From c5e073965a428ce3ac74f9e445d539df6ff01918 Mon Sep 17 00:00:00 2001
From: njohnso6 <njohnso6@uccs.edu>
Date: Tue, 16 Jul 2019 11:19:33 -0400
Subject: [PATCH] Update the Illumina sequence according to cutadapt docs

In the documentation here: https://cutadapt.readthedocs.io/en/stable/guide.html#basic-usage
it says Illumina now prefers more specific sequences when cutting the adapters as the previous ones were less specific and present elsewhere in the genome. This is apparently true at least for True-Seq
---
 data/seq/adapters.fa | 6 ++++--
 1 file changed, 4 insertions(+), 2 deletions(-)

diff --git a/data/seq/adapters.fa b/data/seq/adapters.fa
index 17c8f6a..b3e741c 100644
--- a/data/seq/adapters.fa
+++ b/data/seq/adapters.fa
@@ -2,5 +2,7 @@
 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 >polyT
 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
->illumina
-AGATCGGAAGAGC
+>illumina-read-1
+AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+>illumina-read-2
+AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT