diff --git a/.env.example b/.env.example new file mode 100644 index 0000000..e68ccfa --- /dev/null +++ b/.env.example @@ -0,0 +1,3 @@ +PYTHON_ENV=development +FLASK_DEBUG=True +FLASK_APP=primerx.app diff --git a/.flake8 b/.flake8 deleted file mode 100644 index aa8e2bd..0000000 --- a/.flake8 +++ /dev/null @@ -1,4 +0,0 @@ -[flake8] -ignore = E203, E266, E501, W503 -max-line-length = 88 -max-complexity = 18 diff --git a/.github/workflows/build-and-push.yml b/.github/workflows/build-and-push.yml new file mode 100644 index 0000000..cdb6cdc --- /dev/null +++ b/.github/workflows/build-and-push.yml @@ -0,0 +1,52 @@ +name: Build and push Docker image + +on: + push: + branches: [ main ] + +concurrency: + group: build + cancel-in-progress: true + +jobs: + build-and-push: + name: Build and push + runs-on: ubuntu-latest + permissions: write-all + steps: + - name: Checkout code repo + uses: actions/checkout@v4 + + - name: Docker login + uses: docker/login-action@v3 + with: + registry: ghcr.io + username: ${{ github.actor }} + password: ${{ secrets.GITHUB_TOKEN }} + + - name: Setup Docker buildx + uses: docker/setup-buildx-action@v3 + + - name: Extract image metadata + id: meta + uses: docker/metadata-action@v5 + with: + images: ghcr.io/${{ github.repository }} + + - name: Build and push + id: build + uses: docker/build-push-action@v6 + with: + push: true + tags: | + ghcr.io/${{ github.repository }}:${{ github.sha }} + ghcr.io/${{ github.repository }}:latest + labels: ${{ steps.meta.outputs.labels }} + file: web.Dockerfile + + - name: Generate artifact attestation + uses: actions/attest-build-provenance@v1 + with: + subject-name: ghcr.io/${{ github.repository }}-web + subject-digest: ${{ steps.build.outputs.digest }} + push-to-registry: true diff --git a/.github/workflows/make-docs.yml b/.github/workflows/make-docs.yml deleted file mode 100644 index 7db9a62..0000000 --- a/.github/workflows/make-docs.yml +++ /dev/null @@ -1,26 +0,0 @@ -name: Make docs - -on: - pull_request: - types: - - ready_for_review - - synchronize - workflow_dispatch: - -jobs: - make-docs: - runs-on: ubuntu-latest - steps: - - uses: actions/checkout@v3 - - uses: actions/setup-python@v4 - - name: Install dependencies - run: | - python -m pip install "poetry==1.3.2" - poetry install - - - name: Make docs - run: poetry run sphinx-build -b html docsrc/source docs - - - uses: stefanzweifel/git-auto-commit-action@v4 - with: - commit_message: Update docs diff --git a/.github/workflows/publish-docs.yml b/.github/workflows/publish-docs.yml index f23eb6f..a4d1022 100644 --- a/.github/workflows/publish-docs.yml +++ b/.github/workflows/publish-docs.yml @@ -1,41 +1,34 @@ -# Simple workflow for deploying static content to GitHub Pages -name: Deploy static content to Pages +name: Publish docs to GitHub Pages on: - # Runs on pushes targeting the default branch push: - branches: ["main"] - - # Allows you to run this workflow manually from the Actions tab + branches: [ main ] workflow_dispatch: -# Sets permissions of the GITHUB_TOKEN to allow deployment to GitHub Pages permissions: - contents: read - pages: write - id-token: write + contents: write -# Allow one concurrent deployment concurrency: - group: "pages" + group: pages cancel-in-progress: true jobs: - # Single deploy job since we're just deploying deploy: environment: name: github-pages - url: ${{ steps.deployment.outputs.page_url }} + url: https://${{ github.repository_owner }}.github.io/primerdriver runs-on: ubuntu-latest steps: - - name: Checkout - uses: actions/checkout@v3 - - name: Setup Pages - uses: actions/configure-pages@v3 - - name: Upload artifact - uses: actions/upload-pages-artifact@v1 + - uses: actions/checkout@v4 + + - uses: actions/setup-python@v5 with: - path: './docs' - - name: Deploy to GitHub Pages - id: deployment - uses: actions/deploy-pages@v1 + python-version: '3.10' + + - name: Install dependencies + run: | + python -m pip install "poetry==1.8.3" + poetry install --no-root --with dev + + - name: Publish docs + run: poetry run mkdocs gh-deploy --force diff --git a/.github/workflows/publish-pypi.yml b/.github/workflows/publish-pypi.yml index fcfd8e8..0178edc 100644 --- a/.github/workflows/publish-pypi.yml +++ b/.github/workflows/publish-pypi.yml @@ -1,44 +1,37 @@ -# This workflow will upload a Python Package using Twine when a release is created -# For more information see: https://help.github.com/en/actions/language-and-framework-guides/using-python-with-github-actions#publishing-to-package-registries - -# This workflow uses actions that are not certified by GitHub. -# They are provided by a third-party and are governed by -# separate terms of service, privacy policy, and support -# documentation. - -name: Upload Python Package +name: Upload to PyPI on: release: - types: - - published + types: [ published ] permissions: contents: read + id-token: write jobs: deploy: - runs-on: ubuntu-latest - + environment: + name: pypi + url: https://pypi.org/p/primerdriver steps: - - uses: actions/checkout@v3 - - name: Set up Python - uses: actions/setup-python@v4 - with: - python-version: '3.x' - - - name: Install dependencies - run: | - python -m pip install --upgrade pip - pip install "poetry==1.3.2" - poetry export --without-hashes --without dev -f requirements.txt | pip install -r /dev/stdin - pip install build - - - name: Build package - run: python -m build - - - name: Publish package - uses: pypa/gh-action-pypi-publish@release/v1 - with: - password: ${{ secrets.PYPI_API_TOKEN }} + - uses: actions/checkout@v3 + + - name: Set up Python + uses: actions/setup-python@v6 + with: + python-version: '3.10' + + - name: Install dependencies + run: | + pip install "poetry==1.8.3" + poetry export --without dev --format requirements.txt | pip install --no-cache-dir -r /dev/stdin + pip install build + + - name: Build package + run: python -m build + + - name: Publish package + uses: pypa/gh-action-pypi-publish@release/v1 + with: + password: ${{ secrets.PYPI_API_TOKEN }} diff --git a/.github/workflows/run-tests.yml b/.github/workflows/run-tests.yml index 8387a8e..07ef427 100644 --- a/.github/workflows/run-tests.yml +++ b/.github/workflows/run-tests.yml @@ -1,7 +1,6 @@ name: Run tests -on: - pull_request: +on: pull_request jobs: unit-tests: @@ -9,22 +8,27 @@ jobs: strategy: fail-fast: false matrix: - python-version: ['3.8', '3.9', '3.10'] + python-version: [ '3.9', '3.10' ] steps: - - uses: actions/checkout@v3 - - uses: actions/setup-python@v4 + - uses: actions/checkout@v4 + + - uses: actions/setup-python@v5 name: Setup Python ${{ matrix.python-version }} with: python-version: ${{ matrix.python-version }} + - name: Install dependencies run: | - python -m pip install "poetry==1.3.2" - poetry install + python -m pip install "poetry==1.8.3" + poetry install --no-root --with dev + - name: Run tests run: poetry run coverage run -m pytest + - name: Update code coverage badge run: poetry run coverage-badge -o coverage.svg -f if: ${{ matrix.python-version == 3.10 }} + - uses: stefanzweifel/git-auto-commit-action@v4 if: ${{ matrix.python-version == 3.10 }} with: diff --git a/.gitignore b/.gitignore index 80d539e..d3204f2 100644 --- a/.gitignore +++ b/.gitignore @@ -1,3 +1,147 @@ +# Created by https://www.toptal.com/developers/gitignore/api/python,node +# Edit at https://www.toptal.com/developers/gitignore?templates=python,node + +### Node ### +# Logs +logs +*.log +npm-debug.log* +yarn-debug.log* +yarn-error.log* +lerna-debug.log* +.pnpm-debug.log* + +# Diagnostic reports (https://nodejs.org/api/report.html) +report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json + +# Runtime data +pids +*.pid +*.seed +*.pid.lock + +# Directory for instrumented libs generated by jscoverage/JSCover +lib-cov + +# Coverage directory used by tools like istanbul +coverage +*.lcov + +# nyc test coverage +.nyc_output + +# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files) +.grunt + +# Bower dependency directory (https://bower.io/) +bower_components + +# node-waf configuration +.lock-wscript + +# Compiled binary addons (https://nodejs.org/api/addons.html) +build/Release + +# Dependency directories +node_modules/ +jspm_packages/ + +# Snowpack dependency directory (https://snowpack.dev/) +web_modules/ + +# TypeScript cache +*.tsbuildinfo + +# Optional npm cache directory +.npm + +# Optional eslint cache +.eslintcache + +# Optional stylelint cache +.stylelintcache + +# Microbundle cache +.rpt2_cache/ +.rts2_cache_cjs/ +.rts2_cache_es/ +.rts2_cache_umd/ + +# Optional REPL history +.node_repl_history + +# Output of 'npm pack' +*.tgz + +# Yarn Integrity file +.yarn-integrity + +# dotenv environment variable files +.env +.env.development.local +.env.test.local +.env.production.local +.env.local + +# parcel-bundler cache (https://parceljs.org/) +.cache +.parcel-cache + +# Next.js build output +.next +out + +# Nuxt.js build / generate output +.nuxt +dist + +# Gatsby files +.cache/ +# Comment in the public line in if your project uses Gatsby and not Next.js +# https://nextjs.org/blog/next-9-1#public-directory-support +# public + +# vuepress build output +.vuepress/dist + +# vuepress v2.x temp and cache directory +.temp + +# Docusaurus cache and generated files +.docusaurus + +# Serverless directories +.serverless/ + +# FuseBox cache +.fusebox/ + +# DynamoDB Local files +.dynamodb/ + +# TernJS port file +.tern-port + +# Stores VSCode versions used for testing VSCode extensions +.vscode-test + +# yarn v2 +.yarn/cache +.yarn/unplugged +.yarn/build-state.yml +.yarn/install-state.gz +.pnp.* + +### Node Patch ### +# Serverless Webpack directories +.webpack/ + +# Optional stylelint cache + +# SvelteKit build / generate output +.svelte-kit + +### Python ### # Byte-compiled / optimized / DLL files __pycache__/ *.py[cod] @@ -17,11 +161,9 @@ eggs/ lib/ lib64/ parts/ -staticfiles/ sdist/ var/ wheels/ -pip-wheel-metadata/ share/python-wheels/ *.egg-info/ .installed.cfg @@ -44,20 +186,19 @@ htmlcov/ .nox/ .coverage .coverage.* -.cache nosetests.xml coverage.xml *.cover *.py,cover .hypothesis/ .pytest_cache/ +cover/ # Translations *.mo *.pot # Django stuff: -*.log local_settings.py db.sqlite3 db.sqlite3-journal @@ -70,9 +211,10 @@ instance/ .scrapy # Sphinx documentation -# docs/_build/ +docs/_build/ # PyBuilder +.pybuilder/ target/ # Jupyter Notebook @@ -83,7 +225,9 @@ profile_default/ ipython_config.py # pyenv -.python-version +# For a library or package, you might want to ignore these files since the code is +# intended to run in multiple environments; otherwise, check them in: +# .python-version # pipenv # According to pypa/pipenv#598, it is recommended to include Pipfile.lock in version control. @@ -92,7 +236,22 @@ ipython_config.py # install all needed dependencies. #Pipfile.lock -# PEP 582; used by e.g. github.com/David-OConnor/pyflow +# poetry +# Similar to Pipfile.lock, it is generally recommended to include poetry.lock in version control. +# This is especially recommended for binary packages to ensure reproducibility, and is more +# commonly ignored for libraries. +# https://python-poetry.org/docs/basic-usage/#commit-your-poetrylock-file-to-version-control +#poetry.lock + +# pdm +# Similar to Pipfile.lock, it is generally recommended to include pdm.lock in version control. +#pdm.lock +# pdm stores project-wide configurations in .pdm.toml, but it is recommended to not include it +# in version control. +# https://pdm.fming.dev/#use-with-ide +.pdm.toml + +# PEP 582; used by e.g. github.com/David-OConnor/pyflow and github.com/pdm-project/pdm __pypackages__/ # Celery stuff @@ -103,7 +262,6 @@ celerybeat.pid *.sage.py # Environments -.env .venv env/ venv/ @@ -129,116 +287,27 @@ dmypy.json # Pyre type checker .pyre/ -# Logs -logs -*.log -npm-debug.log* -yarn-debug.log* -yarn-error.log* -lerna-debug.log* - -# Diagnostic reports (https://nodejs.org/api/report.html) -report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json - -# Runtime data -pids -*.pid -*.seed -*.pid.lock - -# Directory for instrumented libs generated by jscoverage/JSCover -lib-cov - -# Coverage directory used by tools like istanbul -coverage -*.lcov - -# nyc test coverage -.nyc_output - -# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files) -.grunt - -# Bower dependency directory (https://bower.io/) -bower_components - -# node-waf configuration -.lock-wscript +# pytype static type analyzer +.pytype/ -# Compiled binary addons (https://nodejs.org/api/addons.html) -build/Release +# Cython debug symbols +cython_debug/ -# Dependency directories -node_modules/ -jspm_packages/ - -# TypeScript v1 declaration files -typings/ - -# TypeScript cache -*.tsbuildinfo - -# Optional npm cache directory -.npm - -# Optional eslint cache -.eslintcache - -# Microbundle cache -.rpt2_cache/ -.rts2_cache_cjs/ -.rts2_cache_es/ -.rts2_cache_umd/ - -# Optional REPL history -.node_repl_history - -# Output of 'npm pack' -*.tgz - -# Yarn Integrity file -.yarn-integrity - -# parcel-bundler cache (https://parceljs.org/) -.cache - -# Next.js build output -.next - -# Nuxt.js build / generate output -.nuxt -dist - -# Gatsby files -.cache/ -# Comment in the public line in if your project uses Gatsby and *not* Next.js -# https://nextjs.org/blog/next-9-1#public-directory-support -# public - -# vuepress build output -.vuepress/dist - -# Serverless directories -.serverless/ - -# FuseBox cache -.fusebox/ - -# DynamoDB Local files -.dynamodb/ - -# TernJS port file -.tern-port +# PyCharm +# JetBrains specific template is maintained in a separate JetBrains.gitignore that can +# be found at https://github.com/github/gitignore/blob/main/Global/JetBrains.gitignore +# and can be added to the global gitignore or merged into this file. For a more nuclear +# option (not recommended) you can uncomment the following to ignore the entire idea folder. +#.idea/ -# Mac -.DS_Store +### Python Patch ### +# Poetry local configuration file - https://python-poetry.org/docs/configuration/#local-configuration +poetry.toml -# VScode -.vscode +# ruff +.ruff_cache/ -# IDEA -.idea +# LSP config files +pyrightconfig.json -# Local bundles -bundles/ -webpack-stats.json +# End of https://www.toptal.com/developers/gitignore/api/python,node diff --git a/.gitleaks.toml b/.gitleaks.toml new file mode 100644 index 0000000..9a12d54 --- /dev/null +++ b/.gitleaks.toml @@ -0,0 +1,7 @@ +title = 'Gitleaks config' + +[extend] +useDefault = true + +[allowlist] +paths = ['sample.fasta'] diff --git a/.mise.toml b/.mise.toml new file mode 100644 index 0000000..567ba28 --- /dev/null +++ b/.mise.toml @@ -0,0 +1,5 @@ +[tools] +bun = "latest" +poetry = "latest" +python = "3.10" +task = "latest" diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 60e27da..5e145c6 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -1,30 +1,45 @@ repos: - - repo: https://github.com/psf/black - rev: 23.1.0 + - repo: https://github.com/astral-sh/ruff-pre-commit + rev: v0.6.9 hooks: - - id: black - language_version: python3 - - repo: https://github.com/PyCQA/isort - rev: 5.12.0 + - id: ruff + args: [ --fix ] + - id: ruff-format + - repo: https://github.com/biomejs/pre-commit + rev: v0.5.0 hooks: - - id: isort - args: ['--profile', 'black'] - - repo: https://github.com/PyCQA/flake8 - rev: 6.0.0 - hooks: - - id: flake8 + - id: biome-check + additional_dependencies: + - "@biomejs/biome@1.9.4" + args: [ '--config-path', './ui' ] - repo: https://github.com/pre-commit/pre-commit-hooks - rev: v4.1.0 + rev: v5.0.0 hooks: - id: check-added-large-files - args: ['--maxkb=500'] + args: [ '--maxkb=500' ] + exclude: '^sample\.fasta$' + - id: trailing-whitespace - id: end-of-file-fixer - id: mixed-line-ending - args: ['--fix=lf'] + args: [ '--fix=lf' ] - id: check-merge-conflict - id: check-yaml + args: [ '--allow-multiple-documents' ] + exclude: templates/.+\.ya?ml$ + - id: check-json + - id: check-toml + - id: check-xml - repo: https://github.com/zricethezav/gitleaks - rev: v7.5.0 + rev: v8.21.1 hooks: - id: gitleaks - args: ['--verbose'] + args: [ '--verbose', '--config', '.gitleaks.toml' ] + - repo: https://github.com/hadolint/hadolint + rev: v2.12.0 + hooks: + - id: hadolint-docker + args: + - --ignore + - DL3008 + - --ignore + - DL3018 diff --git a/README.md b/README.md index 7f5d220..a80c490 100644 --- a/README.md +++ b/README.md @@ -10,9 +10,9 @@ _PrimerDriver_ is a user-friendly bioinformatics platform specifically designed to generate primers for site-directed mutagenesis experiments into workflows with an easy-to-use command-line interface. “Traversing” PrimerDriver lanes, -users can generate possible mutagenic primers upon input of a DNA sequence (`DNA`), design primers for an array of species -codon expression systems through direct mutation of the amino acid (`PRO`), characterize and report user-designed -primers (`CHAR`). +users can generate possible mutagenic primers upon input of a DNA sequence (`DNA`), design primers for an array of +species codon expression systems through direct mutation of the amino acid (`PRO`), characterize and report +user-designed primers (`CHAR`). ## Usage @@ -43,20 +43,20 @@ Batch design can be performed by including #### Prerequisites -- [Python 3.8.1+](https://www.python.org/downloads/) -- [Poetry](https://python-poetry.org/docs/#installation) - [Git](https://git-scm.com/downloads) +- [Mise](https://mise.jdx.dev) #### Setup -1. Clone the repo to your local device +1. Clone the repo to your local device and `cd` into it ```shell git clone https://github.com/kvdomingo/primerdriver.git + cd primerdriver ``` 2. Install dependencies: ```shell - poetry install + mise install ``` Run the program as follows: @@ -70,17 +70,17 @@ poetry run python -m primerdriver -h Run as follows: ```shell -docker run -it --entrypoint python kvdomingo/primerdriver -m primerdriver -h +docker run -it --entrypoint python kvdomingo/primerdriver -m primerdriver -h ``` ## Web application For a more interactive experience, visit the -[web application](https://primerdriver.kvdstudio.app). +[web application](https://primerdriver.kvd.studio). ## Documentation -The documentation is available at https://kvdomingo.github.io/primerdriver/. +The documentation is available at https://primerdriver-docs.kvd.studio. ## Contributing @@ -93,7 +93,7 @@ You may also email Nomer or Kenneth, depending on the nature of the issue. ### Prerequisites - [Docker](https://www.docker.com/get-started) -- [Task](https://taskfile.dev/#/installation) +- [Mise](https://mise.jdx.dev) ### Installing @@ -101,14 +101,26 @@ A step by step series of examples that tell you how to get a development environment running 1. Clone the repo. -2. Install backend dependencies: - -```shell -poetry install -``` +2. Install prerequisites: + ```shell + mise install + pip install -U pre-commit + pre-commit install + ``` +3. Install backend dependencies: + ```shell + poetry install --no-root --with dev + ``` +4. Run the development servers: + ```shell + task + ``` Wait a few minutes for all the containers to start, then access the -local server in your browser at http://localhost:8000. +local servers in your browser at: + +- Web app: http://localhost:3000 +- Docs: http://localhost:8000 ### Building from source @@ -128,15 +140,16 @@ git commit -m "DESCRIPTIVE_COMMIT_MESSAGE" git push origin your_feature_branch ``` -where `your_feature_branch` should summarize the changes you are implementing -(e.g., `feature/implementing-xxxx-feature`, `bugfix/crush-critical-yyyy-bug`). +where `your_feature_branch` should summarize the changes you are implementing following +the [Conventional Commits](https://www.conventionalcommits.org/en/v1.0.0/) format +(e.g., `feat/xxxx`, `fix/yyyy`). ## Authors - **Numeriano Amer "Nomer" E. Gutierrez** - Project Lead, Molecular Biologist - [Email](mailto:ngutierrez@evc.pshs.edu.ph) | [GitHub](https://github.com/nomgutierrez) -- **Kenneth V. Domingo** - Lead Developer, Technical - Consultant - [Email](mailto:kvdomingo@alum.up.edu.ph) | [Website](https://kvdomingo.xyz) | [GitHub](https://github.com/kvdomingo) +- **Kenneth V. Domingo** - Technical + Lead - [Email](mailto:kvdomingo@alum.up.edu.ph) | [Website](https://kvd.studio) | [GitHub](https://github.com/kvdomingo) - **Shebna Rose D. Fabilloren** - Technical Consultant - [Email](mailto:sdfabilloren@up.edu.ph) - **Carlo M. Lapid** - Project Adviser - [Email](mailto:cmlapid@up.edu.ph) diff --git a/Taskfile.yml b/Taskfile.yml index c87526a..1f204e7 100644 --- a/Taskfile.yml +++ b/Taskfile.yml @@ -3,25 +3,67 @@ version: '3' env: NAME: primerdriver SHORT_SHA: - sh: git show --format="%h" --no-patch + sh: git rev-parse --short HEAD tasks: - setup: - cmds: - - pip install pre-commit - - pre-commit install - - poetry install + default: + cmd: + task: up - test: - cmds: - - poetry run coverage run -m pytest + up: + desc: Build and start containers + cmd: docker compose --project-name {{.NAME}} up --detach --build --remove-orphans {{.CLI_ARGS}} + + stop: + desc: Stop containers + cmd: docker compose --project-name {{.NAME}} stop {{.CLI_ARGS}} + + logs: + desc: Follow Docker logs + interactive: true + cmd: docker compose --project-name {{.NAME}} logs --follow {{.CLI_ARGS}} + + restart: + desc: Restart containers + cmd: docker compose --project-name {{.NAME}} restart {{.CLI_ARGS}} - build: + down: + desc: Stop and remove containers + cmd: docker compose --project-name {{.NAME}} down --remove-orphans + + clean: + desc: Nuke everything + cmd: docker compose --project-name {{.NAME}} down --volumes --remove-orphans + + build-web: + desc: Build web app image + cmd: > + docker build + -t kvdomingo/primerdriver:{{.SHORT_SHA}} + -t kvdomingo/primerdriver:latest + --build-arg SHORT_SHA={{.SHORT_SHA}} + -f web.Dockerfile . + + build-cli: + desc: Build CLI cmds: - - poetry run pyinstaller --clean -F --name primerdriver setup.py - - docker run -v "$(pwd)":/build --rm --env NAME={{.NAME}} --name primerdriver --workdir /build kvdomingo/py-cli-builder:latest + - > + docker build + -t kvdomingo/primerdriver-cli:{{.SHORT_SHA}} + -t kvdomingo/primerdriver-cli:latest + -f cli.Dockerfile . + - > + docker run + -t --rm + -u $(id -u):$(id -g) + -v "$(pwd)":/build + --workdir /build + kvdomingo/primerdriver-cli:latest build-docs: - cmds: - - rm -rf docsrc/source/generated - - poetry run sphinx-build -b html docsrc/source docs + desc: Build docs + cmd: > + docker build + -t kvdomingo/primerdriver-docs:{{.SHORT_SHA}} + -t kvdomingo/primerdriver-docs:latest + -f docs.Dockerfile . diff --git a/cli.Dockerfile b/cli.Dockerfile new file mode 100644 index 0000000..922b115 --- /dev/null +++ b/cli.Dockerfile @@ -0,0 +1,25 @@ +FROM python:3.10-bullseye + +ENV DEBIAN_FRONTEND=noninteractive +ENV PYTHONUNBUFFERED=1 +ENV PYTHONDONTWRITEBYTECODE=1 +ENV POETRY_VERSION=1.8.3 +ENV POETRY_HOME=/opt/poetry +ENV PATH=${PATH}:${POETRY_HOME}/bin + +WORKDIR /tmp + +COPY pyproject.toml poetry.lock ./ + +RUN apt-get update && \ + apt-get install --no-install-recommends -y upx-ucl && \ + pip install --no-cache-dir "poetry==$POETRY_VERSION" && \ + poetry export --without-hashes --with dev --format requirements.txt --output requirements.txt && \ + python -m venv .venv && \ + /tmp/.venv/bin/pip install --no-cache-dir -r requirements.txt && \ + rm -rf /var/lib/apt/lists/* + +WORKDIR /build + +ENTRYPOINT [ "/bin/bash", "-euxo", "pipefail", "-c" ] +CMD [ "/tmp/.venv/bin/pyinstaller -F --clean --name primerdriver setup.py" ] diff --git a/dev.Dockerfile b/dev.Dockerfile new file mode 100644 index 0000000..7ce23a6 --- /dev/null +++ b/dev.Dockerfile @@ -0,0 +1,16 @@ +FROM python:3.10-bullseye + +ENV DEBIAN_FRONTEND noninteractive +ENV PYTHONUNBUFFERED 1 +ENV PYTHONDONTWRITEBYTECODE 1 +ENV POETRY_VERSION 1.8.3 + +WORKDIR /primerdriver + +SHELL [ "/bin/bash", "-euxo", "pipefail", "-c" ] + +RUN pip install --no-cache-dir poetry==$POETRY_VERSION && \ + poetry config virtualenvs.create true && \ + poetry config virtualenvs.in-project true + +ENTRYPOINT [ "/bin/bash", "-euxo", "pipefail", "-c" ] diff --git a/docker-compose.yml b/docker-compose.yml new file mode 100644 index 0000000..9ac4b1e --- /dev/null +++ b/docker-compose.yml @@ -0,0 +1,56 @@ +services: + backend: + build: + context: . + dockerfile: dev.Dockerfile + image: kvdomingo/primerdriver-api:latest + init: true + command: + - | + poetry install --no-root + poetry run flask run -h 0.0.0.0 -p '5000' --reload + restart: unless-stopped + env_file: .env + volumes: + - .:/primerdriver + - venv-data:/primerdriver/.venv + ports: + - '5000:5000' + + docs: + build: + context: . + dockerfile: dev.Dockerfile + image: kvdomingo/primerdriver-api:latest + init: true + restart: unless-stopped + env_file: .env + command: + - | + poetry install --no-root + poetry run mkdocs serve -a 0.0.0.0:8000 + volumes: + - .:/primerdriver + - docs-venv-data:/primerdriver/.venv + ports: + - '8000:8000' + + frontend: + image: oven/bun:1.1-alpine + restart: unless-stopped + init: true + environment: + NODE_ENV: development + entrypoint: + - /bin/sh + - "-c" + - "bun install && exec bun run dev" + working_dir: /web + volumes: + - ./ui:/web + ports: + - '3000:3000' + +volumes: + venv-data: + docs-venv-data: diff --git a/docker-entrypoint.sh b/docker-entrypoint.sh new file mode 100755 index 0000000..3828bc5 --- /dev/null +++ b/docker-entrypoint.sh @@ -0,0 +1,3 @@ +#!/bin/bash + +exec /primerdriver/.venv/bin/gunicorn -b 0.0.0.0:$PORT -c ./gunicorn.conf.py diff --git a/docs.Dockerfile b/docs.Dockerfile new file mode 100644 index 0000000..d52c60b --- /dev/null +++ b/docs.Dockerfile @@ -0,0 +1,37 @@ +FROM python:3.10-slim AS build + +ENV DEBIAN_FRONTEND=noninteractive +ENV PYTHONUNBUFFERED=1 +ENV PYTHONDONTWRITEBYTECODE=1 +ENV POETRY_VERSION=1.8.3 + +SHELL [ "/bin/bash", "-euxo", "pipefail", "-c" ] + +RUN apt-get update && \ + apt-get install --no-install-recommends -y gcc libc-dev && \ + pip install --no-cache-dir "poetry==$POETRY_VERSION" && \ + poetry config virtualenvs.create false && \ + rm -rf /var/lib/apt/lists/* + +WORKDIR /tmp + +COPY pyproject.toml poetry.lock ./ + +RUN poetry export --without-hashes --with dev --format requirements.txt --output requirements.txt + +WORKDIR /build + +RUN python -m venv .venv && \ + ./.venv/bin/pip install --no-cache-dir -r /tmp/requirements.txt + +COPY mkdocs.yml . +COPY ./docs/ ./docs/ +COPY ./primerdriver/ ./primerdriver/ + +RUN ./.venv/bin/mkdocs build + +FROM bitnami/nginx:1.27.2-debian-12-r2 + +WORKDIR /app + +COPY --from=build /build/site/ ./ diff --git a/docs/.buildinfo b/docs/.buildinfo deleted file mode 100644 index e1af709..0000000 --- a/docs/.buildinfo +++ /dev/null @@ -1,4 +0,0 @@ -# Sphinx build info version 1 -# This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done. -config: 3cdfd6296fb51cb45ce3f01e9fcf81ef -tags: 645f666f9bcd5a90fca523b33c5a78b7 diff --git a/docs/.doctrees/api.doctree b/docs/.doctrees/api.doctree deleted file mode 100644 index b3aa80d..0000000 Binary files a/docs/.doctrees/api.doctree and /dev/null differ diff --git a/docs/.doctrees/environment.pickle b/docs/.doctrees/environment.pickle deleted file mode 100644 index 8bfed33..0000000 Binary files a/docs/.doctrees/environment.pickle and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.checks.PrimerChecks.doctree b/docs/.doctrees/generated/primerdriver.checks.PrimerChecks.doctree deleted file mode 100644 index bdd148b..0000000 Binary files a/docs/.doctrees/generated/primerdriver.checks.PrimerChecks.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.checks.SequenceChecks.doctree b/docs/.doctrees/generated/primerdriver.checks.SequenceChecks.doctree deleted file mode 100644 index 2729724..0000000 Binary files a/docs/.doctrees/generated/primerdriver.checks.SequenceChecks.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.exceptions.PrimerCheckError.doctree b/docs/.doctrees/generated/primerdriver.exceptions.PrimerCheckError.doctree deleted file mode 100644 index d3d982d..0000000 Binary files a/docs/.doctrees/generated/primerdriver.exceptions.PrimerCheckError.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.input_handler.interactive_handler.doctree b/docs/.doctrees/generated/primerdriver.input_handler.interactive_handler.doctree deleted file mode 100644 index bbd5011..0000000 Binary files a/docs/.doctrees/generated/primerdriver.input_handler.interactive_handler.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.input_handler.single_command_handler.doctree b/docs/.doctrees/generated/primerdriver.input_handler.single_command_handler.doctree deleted file mode 100644 index 7b18599..0000000 Binary files a/docs/.doctrees/generated/primerdriver.input_handler.single_command_handler.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.output_handler.interactive_saver.doctree b/docs/.doctrees/generated/primerdriver.output_handler.interactive_saver.doctree deleted file mode 100644 index 9a10d25..0000000 Binary files a/docs/.doctrees/generated/primerdriver.output_handler.interactive_saver.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.output_handler.single_command_saver.doctree b/docs/.doctrees/generated/primerdriver.output_handler.single_command_saver.doctree deleted file mode 100644 index 1dcd428..0000000 Binary files a/docs/.doctrees/generated/primerdriver.output_handler.single_command_saver.doctree and /dev/null differ diff --git a/docs/.doctrees/generated/primerdriver.primer_design.PrimerDesign.doctree b/docs/.doctrees/generated/primerdriver.primer_design.PrimerDesign.doctree deleted file mode 100644 index 8769958..0000000 Binary files a/docs/.doctrees/generated/primerdriver.primer_design.PrimerDesign.doctree and /dev/null differ diff --git a/docs/.doctrees/gettingstarted.doctree b/docs/.doctrees/gettingstarted.doctree deleted file mode 100644 index d1b3e95..0000000 Binary files a/docs/.doctrees/gettingstarted.doctree and /dev/null differ diff --git a/docs/.doctrees/index.doctree b/docs/.doctrees/index.doctree deleted file mode 100644 index 969e27c..0000000 Binary files a/docs/.doctrees/index.doctree and /dev/null differ diff --git a/docs/.doctrees/software.doctree b/docs/.doctrees/software.doctree deleted file mode 100644 index 1e38f1b..0000000 Binary files a/docs/.doctrees/software.doctree and /dev/null differ diff --git a/docs/.nojekyll b/docs/.nojekyll deleted file mode 100644 index e69de29..0000000 diff --git a/docs/_sources/api.rst.txt b/docs/_sources/api.rst.txt deleted file mode 100644 index dc1ce80..0000000 --- a/docs/_sources/api.rst.txt +++ /dev/null @@ -1,16 +0,0 @@ -.. _api_reference: - -API Reference -============= - -.. autosummary:: - :toctree: generated - - primerdriver.checks.PrimerChecks - primerdriver.checks.SequenceChecks - primerdriver.exceptions.PrimerCheckError - primerdriver.input_handler.interactive_handler - primerdriver.input_handler.single_command_handler - primerdriver.output_handler.interactive_saver - primerdriver.output_handler.single_command_saver - primerdriver.primer_design.PrimerDesign \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.checks.PrimerChecks.rst.txt b/docs/_sources/generated/primerdriver.checks.PrimerChecks.rst.txt deleted file mode 100644 index 5793255..0000000 --- a/docs/_sources/generated/primerdriver.checks.PrimerChecks.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.checks.PrimerChecks -================================ - -.. currentmodule:: primerdriver.checks - -.. autodata:: PrimerChecks \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.checks.SequenceChecks.rst.txt b/docs/_sources/generated/primerdriver.checks.SequenceChecks.rst.txt deleted file mode 100644 index b7529ef..0000000 --- a/docs/_sources/generated/primerdriver.checks.SequenceChecks.rst.txt +++ /dev/null @@ -1,27 +0,0 @@ -primerdriver.checks.SequenceChecks -================================== - -.. currentmodule:: primerdriver.checks - -.. autoclass:: SequenceChecks - - - .. automethod:: __init__ - - - .. rubric:: Methods - - .. autosummary:: - - ~SequenceChecks.__init__ - ~SequenceChecks.are_melting_temps_close - ~SequenceChecks.is_gc_clamped - ~SequenceChecks.is_valid_gc_content - ~SequenceChecks.is_valid_length - ~SequenceChecks.is_valid_melting_temp - - - - - - \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.exceptions.PrimerCheckError.rst.txt b/docs/_sources/generated/primerdriver.exceptions.PrimerCheckError.rst.txt deleted file mode 100644 index 5fa21ce..0000000 --- a/docs/_sources/generated/primerdriver.exceptions.PrimerCheckError.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.exceptions.PrimerCheckError -======================================== - -.. currentmodule:: primerdriver.exceptions - -.. autoexception:: PrimerCheckError \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.input_handler.interactive_handler.rst.txt b/docs/_sources/generated/primerdriver.input_handler.interactive_handler.rst.txt deleted file mode 100644 index 2f55176..0000000 --- a/docs/_sources/generated/primerdriver.input_handler.interactive_handler.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.input\_handler.interactive\_handler -================================================ - -.. currentmodule:: primerdriver.input_handler - -.. autofunction:: interactive_handler \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.input_handler.single_command_handler.rst.txt b/docs/_sources/generated/primerdriver.input_handler.single_command_handler.rst.txt deleted file mode 100644 index cd16f0c..0000000 --- a/docs/_sources/generated/primerdriver.input_handler.single_command_handler.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.input\_handler.single\_command\_handler -==================================================== - -.. currentmodule:: primerdriver.input_handler - -.. autofunction:: single_command_handler \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.output_handler.interactive_saver.rst.txt b/docs/_sources/generated/primerdriver.output_handler.interactive_saver.rst.txt deleted file mode 100644 index 410703a..0000000 --- a/docs/_sources/generated/primerdriver.output_handler.interactive_saver.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.output\_handler.interactive\_saver -=============================================== - -.. currentmodule:: primerdriver.output_handler - -.. autofunction:: interactive_saver \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.output_handler.single_command_saver.rst.txt b/docs/_sources/generated/primerdriver.output_handler.single_command_saver.rst.txt deleted file mode 100644 index e95bf71..0000000 --- a/docs/_sources/generated/primerdriver.output_handler.single_command_saver.rst.txt +++ /dev/null @@ -1,6 +0,0 @@ -primerdriver.output\_handler.single\_command\_saver -=================================================== - -.. currentmodule:: primerdriver.output_handler - -.. autofunction:: single_command_saver \ No newline at end of file diff --git a/docs/_sources/generated/primerdriver.primer_design.PrimerDesign.rst.txt b/docs/_sources/generated/primerdriver.primer_design.PrimerDesign.rst.txt deleted file mode 100644 index 565808f..0000000 --- a/docs/_sources/generated/primerdriver.primer_design.PrimerDesign.rst.txt +++ /dev/null @@ -1,41 +0,0 @@ -primerdriver.primer\_design.PrimerDesign -======================================== - -.. currentmodule:: primerdriver.primer_design - -.. autoclass:: PrimerDesign - - - .. automethod:: __init__ - - - .. rubric:: Methods - - .. autosummary:: - - ~PrimerDesign.