir}/{sample}/fastqc/{sample}{suffix}_fastqc.zip',
diff --git a/workflows/rnaseq/Snakefile b/workflows/rnaseq/Snakefile
index 79d40529..a5be9a87 100644
--- a/workflows/rnaseq/Snakefile
+++ b/workflows/rnaseq/Snakefile
@@ -268,7 +268,10 @@ rule fastqc:
"""
Run FastQC
"""
- input: '{sample_dir}/{sample}/{sample}{suffix}'
+ input:
+ '{sample_dir}/{sample}/{sample}{suffix}'
+ threads:
+ 6
output:
html='{sample_dir}/{sample}/fastqc/{sample}{suffix}_fastqc.html',
zip='{sample_dir}/{sample}/fastqc/{sample}{suffix}_fastqc.zip',
From bcf77f6945d46391a1c555e3e56ebfb7b74c36f9 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 20:55:48 -0500
Subject: [PATCH 12/23] make sure multibigwigsummary uses configured threads
---
workflows/chipseq/Snakefile | 1 +
1 file changed, 1 insertion(+)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index d8ce4d0c..18d4826c 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -738,6 +738,7 @@ rule multibigwigsummary:
'bins '
'-b {input} '
'--labels {labels} '
+ '--numberOfProcessors {threads} '
'-out {output.npz} '
'--outRawCounts {output.tab}'
)
From 0b2ed876a761325263e3c289802abb5f2b0e726f Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sat, 2 Jan 2021 20:56:13 -0500
Subject: [PATCH 13/23] support fingerprint in cases where input is unavailable
for some samples
---
workflows/chipseq/Snakefile | 41 +++++++++++++++++++++----------------
1 file changed, 23 insertions(+), 18 deletions(-)
diff --git a/workflows/chipseq/Snakefile b/workflows/chipseq/Snakefile
index 18d4826c..ca8bf1f6 100644
--- a/workflows/chipseq/Snakefile
+++ b/workflows/chipseq/Snakefile
@@ -567,24 +567,29 @@ rule fingerprint:
metrics=c.patterns['fingerprint']['metrics']
threads: 8
log: c.patterns['fingerprint']['metrics'] + '.log'
- shell:
- 'plotFingerprint '
- '--bamfiles {input.bams} '
- '-p {threads} '
- # The JSDsample argument is disabled for testing as it dramatically
- # increases the run time.
- # [TEST SETTINGS +1]
- '--JSDsample {input.control} '
- '--smartLabels '
- '--extendReads=300 '
- '--skipZeros '
- '--outQualityMetrics {output.metrics} '
- '--outRawCounts {output.raw_counts} '
- '--plotFile {output.plot} '
- # Default is 500k; use fewer to speed up testing:
- # '--numberOfSamples 50 ' # [TEST SETTINGS ]
- '&> {log} '
- '&& sed -i "s/NA/0.0/g" {output.metrics} '
+ run:
+ if len(input.control) == 0:
+ jsdsample_arg = ""
+ else:
+ jsdsample_arg = '--JSDsample {input.control}'
+ shell(
+ 'plotFingerprint ' '--bamfiles {input.bams} '
+ '-p {threads} '
+ # The JSDsample argument is disabled for testing as it dramatically
+ # increases the run time.
+ # [TEST SETTINGS +1]
+ '{jsdsample_arg} '
+ '--smartLabels '
+ '--extendReads=300 '
+ '--skipZeros '
+ '--outQualityMetrics {output.metrics} '
+ '--outRawCounts {output.raw_counts} '
+ '--plotFile {output.plot} '
+ # Default is 500k; use fewer to speed up testing:
+ # '--numberOfSamples 50 ' # [TEST SETTINGS ]
+ '&> {log} '
+ '&& sed -i "s/NA/0.0/g" {output.metrics} '
+ )
rule sicer:
From b2532242512ffd3f613879187b9dbf90b143682b Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 3 Jan 2021 19:26:00 -0500
Subject: [PATCH 14/23] add peak-calling and bigwig merging to complex chipseq
config
---
.../complex-dataset-chipseq-config.yaml | 76 ++++++++++++++++++-
1 file changed, 74 insertions(+), 2 deletions(-)
diff --git a/test/test_configs/complex-dataset-chipseq-config.yaml b/test/test_configs/complex-dataset-chipseq-config.yaml
index e80f2726..61406e94 100644
--- a/test/test_configs/complex-dataset-chipseq-config.yaml
+++ b/test/test_configs/complex-dataset-chipseq-config.yaml
@@ -18,8 +18,80 @@ fastq_screen:
organism: human
tag: gencode-v28
-merged_bigwigs: {}
-chipseq: {}
+merged_bigwigs:
+ BRD4-dBET6:
+ - BRD4-dBET6-1
+ - BRD4-dBET6-2
+ BRD4-DMSO:
+ - BRD4-DMSO-1
+ - BRD4-DMSO-2
+ IgG-dBET6:
+ - IgG-dBET6-1
+ - IgG-dBET6-2
+ IgG-DMSO:
+ - IgG-DMSO-1
+ - IgG-DMSO-2
+ MTHFD1-dBET6:
+ - MTHFD1-dBET6-1
+ - MTHFD1-dBET6-2
+ MTHFD1-DMSO:
+ - MTHFD1-DMSO-1
+ - MTHFD1-DMSO-2
+ H3K27ac:
+ - H3K27ac-untreated-1
+ - H3K27ac-untreated-2
+
+chipseq:
+ peak_calling:
+ - label: BRD4-dBET6-1
+ algorithm: macs2
+ ip:
+ - BRD4-dBET6-1
+ control:
+ - input-dBET6-1
+ - label: BRD4-dBET6-2
+ algorithm: macs2
+ ip:
+ - BRD4-dBET6-2
+ control:
+ - input-dBET6-2
+ - label: BRD4-DMSO-1
+ algorithm: macs2
+ ip:
+ - BRD4-DMSO-1
+ control:
+ - input-DMSO-1
+ - label: BRD4-DMSO-2
+ algorithm: macs2
+ ip:
+ - BRD4-DMSO-2
+ control:
+ - input-DMSO-2
+ - label: MTHFD1-dBET6-1
+ algorithm: macs2
+ ip:
+ - MTHFD1-dBET6-1
+ control:
+ - input-dBET6-1
+ - label: MTHFD1-dBET6-2
+ algorithm: macs2
+ ip:
+ - MTHFD1-dBET6-2
+ control:
+ - input-dBET6-2
+ - label: MTHFD1-DMSO-1
+ algorithm: macs2
+ ip:
+ - MTHFD1-DMSO-1
+ control:
+ - input-DMSO-1
+ - label: MTHFD1-DMSO-2
+ algorithm: macs2
+ ip:
+ - MTHFD1-DMSO-2
+ control:
+ - input-DMSO-2
+
include_references:
- '../../include/reference_configs/Homo_sapiens.yaml'
From 28356ba42c6cbadf8a41b7081b46a86e68bf01cd Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 3 Jan 2021 19:26:34 -0500
Subject: [PATCH 15/23] redirect to logs for merge bigwig output
---
wrappers/wrappers/average-bigwigs/wrapper.py | 6 ++----
1 file changed, 2 insertions(+), 4 deletions(-)
diff --git a/wrappers/wrappers/average-bigwigs/wrapper.py b/wrappers/wrappers/average-bigwigs/wrapper.py
index a191fc30..94be840a 100644
--- a/wrappers/wrappers/average-bigwigs/wrapper.py
+++ b/wrappers/wrappers/average-bigwigs/wrapper.py
@@ -11,8 +11,6 @@
else:
mem_arg = ''
-log = snakemake.log_fmt_shell()
-
if len(snakemake.input.bigwigs) == 1:
utils.make_relative_symlink(snakemake.input.bigwigs[0], snakemake.output[0])
@@ -26,9 +24,9 @@
shell(
'export LC_ALL=C; '
- 'bigWigMerge {snakemake.input.bigwigs} stdout '
+ 'bigWigMerge {snakemake.input.bigwigs} stdout 2> {snakemake.log} '
"""| awk 'BEGIN{{OFS="\t"}}{{$4={f}*$4; print}}' """
'| sort {mem_arg} -T {tmpdir} -k1,1 -k2,2n > {tmp} '
'&& bedGraphToBigWig {tmp} {snakemake.input.chromsizes} '
- '{snakemake.output} {log}'
+ '{snakemake.output} &>> {snakemake.log}'
)
From fc87b8463f046c99baa8a3c5a3abcbe51d600d00 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 14:15:44 -0400
Subject: [PATCH 16/23] fix configfile overrides in tests
---
.circleci/config.yml | 17 +++++++++++------
1 file changed, 11 insertions(+), 6 deletions(-)
diff --git a/.circleci/config.yml b/.circleci/config.yml
index 25b37dcf..550d88c8 100644
--- a/.circleci/config.yml
+++ b/.circleci/config.yml
@@ -218,19 +218,19 @@ variables:
# only go to the cutadapt step.
rm -r data
./run_test.sh -j 1 --use-conda -k -p -r --until cutadapt \
- --configfile $ORIG/test/test_configs/override.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
--config sampletable=$ORIG/test/test_configs/test_sra_sampletable.tsv
# Same as above, but SE
rm -r data
./run_test.sh -j 1 --use-conda -k -p -r --until cutadapt \
- --configfile $ORIG/test/test_configs/override.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
--config sampletable=$ORIG/test/test_configs/test_sra_sampletable_SE_only.tsv
# test strandedness, PE
rm -r data && cp -r /tmp/data data
./run_test.sh -j 2 --use-conda -k -p -r --until strand_check \
- --configfile $ORIG/test/test_configs/override.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
--config sampletable=$ORIG/test/test_configs/test_pe_sampletable.tsv \
&& cat strandedness.tsv
@@ -245,7 +245,9 @@ variables:
rm -r data && cp -r /tmp/data data
./run_test.sh -j 2 --use-conda -k -p -r \
--forcerun star_pass1 \
- --configfile $ORIG/test/test_configs/star_override_2pass.yaml \
+ --configfile \
+ $ORIG/test/test_configs/test_rnaseq_config.yaml \
+ $ORIG/test/test_configs/star_override_2pass.yaml \
--config sampletable=$ORIG/test/test_configs/two_samples.tsv \
--until star_pass2
@@ -253,14 +255,17 @@ variables:
rm -r data && cp -r /tmp/data data
./run_test.sh -j 2 --use-conda -k -p -r \
--forcerun star \
- --configfile $ORIG/test/test_configs/star_override_1pass.yaml \
+ --configfile \
+ $ORIG/test/test_configs/test_rnaseq_config.yaml \
+ $ORIG/test/test_configs/star_override_1pass.yaml \
--config sampletable=$ORIG/test/test_configs/two_samples.tsv \
--until star
# test PE reads
rm -r data && cp -r /tmp/data data
./run_test.sh -j 2 --use-conda -k -p -r --until multiqc \
- --configfile $ORIG/test/test_configs/override.yaml \
+ --configfile \
+ $ORIG/test/test_configs/test_rnaseq_config.yaml \
--config sampletable=$ORIG/test/test_configs/test_pe_sampletable.tsv
# --------------------------------------------------------------------------
From 495ad75148888349dc431df829bd705b3b535d3b Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 14:16:50 -0400
Subject: [PATCH 17/23] update env-pinned.yml
---
env-pinned.yml | 381 +++++++++++++++++++++++++++----------------------
1 file changed, 213 insertions(+), 168 deletions(-)
diff --git a/env-pinned.yml b/env-pinned.yml
index 9fda864b..93b0c9c8 100644
--- a/env-pinned.yml
+++ b/env-pinned.yml
@@ -1,3 +1,4 @@
+name: /home/dalerr/lcdb-wf/env
channels:
- conda-forge
- bioconda
@@ -6,152 +7,186 @@ dependencies:
- _libgcc_mutex=0.1=conda_forge
- _openmp_mutex=4.5=1_gnu
- _r-mutex=1.0.1=anacondar_1
- - alsa-lib=1.2.3=h516909a_0
+ - aiohttp=3.7.4=py39h3811e60_0
- amply=0.1.4=py_0
- apipkg=1.5=py_0
- appdirs=1.4.4=pyh9f0ad1d_0
- argcomplete=1.12.2=pyhd8ed1ab_0
- argh=0.26.2=pyh9f0ad1d_1002
+ - async-timeout=3.0.1=py_1000
- attrs=20.3.0=pyhd3deb0d_0
- backcall=0.2.0=pyh9f0ad1d_0
- backports=1.0=py_2
- - backports.functools_lru_cache=1.6.1=py_0
- - bedtools=2.30.0=hc088bd4_0
+ - backports.functools_lru_cache=1.6.3=pyhd8ed1ab_0
+ - bedtools=2.30.0=h7d7f7ad_1
- binutils_impl_linux-64=2.35.1=h193b22a_2
- binutils_linux-64=2.35=h67ddf6f_30
- - biopython=1.78=py38h497a2fe_1
- - bowtie=1.3.0=py38hed8969a_1
- - bowtie2=2.4.2=py38h1c8e9b9_1
- - brotlipy=0.7.0=py38h497a2fe_1001
- - bwidget=1.9.14=ha770c72_0
- - bx-python=0.8.9=py38hb90e610_2
+ - biopython=1.78=py39h3811e60_2
+ - boost-cpp=1.74.0=hc6e9bd1_2
+ - boto3=1.17.44=pyhd8ed1ab_0
+ - botocore=1.20.44=pyhd8ed1ab_0
+ - bowtie=1.3.0=py39h176da8b_2
+ - bowtie2=2.4.2=py39hc9c6fcd_2
+ - brotlipy=0.7.0=py39h3811e60_1001
+ - bwidget=1.9.14=0
+ - bx-python=0.8.11=py39h5d76eff_1
- bzip2=1.0.8=h7f98852_4
- - c-ares=1.17.1=h36c2ea0_0
- - ca-certificates=2020.12.5=ha878542_0
- - cairo=1.16.0=hcf35c78_1003
- - certifi=2020.12.5=py38h578d9bd_1
- - cffi=1.14.5=py38ha65f79e_0
- - chardet=4.0.0=py38h578d9bd_1
+ - c-ares=1.17.1=h7f98852_1
+ - ca-certificates=2021.1.19=h06a4308_1
+ - cachetools=4.2.1=pyhd8ed1ab_0
+ - cairo=1.16.0=h6cf1ce9_1008
+ - certifi=2020.12.5=py39hf3d152e_1
+ - cffi=1.14.5=py39he32792d_0
+ - chardet=4.0.0=py39hf3d152e_1
- click=7.1.2=pyh9f0ad1d_0
- - coincbc=2.10.5=hab63836_1
- - coloredlogs=15.0=py38h578d9bd_0
+ - coincbc=2.10.5=hcee13e7_1
+ - colorama=0.4.4=pyh9f0ad1d_0
+ - coloredlogs=15.0=py39hf3d152e_0
- colormath=3.0.0=py_2
- - configargparse=1.3=pyhd8ed1ab_0
- - cryptography=3.4.4=py38h3e25421_0
- - curl=7.71.1=he644dc0_8
- - cutadapt=3.2=py38h0213d0e_0
+ - commonmark=0.9.1=py_0
+ - configargparse=1.4=pyhd8ed1ab_0
+ - cryptography=3.4.7=py39hbca0aa6_0
+ - curl=7.76.0=h979ede3_0
+ - cutadapt=3.3=py39h38f01e4_1
- cycler=0.10.0=py_2
- - datrie=0.8.2=py38h1e0a361_1
- - decorator=4.4.2=py_0
- - deeptools=3.5.0=py_0
- - deeptoolsintervals=0.1.9=py38h0213d0e_2
- - dnaio=0.5.0=py38h0213d0e_0
- - docutils=0.16=py38h578d9bd_3
+ - datrie=0.8.2=py39h07f9747_1
+ - dbus=1.13.18=hb2f20db_0
+ - decorator=5.0.5=pyhd8ed1ab_0
+ - deeptools=3.5.1=py_0
+ - deeptoolsintervals=0.1.9=py39h38f01e4_3
+ - dnaio=0.5.0=py39h38f01e4_1
+ - docutils=0.17=py39hf3d152e_0
- execnet=1.8.0=pyh44b312d_0
- - expat=2.2.10=h9c3ff4c_0
- - fastq-screen=0.14.0=pl526_0
- - fastqc=0.11.9=0
+ - expat=2.3.0=h9c3ff4c_0
+ - fastq-screen=0.14.0=pl5262hdfd78af_1
+ - fastqc=0.11.9=hdfd78af_1
+ - filelock=3.0.12=pyh9f0ad1d_0
- font-ttf-dejavu-sans-mono=2.37=hab24e00_0
- fontconfig=2.13.1=hba837de_1004
- freetype=2.10.4=h0708190_1
- - fribidi=1.0.10=h36c2ea0_0
- - future=0.18.2=py38h578d9bd_3
- - gat=1.3.6=py38h197edbe_2
- - gcc_impl_linux-64=7.5.0=hda68d29_13
- - gcc_linux-64=7.5.0=h47867f9_30
- - gettext=0.19.8.1=h0b5b191_1005
- - gffread=0.12.1=h8b12597_0
+ - fribidi=1.0.10=h516909a_0
+ - future=0.18.2=py39hf3d152e_3
+ - gat=1.3.6=py39hd1f1204_3
+ - gcc_impl_linux-64=9.3.0=h70c0ae5_18
+ - gcc_linux-64=9.3.0=hf25ea35_30
+ - gettext=0.20.2=hf68c758_0
+ - gffread=0.12.1=h2e03b76_1
- gffutils=0.10.1=pyh864c0ab_1
- - gfortran_impl_linux-64=7.5.0=h56cb351_18
- - gfortran_linux-64=7.5.0=h78c8a43_30
- - giflib=5.2.1=h36c2ea0_2
- - gitdb=4.0.5=pyhd8ed1ab_1
- - gitpython=3.1.13=pyhd8ed1ab_0
- - glib=2.66.7=h9c3ff4c_0
- - glib-tools=2.66.7=h9c3ff4c_0
- - graphite2=1.3.13=h58526e2_1001
+ - gfortran_impl_linux-64=9.3.0=hc4a2995_18
+ - gfortran_linux-64=9.3.0=hdc58fab_30
+ - giflib=5.2.1=h516909a_2
+ - gitdb=4.0.7=pyhd8ed1ab_0
+ - gitpython=3.1.14=pyhd8ed1ab_0
+ - glib=2.68.0=h9c3ff4c_2
+ - glib-tools=2.68.0=h9c3ff4c_2
+ - google-api-core=1.26.2=pyhd8ed1ab_0
+ - google-auth=1.28.0=pyh44b312d_0
+ - google-cloud-core=1.6.0=pyhd3eb1b0_0
+ - google-cloud-storage=1.37.0=pyhd3eb1b0_0
+ - google-crc32c=1.1.2=py39hb81f231_0
+ - google-resumable-media=1.2.0=pyhd3deb0d_0
+ - googleapis-common-protos=1.53.0=py39hf3d152e_0
+ - graphite2=1.3.14=h23475e2_0
- gsl=2.6=he838d99_2
- - gxx_impl_linux-64=7.5.0=h64c220c_13
- - gxx_linux-64=7.5.0=h555fc39_30
- - harfbuzz=2.4.0=h9f30f68_3
- - hdf5=1.10.5=nompi_h7c3c948_1111
- - hisat2=2.2.1=he1b5a44_2
- - htslib=1.11=hd3b49d5_1
- - humanfriendly=9.1=py38h578d9bd_0
- - icu=64.2=he1b5a44_1
+ - gst-plugins-base=1.18.4=h29181c9_0
+ - gstreamer=1.18.4=h76c114f_0
+ - gxx_impl_linux-64=9.3.0=hd87eabc_18
+ - gxx_linux-64=9.3.0=h3fbe746_30
+ - harfbuzz=2.8.0=h83ec7ef_1
+ - hdf5=1.10.5=nompi_h5b725eb_1114
+ - hisat2=2.2.1=h1b792b2_3
+ - htslib=1.12=h9093b5e_1
+ - humanfriendly=9.1=py39hf3d152e_0
+ - icu=68.1=h58526e2_0
- idna=2.10=pyh9f0ad1d_0
- - importlib-metadata=3.4.0=py38h578d9bd_0
- - importlib_metadata=3.4.0=hd8ed1ab_0
+ - importlib-metadata=3.10.0=py39hf3d152e_0
+ - importlib_metadata=3.10.0=hd8ed1ab_0
- iniconfig=1.1.1=pyh9f0ad1d_0
- intervalstats=1.01=0
- - ipython=7.20.0=py38h81c977d_2
+ - ipython=7.22.0=py39hef51801_0
- ipython_genutils=0.2.0=py_1
- - isa-l=2.30.0=h7f98852_1
- - jedi=0.18.0=py38h578d9bd_2
+ - isa-l=2.30.0=ha770c72_4
+ - jedi=0.18.0=py39hf3d152e_2
- jemalloc=5.2.1=h9c3ff4c_5
- jinja2=2.11.3=pyh44b312d_0
- - jpeg=9d=h36c2ea0_0
- - jsonschema=3.2.0=py_2
- - jupyter_core=4.7.1=py38h578d9bd_0
+ - jmespath=0.10.0=pyh9f0ad1d_0
+ - jpeg=9d=h516909a_0
+ - jsonschema=3.2.0=pyhd8ed1ab_3
+ - jupyter_core=4.7.1=py39hf3d152e_0
- kernel-headers_linux-64=2.6.32=h77966d4_13
- - kiwisolver=1.3.1=py38h1fd1430_1
+ - kiwisolver=1.3.1=py39h1a9c180_1
- krb5=1.17.2=h926e7f8_0
- - lcms2=2.11=hcbb858e_1
+ - lcms2=2.12=hddcbb42_0
- ld_impl_linux-64=2.35.1=hea4e1c9_2
- libblas=3.9.0=8_openblas
- libcblas=3.9.0=8_openblas
- - libcurl=7.71.1=hcdd3856_8
- - libdeflate=1.6=h516909a_0
- - libedit=3.1.20191231=he28a2e2_2
+ - libclang=11.1.0=default_ha53f305_0
+ - libcrc32c=1.1.1=he1b5a44_2
+ - libcurl=7.76.0=hc4aaa36_0
+ - libdeflate=1.7=h7f98852_5
+ - libedit=3.1.20210216=h27cfd23_1
- libev=4.33=h516909a_1
+ - libevent=2.1.10=hcdb4288_3
- libffi=3.3=h58526e2_2
+ - libgcc-devel_linux-64=9.3.0=h7864c58_18
- libgcc-ng=9.3.0=h2828fa1_18
- - libgd=2.2.5=h307a58e_1007
- - libgfortran-ng=7.5.0=h14aa051_18
- - libgfortran4=7.5.0=h14aa051_18
- - libglib=2.66.7=h1f3bc88_0
+ - libgd=2.3.2=h78a0170_0
+ - libgfortran-ng=9.3.0=hff62375_18
+ - libgfortran5=9.3.0=hff62375_18
+ - libglib=2.68.0=h3e27bee_2
- libgomp=9.3.0=h2828fa1_18
- libiconv=1.16=h516909a_0
- liblapack=3.9.0=8_openblas
+ - libllvm11=11.1.0=hf817b99_1
- libnghttp2=1.43.0=h812cca2_0
- - libopenblas=0.3.12=pthreads_hb3c22a3_1
- - libpng=1.6.37=h21135ba_2
- - libssh2=1.9.0=hab1572f_5
+ - libopenblas=0.3.12=pthreads_h4812303_1
+ - libpng=1.6.37=hed695b0_2
+ - libpq=13.1=hfd2b0eb_2
+ - libprotobuf=3.15.6=h780b84a_0
+ - libssh2=1.9.0=ha56f1ee_6
+ - libstdcxx-devel_linux-64=9.3.0=hb016644_18
- libstdcxx-ng=9.3.0=h6de172a_18
- - libtiff=4.1.0=hc3755c2_3
- - libuuid=2.32.1=h7f98852_1000
- - libwebp=1.0.2=h56121f0_5
- - libxcb=1.13=h7f98852_1003
- - libxml2=2.9.10=hee79883_0
+ - libtiff=4.2.0=hdc55705_0
+ - libuuid=2.32.1=h14c3975_1000
+ - libwebp=1.2.0=h3452ae3_0
+ - libwebp-base=1.2.0=h7f98852_2
+ - libxcb=1.14=h7b6447c_0
+ - libxkbcommon=1.0.3=he3ba5ed_0
+ - libxml2=2.9.10=h72842e0_3
- lz4-c=1.9.3=h9c3ff4c_0
- lzo=2.10=h516909a_1000
- lzstring=1.0.4=py_1001
- make=4.3=hd18ef5c_1
- - markdown=3.3.3=pyh9f0ad1d_0
- - markupsafe=1.1.1=py38h497a2fe_3
- - matplotlib=3.3.2=0
- - matplotlib-base=3.3.2=py38h5c7f4ab_1
+ - markdown=3.3.4=pyhd8ed1ab_0
+ - markupsafe=1.1.1=py39h3811e60_3
+ - matplotlib=3.4.1=py39hf3d152e_0
+ - matplotlib-base=3.4.1=py39h2fa2bec_0
- more-itertools=8.7.0=pyhd8ed1ab_0
- - multiqc=1.9=py_1
+ - multidict=5.1.0=py39h3811e60_1
+ - multiqc=1.10.1=py_0
+ - mysql-common=8.0.23=ha770c72_1
- mysql-connector-c=6.1.11=h6eb9d5d_1007
- - nbformat=5.1.2=pyhd8ed1ab_1
- - ncbi-ngs-sdk=2.10.9=h3e72335_0
+ - mysql-libs=8.0.23=h935591d_1
+ - nbformat=5.1.3=pyhd8ed1ab_0
+ - ncbi-ngs-sdk=2.10.9=hff44eed_1
- ncurses=6.2=h58526e2_4
- networkx=2.5=py_0
- - numpy=1.20.1=py38h18fd61f_0
+ - nspr=4.30=h9c3ff4c_0
+ - nss=3.63=hb5efdd6_0
+ - numpy=1.20.2=py39hdbf815f_0
- olefile=0.46=pyh9f0ad1d_1
- - openblas=0.3.12=pthreads_h43bd3aa_1
- - openjdk=11.0.8=hacce0ff_0
- - openssl=1.1.1j=h7f98852_0
+ - openblas=0.3.12=pthreads_h04b7a96_1
+ - openjdk=11.0.1=h516909a_1016
+ - openssl=1.1.1k=h7f98852_0
- ossuuid=1.6.2=hf484d3e_1000
- packaging=20.9=pyh44b312d_0
- - pandas=1.2.2=py38h51da96c_0
- - pandoc=2.11.4=h7f98852_0
- - pango=1.42.4=h7062337_4
- - parso=0.8.1=pyhd8ed1ab_0
+ - pandas=1.2.3=py39hde0f152_0
+ - pandoc=2.12=h7f98852_0
+ - pango=1.48.4=hb8ff022_0
+ - parso=0.8.2=pyhd8ed1ab_0
- patsy=0.5.1=py_0
- pcre=8.44=he1b5a44_0
- - pcre2=10.35=h032f7d1_2
+ - pcre2=10.36=h032f7d1_1
- perl=5.26.2=h36c2ea0_1008
- perl-app-cpanminus=1.7044=pl526_1
- perl-business-isbn=3.004=pl526_0
@@ -164,7 +199,7 @@ dependencies:
- perl-extutils-makemaker=7.36=pl526_1
- perl-file-path=2.16=pl526_0
- perl-file-temp=0.2304=pl526_2
- - perl-gd=2.71=pl526he860b03_0
+ - perl-gd=2.68=pl526he941832_0
- perl-gdgraph=1.54=pl526_0
- perl-gdtextutil=0.86=pl526h14c3975_5
- perl-mime-base64=3.15=pl526_1
@@ -176,109 +211,119 @@ dependencies:
- perl-xml-sax-base=1.09=pl526_0
- perl-xsloader=0.24=pl526_0
- pexpect=4.8.0=pyh9f0ad1d_2
- - picard=2.25.0=0
- - pickleshare=0.7.5=py_1003
- - pigz=2.5=h27826a3_0
- - pillow=8.1.0=py38h357d4e7_1
+ - picard=2.25.1=hdfd78af_1
+ - pickleshare=0.7.5=py39hde42818_1002
+ - pigz=2.6=h27826a3_0
+ - pillow=8.2.0=py39he98fc37_0
- pip=21.0.1=pyhd8ed1ab_0
- - pixman=0.38.0=h516909a_1003
+ - pixman=0.40.0=h36c2ea0_0
- plotly=4.14.3=pyh44b312d_0
- - pluggy=0.13.1=py38h578d9bd_4
- - preseq=2.0.3=hc216eb9_5
- - prompt-toolkit=3.0.16=pyha770c72_0
- - psutil=5.8.0=py38h497a2fe_1
- - pthread-stubs=0.4=h36c2ea0_1001
+ - pluggy=0.13.1=py39hf3d152e_4
+ - preseq=3.1.2=h06ef8b0_1
+ - prompt-toolkit=3.0.18=pyha770c72_0
+ - protobuf=3.15.6=py39he80948d_0
+ - psutil=5.8.0=py39h3811e60_1
- ptyprocess=0.7.0=pyhd3deb0d_0
- - pulp=2.3.1=py38h32f6830_0
+ - pulp=2.4=py39hf3d152e_0
- py=1.10.0=pyhd3deb0d_0
- - py2bit=0.3.0=py38h0213d0e_4
- - pybedtools=0.8.1=py38h1c8e9b9_2
- - pybigwig=0.3.18=py38h55f8d50_0
+ - py2bit=0.3.0=py39h38f01e4_5
+ - pyasn1=0.4.8=py_0
+ - pyasn1-modules=0.2.8=py_0
+ - pybedtools=0.8.2=py39h39abbe0_1
+ - pybigwig=0.3.18=py39h015b436_1
- pycparser=2.20=pyh9f0ad1d_2
- - pyfaidx=0.5.9.2=pyh3252c3a_0
- - pygments=2.8.0=pyhd8ed1ab_0
+ - pyfaidx=0.5.9.5=pyh3252c3a_0
+ - pygments=2.8.1=pyhd8ed1ab_0
- pyopenssl=20.0.1=pyhd8ed1ab_0
- pyparsing=2.4.7=pyh9f0ad1d_0
- - pyrsistent=0.17.3=py38h497a2fe_2
- - pysam=0.16.0.1=py38hbdc2ae9_1
- - pysocks=1.7.1=py38h578d9bd_3
- - pytest=6.2.2=py38h578d9bd_0
+ - pyqt=5.12.3=py39hf3d152e_7
+ - pyqt-impl=5.12.3=py39h0fcd23e_7
+ - pyqt5-sip=4.19.18=py39he80948d_7
+ - pyqtchart=5.12=py39h0fcd23e_7
+ - pyqtwebengine=5.12.1=py39h0fcd23e_7
+ - pyrsistent=0.17.3=py39h3811e60_2
+ - pysam=0.16.0.1=py39h051187c_3
+ - pysocks=1.7.1=py39hf3d152e_3
+ - pytest=6.2.2=py39hf3d152e_0
- pytest-forked=1.3.0=pyhd3deb0d_0
- pytest-xdist=2.2.1=pyhd8ed1ab_0
- - python=3.8.6=hffdb5ce_5_cpython
+ - python=3.9.2=hffdb5ce_0_cpython
- python-dateutil=2.8.1=py_0
- - python-isal=0.4.0=py38h497a2fe_0
- - python-lzo=1.12=py38h86e1cee_1003
- - python_abi=3.8=1_cp38
+ - python-isal=0.9.0=py39h3811e60_1
+ - python-lzo=1.12=py39h265373d_1003
+ - python_abi=3.9=1_cp39
- pytz=2021.1=pyhd8ed1ab_0
- - pyyaml=5.4.1=py38h497a2fe_0
- - r-base=4.0.2=h95c6c4b_0
+ - pyyaml=5.4.1=py39h3811e60_0
+ - qt=5.12.9=hda022c4_4
+ - r-base=4.0.3=h349a78a_8
- ratelimiter=1.2.0=py_1002
- - readline=8.0=he28a2e2_2
+ - readline=8.1=h27cfd23_0
- requests=2.25.1=pyhd3deb0d_0
- retrying=1.3.3=py_2
- - rseqc=4.0.0=py38h0213d0e_0
- - salmon=1.4.0=hf69c8f4_0
- - samtools=1.11=h6270b1f_0
- - scipy=1.5.3=py38h828c644_0
- - seaborn=0.11.1=hd8ed1ab_1
+ - rich=10.1.0=py39hf3d152e_0
+ - rsa=4.7.2=pyh44b312d_0
+ - rseqc=3.0.1=py_0
+ - s3transfer=0.3.6=pyhd8ed1ab_0
+ - salmon=1.4.0=h84f40af_1
+ - samtools=1.12=h9aed4be_1
+ - scipy=1.6.2=py39hee8e79c_0
+ - seaborn=0.11.1=ha770c72_0
- seaborn-base=0.11.1=pyhd8ed1ab_1
- sed=4.8=he412f7d_0
- - setuptools=49.6.0=py38h578d9bd_3
- - simplejson=3.17.2=py38h497a2fe_2
+ - setuptools=52.0.0=py39h06a4308_0
+ - simplejson=3.17.2=py39h3811e60_2
- six=1.15.0=pyh9f0ad1d_0
+ - smart_open=5.0.0=pyhd3eb1b0_0
- smmap=3.0.5=pyh44b312d_0
- - snakemake-minimal=5.32.2=py_0
+ - snakemake-minimal=6.1.0=pyhdfd78af_1
- spectra=0.0.11=py_1
- - sqlite=3.34.0=h74cdb3f_0
+ - sqlite=3.35.3=h74cdb3f_0
- sra-tools=2.10.9=pl526haddd2b5_0
- - star=2.7.7a=0
- - statsmodels=0.12.2=py38h5c078b8_0
- - subread=2.0.1=hed695b0_0
+ - star=2.7.8a=h9ee0642_1
+ - statsmodels=0.12.2=py39hce5d2b2_0
+ - subread=2.0.1=h5bf99c6_1
- sysroot_linux-64=2.12=h77966d4_13
- - tbb=2020.2=h4bd325d_3
- - tk=8.6.10=h21135ba_1
+ - tbb=2020.2=h4bd325d_4
+ - tk=8.6.10=hed695b0_1
- tktable=2.10=hb7b940f_3
- toml=0.10.2=pyhd8ed1ab_0
- toposort=1.6=pyhd8ed1ab_0
- - tornado=6.1=py38h497a2fe_1
+ - tornado=6.1=py39h3811e60_1
- trackhub=0.2.4=pyh864c0ab_2
- traitlets=5.0.5=py_0
- - ucsc-bedgraphtobigwig=377=h446ed27_1
- - ucsc-bedsort=377=h446ed27_2
- - ucsc-bedtobigbed=377=h446ed27_1
- - ucsc-bigwigmerge=377=h446ed27_1
- - ucsc-fetchchromsizes=377=h446ed27_1
- - ucsc-genepredtobed=377=h446ed27_3
- - ucsc-gtftogenepred=377=h446ed27_3
- - ucsc-liftover=377=h446ed27_2
- - ucsc-oligomatch=377=h446ed27_1
- - ucsc-twobittofa=377=h446ed27_2
- - ucsc-wigtobigwig=377=h446ed27_1
- - urllib3=1.26.3=pyhd8ed1ab_0
+ - typing-extensions=3.7.4.3=0
+ - typing_extensions=3.7.4.3=py_0
+ - tzdata=2021a=he74cb21_0
+ - ucsc-bedgraphtobigwig=377=h0b8a92a_2
+ - ucsc-bedsort=377=h0b8a92a_3
+ - ucsc-bedtobigbed=377=h0b8a92a_2
+ - ucsc-bigwigmerge=377=h0b8a92a_2
+ - ucsc-fetchchromsizes=377=h0b8a92a_2
+ - ucsc-genepredtobed=377=h0b8a92a_4
+ - ucsc-gtftogenepred=377=h0b8a92a_4
+ - ucsc-liftover=377=h0b8a92a_3
+ - ucsc-oligomatch=377=h0b8a92a_2
+ - ucsc-twobittofa=377=h0b8a92a_3
+ - ucsc-wigtobigwig=377=h0b8a92a_2
+ - urllib3=1.26.4=pyhd8ed1ab_0
- wcwidth=0.2.5=pyh9f0ad1d_2
- wheel=0.36.2=pyhd3deb0d_0
- - wrapt=1.12.1=py38h497a2fe_3
- - xopen=1.1.0=py38h578d9bd_1
- - xorg-fixesproto=5.0=h14c3975_1002
- - xorg-inputproto=2.3.2=h7f98852_1002
- - xorg-kbproto=1.0.7=h7f98852_1002
+ - wrapt=1.12.1=py39h3811e60_3
+ - xopen=1.1.0=py39hf3d152e_2
+ - xorg-kbproto=1.0.7=h14c3975_1002
- xorg-libice=1.0.10=h516909a_0
- - xorg-libsm=1.2.3=h84519dc_1000
- - xorg-libx11=1.6.12=h516909a_0
- - xorg-libxau=1.0.9=h7f98852_0
- - xorg-libxdmcp=1.1.3=h7f98852_0
- - xorg-libxext=1.3.4=h516909a_0
- - xorg-libxfixes=5.0.3=h516909a_1004
- - xorg-libxi=1.7.10=h516909a_0
- - xorg-libxrender=0.9.10=h516909a_1002
- - xorg-libxtst=1.2.3=h516909a_1002
- - xorg-recordproto=1.14.2=h516909a_1002
+ - xorg-libsm=1.2.3=hd9c2040_1000
+ - xorg-libx11=1.7.0=h36c2ea0_0
+ - xorg-libxext=1.3.4=h7f98852_1
+ - xorg-libxrender=0.9.10=h7f98852_1003
+ - xorg-libxt=1.2.1=h7f98852_2
- xorg-renderproto=0.11.1=h14c3975_1002
- - xorg-xextproto=7.3.0=h7f98852_1002
- - xorg-xproto=7.0.31=h7f98852_1007
+ - xorg-xextproto=7.3.0=h14c3975_1002
+ - xorg-xproto=7.0.31=h14c3975_1007
- xz=5.2.5=h516909a_1
- yaml=0.2.5=h516909a_0
- - zipp=3.4.0=py_0
+ - yarl=1.5.1=py39h07f9747_0
+ - zipp=3.4.1=pyhd8ed1ab_0
- zlib=1.2.11=h516909a_1010
- - zstd=1.4.8=ha95c52a_1
+ - zstd=1.4.9=ha95c52a_0
+prefix: /home/dalerr/lcdb-wf/env
From 99851a12e310522d0ba05845ad5a427e88549c13 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 14:19:34 -0400
Subject: [PATCH 18/23] use pinned env for deploy and tests
---
.circleci/config.yml | 6 ++----
deploy.py | 4 ++--
2 files changed, 4 insertions(+), 6 deletions(-)
diff --git a/.circleci/config.yml b/.circleci/config.yml
index 550d88c8..897630f8 100644
--- a/.circleci/config.yml
+++ b/.circleci/config.yml
@@ -71,11 +71,9 @@ variables:
conda config --system --add channels bioconda
conda config --system --add channels conda-forge
conda install mamba -y
- mamba env create -n lcdb-wf-test --file env.yml
- mamba env create -n lcdb-wf-test-r --file env-r.yml
+ mamba env create -n lcdb-wf-test --file env-pinned.yml
+ mamba env create -n lcdb-wf-test-r --file env-r-pinned.yml
fi
- # conda env export -n lcdb-wf-test > env.yaml
- # conda env export -n lcdb-wf-test-r > env-r.yaml
# --------------------------------------------------------------------------
# Deploy into a new directory and get the test data.
diff --git a/deploy.py b/deploy.py
index 6967a5e3..3d84bda8 100644
--- a/deploy.py
+++ b/deploy.py
@@ -223,7 +223,7 @@ def filter_out_other_workflows(filenames, patterns_to_include, prefilter="workfl
"-p",
"./env",
"--file",
- "env.yml",
+ "env-pinned.yml",
"-c",
"conda-forge",
"-c",
@@ -242,7 +242,7 @@ def filter_out_other_workflows(filenames, patterns_to_include, prefilter="workfl
"-p",
"./env-r",
"--file",
- "env-r.yml",
+ "env-r-pinned.yml",
"-c",
"conda-forge",
"-c",
From b979450386123f34c215ff542e19252bd32b3cb2 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 14:20:25 -0400
Subject: [PATCH 19/23] update env-r-pinned
---
env-r-pinned.yml | 328 +++++++++++++++++++++++------------------------
1 file changed, 164 insertions(+), 164 deletions(-)
diff --git a/env-r-pinned.yml b/env-r-pinned.yml
index 00a4d6ec..332e515f 100644
--- a/env-r-pinned.yml
+++ b/env-r-pinned.yml
@@ -1,3 +1,4 @@
+name: /home/dalerr/lcdb-wf/mamba-env-r-unpinned
channels:
- conda-forge
- bioconda
@@ -8,174 +9,172 @@ dependencies:
- _r-mutex=1.0.1=anacondar_1
- binutils_impl_linux-64=2.35.1=h193b22a_2
- binutils_linux-64=2.35=h67ddf6f_30
- - bioconductor-all=1.32.0=r40_0
- - bioconductor-annotate=1.68.0=r40_0
- - bioconductor-annotationdbi=1.52.0=r40_0
- - bioconductor-annotationhub=2.22.0=r40_0
- - bioconductor-apeglm=1.12.0=r40h5f743cb_0
- - bioconductor-biobase=2.50.0=r40h037d062_0
- - bioconductor-biocfilecache=1.14.0=r40_0
- - bioconductor-biocgenerics=0.36.0=r40_0
- - bioconductor-biocparallel=1.24.0=r40h5f743cb_0
- - bioconductor-biocversion=3.12.0=r40_0
- - bioconductor-biomart=2.46.0=r40_0
- - bioconductor-biostrings=2.58.0=r40h037d062_0
- - bioconductor-clusterprofiler=3.18.0=r40_0
- - bioconductor-complexheatmap=2.6.2=r40_0
- - bioconductor-consensusclusterplus=1.54.0=r40_0
- - bioconductor-degreport=1.26.0=r40_0
- - bioconductor-delayedarray=0.16.0=r40h037d062_0
- - bioconductor-deseq2=1.30.0=r40h5f743cb_0
- - bioconductor-do.db=2.9=r40_9
- - bioconductor-dose=3.16.0=r40_0
- - bioconductor-dupradar=1.20.0=r40_0
- - bioconductor-edger=3.32.0=r40h5f743cb_0
- - bioconductor-enrichplot=1.10.0=r40_0
- - bioconductor-fgsea=1.16.0=r40h5f743cb_0
- - bioconductor-genefilter=1.72.0=r40hc6cf775_0
- - bioconductor-geneplotter=1.68.0=r40_0
- - bioconductor-genomeinfodb=1.26.0=r40_0
- - bioconductor-genomeinfodbdata=1.2.4=r40_0
- - bioconductor-genomicalignments=1.26.0=r40h037d062_0
- - bioconductor-genomicfeatures=1.42.0=r40_0
- - bioconductor-genomicranges=1.42.0=r40h037d062_0
- - bioconductor-go.db=3.12.1=r40_0
- - bioconductor-gosemsim=2.16.0=r40h5f743cb_0
- - bioconductor-graph=1.68.0=r40h037d062_0
- - bioconductor-graphite=1.36.0=r40_0
- - bioconductor-ihw=1.18.0=r40_0
- - bioconductor-interactivedisplaybase=1.28.0=r40_0
- - bioconductor-iranges=2.24.0=r40h037d062_0
- - bioconductor-limma=3.46.0=r40h037d062_0
- - bioconductor-lpsymphony=1.18.0=r40h5f743cb_0
- - bioconductor-matrixgenerics=1.2.0=r40_0
- - bioconductor-qvalue=2.22.0=r40_0
- - bioconductor-reactome.db=1.74.0=r40_0
- - bioconductor-reactomepa=1.34.0=r40_0
- - bioconductor-rhtslib=1.22.0=r40h037d062_0
- - bioconductor-rsamtools=2.6.0=r40h5f743cb_0
- - bioconductor-rsubread=2.4.0=r40h037d062_0
- - bioconductor-rtracklayer=1.50.0=r40h9bb0e53_1
- - bioconductor-s4vectors=0.28.0=r40h037d062_0
- - bioconductor-summarizedexperiment=1.20.0=r40_0
- - bioconductor-sva=3.38.0=r40h037d062_0
- - bioconductor-tximport=1.18.0=r40_0
- - bioconductor-xvector=0.30.0=r40h037d062_0
- - bioconductor-zlibbioc=1.36.0=r40h037d062_0
- - bwidget=1.9.14=ha770c72_0
+ - bioconductor-all=1.32.0=r40hdfd78af_1
+ - bioconductor-annotate=1.68.0=r40hdfd78af_1
+ - bioconductor-annotationdbi=1.52.0=r40hdfd78af_1
+ - bioconductor-annotationhub=2.22.0=r40hdfd78af_1
+ - bioconductor-apeglm=1.12.0=r40h399db7b_1
+ - bioconductor-biobase=2.50.0=r40hd029910_1
+ - bioconductor-biocfilecache=1.14.0=r40hdfd78af_1
+ - bioconductor-biocgenerics=0.36.0=r40hdfd78af_1
+ - bioconductor-biocparallel=1.24.1=r40h399db7b_0
+ - bioconductor-biocversion=3.12.0=r40hdfd78af_1
+ - bioconductor-biomart=2.46.3=r40hdfd78af_0
+ - bioconductor-biostrings=2.58.0=r40hd029910_1
+ - bioconductor-clusterprofiler=3.18.1=r40hdfd78af_0
+ - bioconductor-complexheatmap=2.6.2=r40hdfd78af_1
+ - bioconductor-consensusclusterplus=1.54.0=r40hdfd78af_1
+ - bioconductor-degreport=1.26.0=r40hdfd78af_1
+ - bioconductor-delayedarray=0.16.3=r40hd029910_0
+ - bioconductor-deseq2=1.30.1=r40h399db7b_0
+ - bioconductor-do.db=2.9=r40hdfd78af_10
+ - bioconductor-dose=3.16.0=r40hdfd78af_1
+ - bioconductor-dupradar=1.20.0=r40hdfd78af_1
+ - bioconductor-edger=3.32.1=r40h399db7b_0
+ - bioconductor-enrichplot=1.10.2=r40hdfd78af_0
+ - bioconductor-fgsea=1.16.0=r40h399db7b_1
+ - bioconductor-genefilter=1.72.1=r40hba52eb8_0
+ - bioconductor-geneplotter=1.68.0=r40hdfd78af_1
+ - bioconductor-genomeinfodb=1.26.4=r40hdfd78af_0
+ - bioconductor-genomeinfodbdata=1.2.4=r40hdfd78af_2
+ - bioconductor-genomicalignments=1.26.0=r40hd029910_1
+ - bioconductor-genomicfeatures=1.42.2=r40hdfd78af_0
+ - bioconductor-genomicranges=1.42.0=r40hd029910_1
+ - bioconductor-go.db=3.12.1=r40hdfd78af_1
+ - bioconductor-gosemsim=2.16.1=r40h399db7b_0
+ - bioconductor-graph=1.68.0=r40hd029910_1
+ - bioconductor-graphite=1.36.0=r40hdfd78af_1
+ - bioconductor-ihw=1.18.0=r40hdfd78af_1
+ - bioconductor-interactivedisplaybase=1.28.0=r40hdfd78af_1
+ - bioconductor-iranges=2.24.1=r40hd029910_0
+ - bioconductor-limma=3.46.0=r40hd029910_1
+ - bioconductor-lpsymphony=1.18.0=r40h399db7b_1
+ - bioconductor-matrixgenerics=1.2.1=r40hdfd78af_0
+ - bioconductor-qvalue=2.22.0=r40hdfd78af_1
+ - bioconductor-reactome.db=1.74.0=r40hdfd78af_1
+ - bioconductor-reactomepa=1.34.0=r40hdfd78af_1
+ - bioconductor-rhtslib=1.22.0=r40hd029910_1
+ - bioconductor-rsamtools=2.6.0=r40h399db7b_1
+ - bioconductor-rsubread=2.4.3=r40hd029910_0
+ - bioconductor-rtracklayer=1.50.0=r40h7f5ccec_2
+ - bioconductor-s4vectors=0.28.1=r40hd029910_0
+ - bioconductor-summarizedexperiment=1.20.0=r40hdfd78af_1
+ - bioconductor-sva=3.38.0=r40hd029910_1
+ - bioconductor-tximport=1.18.0=r40hdfd78af_1
+ - bioconductor-xvector=0.30.0=r40hd029910_1
+ - bioconductor-zlibbioc=1.36.0=r40hd029910_1
+ - bwidget=1.9.14=0
- bzip2=1.0.8=h7f98852_4
- - c-ares=1.17.1=h36c2ea0_0
- - ca-certificates=2020.12.5=ha878542_0
- - cairo=1.16.0=h9f066cc_1006
- - certifi=2020.12.5=py39hf3d152e_1
- - curl=7.71.1=he644dc0_8
+ - c-ares=1.17.1=h7f98852_1
+ - ca-certificates=2021.1.19=h06a4308_1
+ - cairo=1.16.0=h6cf1ce9_1008
+ - curl=7.76.0=h979ede3_0
- fontconfig=2.13.1=hba837de_1004
- freetype=2.10.4=h0708190_1
- - fribidi=1.0.10=h36c2ea0_0
- - gcc_impl_linux-64=7.5.0=hda68d29_13
- - gcc_linux-64=7.5.0=h47867f9_30
- - gettext=0.19.8.1=h0b5b191_1005
- - gfortran_impl_linux-64=7.5.0=h56cb351_18
- - gfortran_linux-64=7.5.0=h78c8a43_30
- - glib=2.66.7=h9c3ff4c_0
- - glib-tools=2.66.7=h9c3ff4c_0
+ - fribidi=1.0.10=h516909a_0
+ - gcc_impl_linux-64=9.3.0=h70c0ae5_18
+ - gcc_linux-64=9.3.0=hf25ea35_30
+ - gettext=0.20.2=hf68c758_0
+ - gfortran_impl_linux-64=9.3.0=hc4a2995_18
+ - gfortran_linux-64=9.3.0=hdc58fab_30
- gmp=6.2.1=h58526e2_0
- - graphite2=1.3.13=h58526e2_1001
+ - graphite2=1.3.14=h23475e2_0
- gsl=2.6=he838d99_2
- - gxx_impl_linux-64=7.5.0=h64c220c_13
- - gxx_linux-64=7.5.0=h555fc39_30
- - harfbuzz=2.7.2=ha5b49bf_1
- - icu=67.1=he1b5a44_0
- - jpeg=9d=h36c2ea0_0
+ - gxx_impl_linux-64=9.3.0=hd87eabc_18
+ - gxx_linux-64=9.3.0=h3fbe746_30
+ - harfbuzz=2.8.0=h83ec7ef_1
+ - icu=68.1=h58526e2_0
+ - jpeg=9d=h516909a_0
- kernel-headers_linux-64=2.6.32=h77966d4_13
- krb5=1.17.2=h926e7f8_0
- ld_impl_linux-64=2.35.1=hea4e1c9_2
- - libblas=3.8.0=17_openblas
- - libcblas=3.8.0=17_openblas
- - libcurl=7.71.1=hcdd3856_8
- - libedit=3.1.20191231=he28a2e2_2
+ - libblas=3.9.0=8_openblas
+ - libcblas=3.9.0=8_openblas
+ - libcurl=7.76.0=hc4aaa36_0
+ - libedit=3.1.20210216=h27cfd23_1
- libev=4.33=h516909a_1
- libffi=3.3=h58526e2_2
+ - libgcc-devel_linux-64=9.3.0=h7864c58_18
- libgcc-ng=9.3.0=h2828fa1_18
- - libgfortran-ng=7.5.0=h14aa051_18
- - libgfortran4=7.5.0=h14aa051_18
- - libgit2=1.1.0=h0b03e73_0
- - libglib=2.66.7=h1f3bc88_0
+ - libgfortran-ng=9.3.0=hff62375_18
+ - libgfortran5=9.3.0=hff62375_18
+ - libgit2=1.1.0=h3974521_1
+ - libglib=2.68.0=h3e27bee_2
- libgomp=9.3.0=h2828fa1_18
- libiconv=1.16=h516909a_0
- - liblapack=3.8.0=17_openblas
+ - liblapack=3.9.0=8_openblas
- libnghttp2=1.43.0=h812cca2_0
- - libopenblas=0.3.10=pthreads_hb3c22a3_5
- - libpng=1.6.37=h21135ba_2
- - libssh2=1.9.0=hab1572f_5
+ - libopenblas=0.3.12=pthreads_h4812303_1
+ - libpng=1.6.37=hed695b0_2
+ - libssh2=1.9.0=ha56f1ee_6
+ - libstdcxx-devel_linux-64=9.3.0=hb016644_18
- libstdcxx-ng=9.3.0=h6de172a_18
- libtiff=4.2.0=hdc55705_0
- - libuuid=2.32.1=h7f98852_1000
- - libwebp-base=1.2.0=h7f98852_0
- - libxcb=1.13=h7f98852_1003
- - libxml2=2.9.10=h68273f3_2
+ - libuuid=2.32.1=h14c3975_1000
+ - libwebp-base=1.2.0=h7f98852_2
+ - libxcb=1.14=h7b6447c_0
+ - libxml2=2.9.10=h72842e0_3
- lz4-c=1.9.3=h9c3ff4c_0
- make=4.3=hd18ef5c_1
- ncurses=6.2=h58526e2_4
- - openssl=1.1.1j=h7f98852_0
- - pandoc=2.11.4=h7f98852_0
- - pango=1.42.4=h69149e4_5
+ - openssl=1.1.1k=h7f98852_0
+ - pandoc=2.12=h7f98852_0
+ - pango=1.48.4=hb8ff022_0
- pcre=8.44=he1b5a44_0
- - pcre2=10.35=h032f7d1_2
- - pip=21.0.1=pyhd8ed1ab_0
+ - pcre2=10.36=h032f7d1_1
- pixman=0.40.0=h36c2ea0_0
- - pthread-stubs=0.4=h36c2ea0_1001
- - python=3.9.1=hffdb5ce_5_cpython
- - python_abi=3.9=1_cp39
+ - r=4.0=r40_1004
- r-ashr=2.2_47=r40h0357c0b_1
- r-askpass=1.1=r40hcdcec82_2
- r-assertthat=0.2.1=r40h6115d3f_2
- r-backports=1.2.1=r40hcfec24a_0
- - r-base=4.0.2=he766273_1
+ - r-base=4.0.3=h349a78a_8
- r-base64enc=0.1_3=r40hcdcec82_1004
- r-bbmle=1.0.23.1=r40h6115d3f_1
- r-bdsmatrix=1.3_4=r40hcdcec82_1
- r-bh=1.75.0_0=r40hc72bb7e_0
- - r-biocmanager=1.30.10=r40h6115d3f_1
+ - r-biocmanager=1.30.12=r40hc72bb7e_0
- r-bit=4.0.4=r40hcdcec82_0
- r-bit64=4.0.5=r40hcdcec82_0
- r-bitops=1.0_6=r40hcdcec82_1004
- r-blob=1.2.1=r40h6115d3f_1
+ - r-boot=1.3_27=r40hc72bb7e_0
- r-brew=1.0_6=r40h6115d3f_1003
- r-brio=1.1.1=r40hcfec24a_0
- - r-broom=0.7.4=r40hc72bb7e_0
+ - r-broom=0.7.5=r40hc72bb7e_0
- r-bslib=0.2.4=r40hc72bb7e_0
- r-cachem=1.0.4=r40hcfec24a_0
- r-cairo=1.5_12.2=r40hcdcec82_0
- - r-callr=3.5.1=r40h142f84f_0
- - r-catools=1.18.1=r40h03ef668_0
+ - r-callr=3.6.0=r40hc72bb7e_0
+ - r-catools=1.18.2=r40h03ef668_0
- r-checkmate=2.0.0=r40hcdcec82_1
- r-circlize=0.4.12=r40hc72bb7e_0
- - r-cli=2.3.0=r40hc72bb7e_0
+ - r-class=7.3_18=r40hcfec24a_0
+ - r-cli=2.3.1=r40hc72bb7e_0
- r-clipr=0.7.1=r40h142f84f_0
- r-clue=0.3_58=r40h7f98852_0
- - r-cluster=2.1.0=r40h31ca83e_4
+ - r-cluster=2.1.1=r40h859d828_0
- r-coda=0.19_4=r40h142f84f_0
- r-codetools=0.2_18=r40hc72bb7e_0
- r-colorspace=2.0_0=r40h9e2df91_0
- r-commonmark=1.7=r40hcdcec82_1002
- r-covr=3.5.1=r40h0357c0b_0
- r-cowplot=1.1.1=r40hc72bb7e_0
- - r-cpp11=0.2.6=r40hc72bb7e_0
+ - r-cpp11=0.2.7=r40hc72bb7e_0
- r-crayon=1.4.1=r40hc72bb7e_0
- r-credentials=1.3.0=r40h6115d3f_0
- r-crosstalk=1.1.1=r40hc72bb7e_0
- - r-curl=4.3=r40hcdcec82_1
- - r-data.table=1.13.6=r40hcfec24a_0
+ - r-curl=4.3=r40hcfec24a_1
+ - r-data.table=1.14.0=r40hcfec24a_0
- r-dbi=1.1.1=r40hc72bb7e_0
- r-dbplyr=2.1.0=r40hc72bb7e_0
- r-dendextend=1.14.0=r40h6115d3f_0
- - r-desc=1.2.0=r40h6115d3f_1003
+ - r-desc=1.3.0=r40hc72bb7e_0
- r-devtools=2.3.2=r40h6115d3f_0
- r-diffobj=0.3.3=r40hcfec24a_0
- r-digest=0.6.27=r40h1b71b39_0
- r-downloader=0.4=r40h6115d3f_1003
- - r-dplyr=1.0.4=r40h03ef668_0
+ - r-dplyr=1.0.5=r40h03ef668_0
- r-dt=0.17=r40hc72bb7e_0
- r-egg=0.4.5=r40h6115d3f_2
- r-ellipsis=0.3.1=r40hcdcec82_0
@@ -183,26 +182,27 @@ dependencies:
- r-etrunct=0.1=r40_1002
- r-evaluate=0.14=r40h6115d3f_2
- r-fansi=0.4.2=r40hcfec24a_0
- - r-farver=2.0.3=r40h0357c0b_1
+ - r-farver=2.1.0=r40h03ef668_0
- r-fastmap=1.1.0=r40h03ef668_0
- r-fastmatch=1.1_0=r40hcdcec82_1005
- r-fdrtool=1.2.16=r40hcfec24a_0
- r-foreach=1.5.1=r40h142f84f_0
- - r-formatr=1.7=r40h6115d3f_2
+ - r-foreign=0.8_81=r40hcfec24a_0
+ - r-formatr=1.8=r40hc72bb7e_0
- r-fs=1.5.0=r40h0357c0b_0
- r-futile.logger=1.4.3=r40h6115d3f_1003
- r-futile.options=1.0.1=r40h6115d3f_1002
- r-gclus=1.3.2=r40h6115d3f_2
- r-generics=0.1.0=r40hc72bb7e_0
- - r-gert=1.2.0=r40hcfec24a_0
+ - r-gert=1.3.0=r40hbd84cd2_0
- r-getoptlong=1.0.5=r40hc72bb7e_0
- r-ggdendro=0.1.22=r40h6115d3f_0
- - r-ggforce=0.3.2=r40h0357c0b_0
+ - r-ggforce=0.3.3=r40h03ef668_0
- r-ggnewscale=0.4.5=r40hc72bb7e_0
- r-ggplot2=3.3.3=r40hc72bb7e_0
- - r-ggraph=2.0.4=r40he524a50_0