__init__ - ~PrimerDesign.calculate_gc_content - ~PrimerDesign.calculate_melting_temperature - ~PrimerDesign.calculate_mismatch - ~PrimerDesign.characterize_primer - ~PrimerDesign.deletion - ~PrimerDesign.dna_based - ~PrimerDesign.get_reverse_complement - ~PrimerDesign.insertion - ~PrimerDesign.is_gc_end - ~PrimerDesign.main - ~PrimerDesign.protein_based - ~PrimerDesign.substitution - - - - - - .. rubric:: Attributes - - .. autosummary:: - - ~PrimerDesign.lut - ~PrimerDesign.df - - \ No newline at end of file diff --git a/docs/_sources/gettingstarted.rst.txt b/docs/_sources/gettingstarted.rst.txt deleted file mode 100644 index 04891ec..0000000 --- a/docs/_sources/gettingstarted.rst.txt +++ /dev/null @@ -1,491 +0,0 @@ -.. _getting_started: - -Getting Started -=============== - -.. _requirements: - -Requirements ------------- - -To use *PrimerDriver*, you should have: - - `Python 3.8.1 or above `_ - - `Poetry `_ - -Additional packages can be installed via the ``pyproject.toml`` file, which will be covered in the next section. `poetry` will automatically handle creating an isolated virtual environment for the project. - - -.. _installaton: - -Installation ------------- - -First, download the latest release from `GitHub `_ and extract it to your local machine. Open a terminal and ``cd`` to where you extracted the files. Install the required packages via - -.. code-block:: console - - $ poetry install - -Now you are ready to design mutagenic primers. - - -.. _quickstart: - -Quickstart ----------- - -To make sure everything is in working order, run the following commands - -.. code-block:: console - - $ poetry run python --version - $ poetry run python -m primerdriver -h - -If no errors occur, then you are good to go. The PrimerDriver CLI can cater to first-time users by providing an interactive mode which allows the user to go through the settings step-by-step. This is triggered by passing the ``-i`` flag when running the program with no additional arguments - -.. code-block:: console - - $ poetry run python -m primerdriver -i - -The user is greeted with a customized header and the first question:: - - ---. .------------. - ||||\ /||||||||||||||\ - Primer · Driver v1.3.2 - \|||||||||||/ \||||||| - `---------` `------ - - (c) 2020 Kenneth Domingo & Nomer Gutierrez - - Enter primer mode [dna/pro/char]: _ - -Here, the user is asked for the desired mode, from DNA-based design (``dna``), protein-based design (``pro``), or characterization of a user-provided sequence (``char``). Try going through all the questions with some example answers as follows:: - - ---. .------------. - ||||\ /||||||||||||||\ - Primer · Driver v1.3.2 - \|||||||||||/ \||||||| - `---------` `------ - - (c) 2020 Kenneth Domingo & Nomer Gutierrez - - Enter primer mode [dna/pro/char]: char - Enter primer sequence: CGATCGTACGGACGCAGCTCGTAGCTACGATCGATCGATCGATCGTACGTACGTACGATCGTACGATCGATCGTACG - Enter mutation type [s/i/d]: s - Enter number of mismatched bases: 1 - -(*Note*: All inputs are case-insensitive). The resulting characterization is:: - - | | Primer 1 | - |------------------+-------------------------------------------------------------------------------| - | Forward | CGATCGTACGGACGCAGCTCGTAGCTACGATCGATCGATCGATCGTACGTACGTACGATCGTACGATCGATCGTACG | - | Reverse | CGTACGATCGATCGTACGATCGTACGTACGTACGATCGATCGATCGATCGTAGCTACGAGCTGCGTCCGTACGATCG | - | Fwd length | 77 bp | - | Rev length | 77 bp | - | Fwd GC content | 54.55% | - | Rev GC content | 54.55% | - | Fwd melting temp | 94.76 C | - | Rev melting temp | 94.76 C | - | Fwd mol. weight | 10083.12 g/mol | - | Rev mol. weight | 10074.11 g/mol | - | Fwd mismatch | 1.30% | - | Rev mismatch | 1.30% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - Save? [y/n] _ - -In the last line, the user is asked whether or not the characterization should be saved. If the answer is no (``n``), the program terminates. Otherwise, a final prompt appears:: - - Enter filename: _ - -In this case, the program will automatically detect the file extension and save to that format. Supported file formats are ``.csv``, ``.txt``, ``.html``, and ``.fasta``. (*Note*: Primer characterizations cannot be saved as FASTA). Aside from manually entering a DNA sequence at the prompt, the user can instead provide the filename of a FASTA file containing the sequence, provided that the correct relative location is entered. By default, PrimerDriver will look in the same directory as ``primerdriver.py``. - -Let's try another example. Suppose we have a FASTA file named ``read.fasta`` in the root directory. The content of the file is as follows:: - - >Seq1 - CGATCGTACGGACGCAGCTCGTAGCTACGATCGATCGATCGATCGTACGTACGTACGATCGTACGATCGATCGTACG - -Enter the following at the interactive CLI:: - - - ---. .------------. - ||||\ /||||||||||||||\ - Primer · Driver v1.3.2 - \|||||||||||/ \||||||| - `---------` `------ - - (c) 2020 Kenneth Domingo & Nomer Gutierrez - - Enter primer mode [dna/pro/char]: dna - Enter primer sequence: read.fasta - Enter mutation type [s/i/d]: s - Enter target base: C - Enter replacement for target base: G - Enter position of target: 25 - -The output should yield:: - - | | Primer 1 | - |------------------+---------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 27 bp | - | Rev length | 31 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.06% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4102.70 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 3.23% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 2 | - |------------------+----------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | CGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 27 bp | - | Rev length | 32 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 59.38% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.69 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4213.80 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 3.12% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 3 | - |------------------+-------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GATCGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 27 bp | - | Rev length | 35 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 57.14% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.87 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4626.18 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.86% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 4 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | CGATCGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 27 bp | - | Rev length | 36 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.33% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 78.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4737.28 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 5 | - |------------------+----------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCG | - | Fwd length | 27 bp | - | Rev length | 32 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 59.38% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.69 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4253.83 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 3.12% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 6 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GATCGTACGGACGCAGCTCGTAGGTACGATCGATCG | - | Fwd length | 27 bp | - | Rev length | 36 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.33% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 78.