+ - r-ggraph=2.0.5=r40h03ef668_0
- r-ggrepel=0.9.1=r40h03ef668_0
- - r-gh=1.2.0=r40hc72bb7e_0
+ - r-gh=1.2.1=r40hc72bb7e_0
- r-git2r=0.28.0=r40hf628c3e_0
- r-gitcreds=0.1.1=r40hc72bb7e_0
- r-globaloptions=0.1.2=r40_0
@@ -213,22 +213,22 @@ dependencies:
- r-gtable=0.3.0=r40h6115d3f_3
- r-gtools=3.8.2=r40hcdcec82_1
- r-heatmaply=1.2.1=r40hc72bb7e_0
- - r-hexbin=1.28.1=r40h31ca83e_2
+ - r-hexbin=1.28.2=r40h859d828_0
- r-highr=0.8=r40h6115d3f_2
- r-hms=1.0.0=r40hc72bb7e_0
- r-htmltools=0.5.1.1=r40h03ef668_0
- r-htmlwidgets=1.5.3=r40hc72bb7e_0
- r-httpuv=1.5.5=r40h03ef668_0
- r-httr=1.4.2=r40h6115d3f_0
- - r-igraph=1.2.6=r40h084b37e_1
+ - r-igraph=1.2.6=r40hfbf21e4_1
- r-ini=0.3.1=r40h6115d3f_1003
- r-invgamma=1.1=r40h6115d3f_1
- r-irlba=2.3.3=r40h7fa42b6_3
- - r-isoband=0.2.3=r40h03ef668_0
+ - r-isoband=0.2.4=r40h03ef668_0
- r-iterators=1.0.13=r40h142f84f_0
- r-jquerylib=0.1.3=r40hc72bb7e_0
- r-jsonlite=1.7.2=r40hcfec24a_0
- - r-kernsmooth=2.23_18=r40h7679c2e_0
+ - r-kernsmooth=2.23_18=r40h742201e_0
- r-knitr=1.31=r40hc72bb7e_0
- r-labeling=0.4.2=r40h142f84f_0
- r-lambda.r=1.2.4=r40h6115d3f_1
@@ -248,18 +248,19 @@ dependencies:
- r-mgcv=1.8_34=r40he454529_0
- r-mime=0.10=r40hcfec24a_0
- r-mixsqp=0.3_43=r40hfbb317b_1
- - r-mnormt=1.5_7=r40h31ca83e_2
+ - r-mnormt=2.0.2=r40h859d828_0
- r-munsell=0.5.0=r40h6115d3f_1003
- - r-mvtnorm=1.1_1=r40h31ca83e_1
- - r-nlme=3.1_150=r40h31ca83e_0
+ - r-mvtnorm=1.1_1=r40h580db52_1
+ - r-nlme=3.1_152=r40h859d828_0
+ - r-nnet=7.3_15=r40hcfec24a_0
- r-nozzle.r1=1.1_1=r40_1003
- r-numderiv=2016.8_1.1=r40h6115d3f_3
- r-openssl=1.4.3=r40he5c4762_0
- r-pheatmap=1.0.12=r40h6115d3f_2
- - r-pillar=1.4.7=r40hc72bb7e_0
+ - r-pillar=1.5.1=r40hc72bb7e_0
- r-pkgbuild=1.2.0=r40hc72bb7e_0
- r-pkgconfig=2.0.3=r40h6115d3f_1
- - r-pkgload=1.1.0=r40h0357c0b_0
+ - r-pkgload=1.2.0=r40h03ef668_0
- r-plogr=0.2.0=r40h6115d3f_1003
- r-plotly=4.9.3=r40hc72bb7e_0
- r-plyr=1.8.6=r40h0357c0b_1
@@ -267,42 +268,44 @@ dependencies:
- r-polyclip=1.10_0=r40h0357c0b_2
- r-praise=1.0.0=r40h6115d3f_1004
- r-prettyunits=1.1.1=r40h6115d3f_1
- - r-processx=3.4.5=r40hcfec24a_0
+ - r-processx=3.5.0=r40hcfec24a_0
- r-progress=1.2.2=r40h6115d3f_2
- r-promises=1.2.0.1=r40h03ef668_0
- - r-ps=1.5.0=r40hcfec24a_0
- - r-psych=2.0.12=r40hc72bb7e_0
+ - r-ps=1.6.0=r40hcfec24a_0
+ - r-psych=2.1.3=r40hc72bb7e_0
- r-purrr=0.3.4=r40hcdcec82_1
- - r-qap=0.1_1=r40h31ca83e_1006
+ - r-qap=0.1_1=r40h580db52_1006
- r-r6=2.5.0=r40hc72bb7e_0
- r-rappdirs=0.3.3=r40hcfec24a_0
- r-rcmdcheck=1.3.3=r40h6115d3f_3
- r-rcolorbrewer=1.1_2=r40h6115d3f_1003
- r-rcpp=1.0.6=r40h03ef668_0
- - r-rcpparmadillo=0.10.2.1.0=r40h306847c_0
+ - r-rcpparmadillo=0.10.2.2.0=r40h306847c_0
- r-rcppeigen=0.3.3.9.1=r40h306847c_0
- r-rcppnumerical=0.4_0=r40h0357c0b_1
- - r-rcurl=1.98_1.2=r40hcdcec82_1
+ - r-rcurl=1.98_1.3=r40hcfec24a_0
- r-readr=1.4.0=r40h1b71b39_0
+ - r-recommended=4.0=r40_1004
- r-registry=0.5_1=r40h6115d3f_2
- r-rematch2=2.1.2=r40h6115d3f_1
- - r-remotes=2.2.0=r40h6115d3f_0
+ - r-remotes=2.3.0=r40hc72bb7e_0
- r-reshape=0.8.8=r40hcdcec82_2
- r-reshape2=1.4.4=r40h0357c0b_1
- r-rex=1.2.0=r40h6115d3f_1
- r-rjson=0.2.20=r40h0357c0b_1002
- r-rlang=0.4.10=r40hcfec24a_0
- - r-rmarkdown=2.6=r40hc72bb7e_0
+ - r-rmarkdown=2.7=r40hc72bb7e_0
- r-roxygen2=7.1.1=r40h0357c0b_0
+ - r-rpart=4.1_15=r40hcfec24a_2
- r-rprojroot=2.0.2=r40hc72bb7e_0
- - r-rsqlite=2.2.3=r40h03ef668_0
+ - r-rsqlite=2.2.5=r40h03ef668_0
- r-rstudioapi=0.13=r40hc72bb7e_0
- r-rvcheck=0.1.8=r40h6115d3f_1
- r-rversions=2.0.2=r40h6115d3f_0
- r-sass=0.3.1=r40h03ef668_0
- r-scales=1.1.1=r40h6115d3f_0
- r-scatterpie=0.1.5=r40h6115d3f_0
- - r-seriation=1.2_9=r40h31ca83e_1
+ - r-seriation=1.2_9=r40h580db52_1
- r-sessioninfo=1.1.1=r40h6115d3f_1002
- r-shadowtext=0.0.7=r40h6115d3f_1
- r-shape=1.4.5=r40_0
@@ -310,61 +313,58 @@ dependencies:
- r-slam=0.1_48=r40hbfbffee_0
- r-snow=0.4_3=r40h6115d3f_1002
- r-sourcetools=0.1.7=r40he1b5a44_1002
- - r-sparsem=1.78=r40h31ca83e_2
- - r-spp=1.16.0=r40h0357c0b_3
+ - r-sparsem=1.81=r40h859d828_0
+ - r-spatial=7.3_13=r40hcfec24a_0
+ - r-spp=1.16.0=r40h52a8340_4
- r-squarem=2021.1=r40hc72bb7e_0
- - r-stringi=1.5.3=r40hca8494e_0
+ - r-stringi=1.5.3=r40hcabe038_1
- r-stringr=1.4.0=r40h6115d3f_2
- - r-survival=3.2_7=r40hcfec24a_0
+ - r-survival=3.2_10=r40hcfec24a_0
- r-sys=3.4=r40hcdcec82_0
- r-testthat=3.0.2=r40h03ef668_0
- - r-tibble=3.0.6=r40hcfec24a_0
+ - r-tibble=3.1.0=r40hcfec24a_1
- r-tidygraph=1.2.0=r40h0357c0b_0
- - r-tidyr=1.1.2=r40h0357c0b_0
+ - r-tidyr=1.1.3=r40h03ef668_0
- r-tidyselect=1.1.0=r40h6115d3f_0
- - r-tinytex=0.29=r40hc72bb7e_0
+ - r-tinytex=0.31=r40hc72bb7e_0
+ - r-tmvnsim=1.0_2=r40h859d828_3
- r-truncnorm=1.0_8=r40hcdcec82_1002
- r-tsp=1.1_10=r40hcdcec82_1
- - r-tweenr=1.0.1=r40h0357c0b_1002
+ - r-tweenr=1.0.2=r40h03ef668_0
- r-upsetr=1.4.0=r40h6115d3f_2
- r-usethis=2.0.1=r40hc72bb7e_0
- - r-utf8=1.1.4=r40hcdcec82_1003
- - r-vctrs=0.3.6=r40hcfec24a_0
+ - r-utf8=1.2.1=r40hcfec24a_0
+ - r-vctrs=0.3.7=r40hcfec24a_0
- r-viridis=0.5.1=r40h6115d3f_1004
- r-viridislite=0.3.0=r40h6115d3f_1003
- - r-waldo=0.2.4=r40hc72bb7e_0
+ - r-waldo=0.2.5=r40hc72bb7e_0
- r-webshot=0.5.2=r40h6115d3f_1
- r-whisker=0.4=r40h6115d3f_1
- r-withr=2.4.1=r40hc72bb7e_0
- r-xfun=0.20=r40hcfec24a_0
- - r-xml=3.99_0.5=r40hcfec24a_0
+ - r-xml=3.99_0.6=r40hcfec24a_0
- r-xml2=1.3.2=r40h0357c0b_1
- r-xopen=1.0.0=r40h6115d3f_1003
- r-xtable=1.8_4=r40h6115d3f_3
- r-yaml=2.2.1=r40hcfec24a_1
- r-zeallot=0.1.0=r40h6115d3f_1002
- r-zip=2.1.1=r40hcdcec82_0
- - readline=8.0=he28a2e2_2
+ - readline=8.1=h27cfd23_0
- sed=4.8=he412f7d_0
- - setuptools=49.6.0=py39hf3d152e_3
- - sqlite=3.34.0=h74cdb3f_0
- sysroot_linux-64=2.12=h77966d4_13
- - tk=8.6.10=h21135ba_1
+ - tk=8.6.10=hed695b0_1
- tktable=2.10=hb7b940f_3
- - tzdata=2021a=he74cb21_0
- - wheel=0.36.2=pyhd3deb0d_0
- - xorg-kbproto=1.0.7=h7f98852_1002
+ - xorg-kbproto=1.0.7=h14c3975_1002
- xorg-libice=1.0.10=h516909a_0
- - xorg-libsm=1.2.3=h84519dc_1000
- - xorg-libx11=1.6.12=h516909a_0
- - xorg-libxau=1.0.9=h7f98852_0
- - xorg-libxdmcp=1.1.3=h7f98852_0
- - xorg-libxext=1.3.4=h516909a_0
- - xorg-libxrender=0.9.10=h516909a_1002
- - xorg-libxt=1.2.1=h7f98852_0
+ - xorg-libsm=1.2.3=hd9c2040_1000
+ - xorg-libx11=1.7.0=h36c2ea0_0
+ - xorg-libxext=1.3.4=h7f98852_1
+ - xorg-libxrender=0.9.10=h7f98852_1003
+ - xorg-libxt=1.2.1=h7f98852_2
- xorg-renderproto=0.11.1=h14c3975_1002
- - xorg-xextproto=7.3.0=h7f98852_1002
- - xorg-xproto=7.0.31=h7f98852_1007
+ - xorg-xextproto=7.3.0=h14c3975_1002
+ - xorg-xproto=7.0.31=h14c3975_1007
- xz=5.2.5=h516909a_1