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4777.31 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 7 | - |------------------+----------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | CGGACGCAGCTCGTAGGTACGATCGATCGATC | - | Fwd length | 27 bp | - | Rev length | 32 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 59.38% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.69 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4213.80 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 3.12% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 8 | - |------------------+-------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCGATC | - | Fwd length | 27 bp | - | Rev length | 35 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 57.14% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 77.87 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4626.18 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.86% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 9 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | CGTACGGACGCAGCTCGTAGGTACGATCGATCGATC | - | Fwd length | 27 bp | - | Rev length | 36 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.33% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 78.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4737.28 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 10 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCGATCG | - | Fwd length | 27 bp | - | Rev length | 36 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.33% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 78.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4777.31 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 11 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATC | - | Reverse | CGGACGCAGCTCGTAGGTACGATCGATCGATCGATC | - | Fwd length | 27 bp | - | Rev length | 36 bp | - | Fwd GC content | 55.56% | - | Rev GC content | 58.33% | - | Fwd melting temp | 76.05 C | - | Rev melting temp | 78.28 C | - | Fwd mol. weight | 3554.21 g/mol | - | Rev mol. weight | 4737.28 g/mol | - | Fwd mismatch | 3.70% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 12 | - |------------------+---------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 28 bp | - | Rev length | 31 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 58.06% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 78.17 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4102.70 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 3.23% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 13 | - |------------------+----------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | CGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 28 bp | - | Rev length | 32 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 59.38% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 78.58 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4213.80 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 3.12% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 14 | - |------------------+-------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GATCGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 28 bp | - | Rev length | 35 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 57.14% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 78.76 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4626.18 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.86% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 15 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | CGATCGTACGGACGCAGCTCGTAGGTACGATCGATC | - | Fwd length | 28 bp | - | Rev length | 36 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 58.33% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 79.17 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4737.28 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 16 | - |------------------+----------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCG | - | Fwd length | 28 bp | - | Rev length | 32 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 59.38% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 78.58 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4253.83 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 3.12% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 17 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GATCGTACGGACGCAGCTCGTAGGTACGATCGATCG | - | Fwd length | 28 bp | - | Rev length | 36 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 58.33% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 79.17 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4777.31 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 18 | - |------------------+-------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCGATC | - | Fwd length | 28 bp | - | Rev length | 35 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 57.14% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 78.76 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4626.18 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.86% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 19 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | CGTACGGACGCAGCTCGTAGGTACGATCGATCGATC | - | Fwd length | 28 bp | - | Rev length | 36 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 58.33% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 79.17 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4737.28 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - | | Primer 20 | - |------------------+--------------------------------------| - | Forward | GCAGCTCGTAGGTACGATCGATCGATCG | - | Reverse | GTACGGACGCAGCTCGTAGGTACGATCGATCGATCG | - | Fwd length | 28 bp | - | Rev length | 36 bp | - | Fwd GC content | 57.14% | - | Rev GC content | 58.33% | - | Fwd melting temp | 77.76 C | - | Rev melting temp | 79.17 C | - | Fwd mol. weight | 3705.34 g/mol | - | Rev mol. weight | 4777.31 g/mol | - | Fwd mismatch | 3.57% | - | Rev mismatch | 2.78% | - | Fwd ends in G/C | True | - | Rev ends in G/C | True | - - Too many results; truncating output... - - Save? [y/n] _ - -Notice that the output is silenced if the number of potential primers exceed 20. In this case, the exceeding primers are still stored and can be accessed by saving the results. The above example can be run in single command mode via - -.. code-block:: console - - $ poetry run python -m primerdriver --mode dna --sequence read.fasta --mutation-type sub --target C --position 25 --replacement G --save primers.fasta - -or in shorthand form via - -.. code-block:: console - - $ poetry run python -m primerdriver -M dna -s read.fasta -m sub -t C -p 25 -r G --save primers.fasta - -The ``--save`` argument is optional and can be omitted if the first 20 primers suffice for the user. As you can see, this can become a powerful tool especially when batch