- zlib=1.2.11=h516909a_1010
- - zstd=1.4.8=ha95c52a_1
+ - zstd=1.4.9=ha95c52a_0
+prefix: /home/dalerr/lcdb-wf/mamba-env-r-unpinned
From 9dbb27f6a45b947b3394e689bb1ccac70aebea13 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 14:28:58 -0400
Subject: [PATCH 20/23] update cache key to reflect env yamls
---
.circleci/config.yml | 4 ++--
1 file changed, 2 insertions(+), 2 deletions(-)
diff --git a/.circleci/config.yml b/.circleci/config.yml
index 897630f8..c2dc7b1d 100644
--- a/.circleci/config.yml
+++ b/.circleci/config.yml
@@ -26,7 +26,7 @@ variables:
save_cache: &save_cache
save_cache:
- key: v0-{{ checksum "env.yml" }}-{{ checksum "env-r.yml" }}
+ key: v0-{{ checksum "env-pinned.yml" }}-{{ checksum "env-r-pinned.yml" }}-{{ checksum "env-r.yml" }}- {{ checksum "env.yml" }}
paths:
- /opt/conda
@@ -38,7 +38,7 @@ variables:
restore_cache: &restore_cache
restore_cache:
keys:
- - v0-{{ checksum "env.yml" }}-{{ checksum "env-r.yml" }}
+ - v0-{{ checksum "env-pinned.yml" }}-{{ checksum "env-r-pinned.yml" }}-{{ checksum "env-r.yml" }}- {{ checksum "env.yml" }}
# --------------------------------------------------------------------------
# The path needs to be set each time; in jobs below this will be called as
From 7f590a2ff1d4d886bbae5991d5f49b6df27dc8d0 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 15:43:25 -0400
Subject: [PATCH 21/23] add additional test configs
---
test/test_configs/test_file_uri.yaml | 45 +++++++++++++++++++++++
test/test_configs/test_rnaseq_config.yaml | 42 +++++++++++++++++++++
test/test_configs/test_sra_config.yaml | 32 ++++++++++++++++
3 files changed, 119 insertions(+)
create mode 100644 test/test_configs/test_file_uri.yaml
create mode 100644 test/test_configs/test_rnaseq_config.yaml
create mode 100644 test/test_configs/test_sra_config.yaml
diff --git a/test/test_configs/test_file_uri.yaml b/test/test_configs/test_file_uri.yaml
new file mode 100644
index 00000000..d619e5cb
--- /dev/null
+++ b/test/test_configs/test_file_uri.yaml
@@ -0,0 +1,45 @@
+sampletable: 'config/sampletable.tsv'
+
+patterns: 'config/rnaseq_patterns.yaml'
+
+# Which key in the `references` dict below to use
+organism: 'filebased'
+
+# If not specified here, use the environment variable REFERENCES_DIR.
+references_dir: 'references_data'
+
+aligner:
+ index: 'hisat2'
+ tag: 'test'
+
+rrna:
+ index: 'bowtie2'
+ tag: 'test'
+
+gtf:
+ tag: "test"
+
+salmon:
+ tag: "test"
+
+fastq_screen:
+ - label: test
+ organism: filebased
+ tag: test
+
+references:
+ filebased:
+ test:
+ genome:
+ url: "file://test.fa.gz"
+ indexes:
+ - "bowtie2"
+ - "hisat2"
+ annotation:
+ url: "file://test.gtf.gz"
+ conversions:
+ - "bed12"
+ - "refflat"
+ transcriptome:
+ indexes:
+ - "salmon"
diff --git a/test/test_configs/test_rnaseq_config.yaml b/test/test_configs/test_rnaseq_config.yaml
new file mode 100644
index 00000000..b8d79b92
--- /dev/null
+++ b/test/test_configs/test_rnaseq_config.yaml
@@ -0,0 +1,42 @@
+sampletable: 'config/sampletable.tsv'
+
+patterns: 'config/rnaseq_patterns.yaml'
+
+# Which key in the `references` dict below to use
+organism: 'dmel'
+
+# If not specified here, use the environment variable REFERENCES_DIR.
+references_dir: 'references_data'
+
+aligner:
+ index: 'hisat2'
+ tag: 'test'
+
+rrna:
+ index: 'bowtie2'
+ tag: 'rRNA'
+
+gtf:
+ tag: "test"
+
+salmon:
+ tag: "test"
+
+fastq_screen:
+ - label: rRNA
+ organism: dmel
+ tag: test
+ - label: PhiX
+ organism: phix
+ tag: default
+ - label: Fly
+ organism: dmel
+ tag: test
+
+# See the reference config files in the top level of the repo,
+# include/reference_configs, for inspiration for more species.
+
+include_references:
+ - '../../include/reference_configs/test.yaml'
+ - '../../include/reference_configs/PhiX.yaml'
+ - '../../include/reference_configs/Drosophila_melanogaster.yaml'
diff --git a/test/test_configs/test_sra_config.yaml b/test/test_configs/test_sra_config.yaml
new file mode 100644
index 00000000..f1127658
--- /dev/null
+++ b/test/test_configs/test_sra_config.yaml
@@ -0,0 +1,32 @@
+patterns: 'config/rnaseq_patterns.yaml'
+
+# Which key in the `references` dict below to use
+organism: 'human'
+
+# If not specified here, use the environment variable REFERENCES_DIR.
+references_dir: 'references_data'
+
+aligner:
+ index: 'star'
+ tag: 'gencode-v28'
+
+rrna:
+ index: 'bowtie2'
+ tag: 'rRNA'
+
+gtf:
+ tag: "gencode-v28"
+
+salmon:
+ tag: "gencode-v28"
+
+fastq_screen:
+ - label: rRNA
+ organism: human
+ tag: rRNA
+ - label: human
+ organism: human
+ tag: gencode-v28
+
+include_references:
+ - '../../include/reference_configs/Drosophila_melanogaster.yaml'
From 30b22d798cfeb866a2c374bcc61f2db3fdebe9c6 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 17:55:33 -0400
Subject: [PATCH 22/23] when testing urls, skip file://
---
lib/common.py | 3 +++
1 file changed, 3 insertions(+)
diff --git a/lib/common.py b/lib/common.py
index a0e05d76..76d8efa8 100644
--- a/lib/common.py
+++ b/lib/common.py
@@ -857,6 +857,9 @@ def check_urls(config, verbose=False):
failures = []
urls = list(set(utils.flatten(pluck(config, 'url'))))
for url in urls:
+ if url.startswith('file://'):
+ continue
+
res = check_url(url, verbose=verbose)
# we expect exit code 23 because we're triggering SIGPIPE with the
From 3f967628bc541f85cd0cd62743e59b05239b1dd9 Mon Sep 17 00:00:00 2001
From: daler <dalerr@niddk.nih.gov>
Date: Sun, 4 Apr 2021 18:08:31 -0400
Subject: [PATCH 23/23] fix name of test rnaseq config
---
.circleci/config.yml | 6 +++---
1 file changed, 3 insertions(+), 3 deletions(-)
diff --git a/.circleci/config.yml b/.circleci/config.yml
index c2dc7b1d..eccbc364 100644
--- a/.circleci/config.yml
+++ b/.circleci/config.yml
@@ -216,19 +216,19 @@ variables:
# only go to the cutadapt step.
rm -r data
./run_test.sh -j 1 --use-conda -k -p -r --until cutadapt \
- --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq_config.yaml \
--config sampletable=$ORIG/test/test_configs/test_sra_sampletable.tsv
# Same as above, but SE
rm -r data
./run_test.sh -j 1 --use-conda -k -p -r --until cutadapt \
- --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq_config.yaml \
--config sampletable=$ORIG/test/test_configs/test_sra_sampletable_SE_only.tsv
# test strandedness, PE
rm -r data && cp -r /tmp/data data
./run_test.sh -j 2 --use-conda -k -p -r --until strand_check \
- --configfile $ORIG/test/test_configs/test_rnaseq.yaml \
+ --configfile $ORIG/test/test_configs/test_rnaseq_config.yaml \
--config sampletable=$ORIG/test/test_configs/test_pe_sampletable.tsv \
&& cat strandedness.tsv