designing primers, by including it as part of a shell script. - -Protein-based design works similarly and uses *Homo sapiens* expression system by default - -.. code-block:: console - - $ poetry run python -m primerdriver --mode pro --sequence CAISBVAIVBAIVBCAICBASCBAVQVFEWQEPFQEHVSDBVSKZDBNCSD --mutation-type sub -t Q -p 26 -r R diff --git a/docs/_sources/index.rst.txt b/docs/_sources/index.rst.txt deleted file mode 100644 index 8d4a9ae..0000000 --- a/docs/_sources/index.rst.txt +++ /dev/null @@ -1,32 +0,0 @@ -.. PrimerDriver documentation master file, created by - sphinx-quickstart on Mon Feb 24 21:07:35 2020. - You can adapt this file completely to your liking, but it should at least - contain the root `toctree` directive. - -.. image:: _static/PrimerDriver_logo.png - -.. toctree:: - :maxdepth: 3 - :caption: Contents: - - gettingstarted - software - api - Source Code - Official Website - - -.. _introduction: - -Introduction -============ - -*PrimerDriver* is a user-friendly bioinformatics platform specifically designed to generate primers for site-directed mutagenesis experiments into workflows with an easy-to-use command-line interface. “Traversing” *PrimerDriver* lanes, users can generate possible mutagenic primers upon input of a DNA sequence (``DNA``), design primers for an array of species codon expression systems through direct mutation of the amino acid (``PRO``), characterize and report user-designed primers (``CHAR``). - - -Indices and tables -================== - -* :ref:`genindex` -* :ref:`modindex` -* :ref:`search` diff --git a/docs/_sources/software.rst.txt b/docs/_sources/software.rst.txt deleted file mode 100644 index 0a281de..0000000 --- a/docs/_sources/software.rst.txt +++ /dev/null @@ -1,149 +0,0 @@ -.. _software_features: - -Software Features -================= - - -.. _parameter_setting: - -Parameter Setting ------------------ - -The user parameter setting is possible for the inputs in PrimerDriver. The tool designs the desired mutagenic primer pairs according to user input and performs site-directed mutagenesis from single- or multiple-bases within the sequence. - -When running ``primerdriver`` as standalone CLI, the user needs to modify the ``primerdriver/settings.json`` file to define custom values for the required parameters. The parameter defaults are as follows - -.. code-block:: json - - { - "Tm_range_min": 75, - "Tm_range_max": 85, - "gc_range_min": 40, - "gc_range_max": 60, - "length_min": 25, - "length_max": 45, - "flank5_range_min": 11, - "flank5_range_max": 21, - "flank3_range_min": 11, - "flank3_range_max": 21, - "forward_overlap5": 9, - "forward_overlap3": 9, - "terminate_gc" : true, - "center_mutation": false, - "primer_mode": "overlapping", - "expression_system": "Homo sapiens" - } - -When running ``primerdriver`` as part of a larger Python script, you can instead import the settings via - -.. code-block:: python - - from primerdriver.config import get_settings - - settings = get_settings() - -then access/modify the individual parameters using dot notation, e.g. - -.. code-block:: python - - settings.terminate_gc = False - settings.length_min = 20 - settings.length_max = 55 - -then pass the updated settings when initializing the module - -.. code-block:: python - - from primerdriver.primer_design import PrimerDesign - - pd = PrimerDesign(*args, settings=settings) - -The following definitions and considerations should be made for designing mutagenic primers: - -- ``Tm_range`` - This is where the user sets the minimum and maximum allowable melting temperature (:math:`T_m`) of primers in a PCR reaction. Depending on the type of mutation, the melting temperature is calculated differently. Estimation of the Tm of primers for base substitution is defined by - - .. math:: - - T_m = 81.5 + 0.41(\%\textrm{GC}) - \frac{675}{N} - \%\textrm{mismatch} - - where :math:`N` is the primer length in base pairs, and :math:`\%\textrm{GC}, \%\textrm{mismatch}` are whole numbers. A modified formula is used for calculating :math:`T_m` that intends to introduce deletions or insertions: - - .. math:: - - T_m = 81.5 + 0.41(\%\textrm{GC}) - \frac{675}{N} - -- ``gc_range`` - The GC content is calculated as - - .. math:: - - \%\textrm{GC} = \frac{\textrm{# of G + # of C}}{\textrm{total length of primer}} - - and the range of GC in a primer is to be set by the user. The user can follow the percentage as prescribed by a protocol or the user can just set the range from 0 to 100. - -- ``length`` - The total length of the desired mutagenic primer - -- ``flank5_range`` - This is the length of the region that is to the left of the mutation when read in standard sequence notation. - -- ``flank3_range`` - This refers to the length of the region that is to the right of the mutation when read in 5' to 3'. - -- ``forward_overlap5`` - When generating overlapping primers, this is where the user sets the minimum number of overlapping bases of the 5’ end of the forward primer to the reverse primer. - -- ``forward_overlap3`` - This sets the minimum number of base overlaps from the 3' end of the forward primer to the reverse primer. - -- ``terminate_gc`` - Set in boolean values, this refers to having a GC clamp at both ends of the primers. - -- ``center_mutation`` - This sets the mutation is centered within the primer. Flanking regions differ by at most one base pair. These are set by boolean values. - -- ``primer_mode`` - This gives the user the choice of having overlapping primers or complementary primers. Both modes use protocol from QuikChange™ Site-Directed Mutagenesis Kit by Stratagene®. - - - Complementary - The values for the flanking regions will just be applied to the forward primer. The reverse primers will just be the reverse complements of the forward primers. - - - Overlapping - Both the forward and reverse primers will be screened for the flanking region values. Forward overlap values will also be applied when generating the primer pairs. - -- ``expression_system`` - When using Protein based primer design, the user can choose from a number of commonly used model organisms used in molecular and cell biology. This enables the tool to generate primers that use the optimum codon for the chosen organism. - - -.. _input_format: - -Input format ------------- - -In PrimerDriver, sequences can be added either by copying/pasting into the input cursor. The tool also accepts one or multiple sequences when uploaded in FASTA format. The input sequence must match the DNA sequence that will serve as template for PCR. Before processing the sequences, a basic input emending (FASTA headers, unsupported characters) is performed. - - -.. _interface: - -Choosing an interface ---------------------- - -As a powerful and useful feature in DNA engineering, the Web server offers the possibility of designing primers for site-directed mutagenesis. The tool can accommodate both DNA and protein sequences to incorporate base pair insertions, deletions, and substitutions as specified by the user. This can cater to an array of primer designs for site-directed single mutagenesis. PrimerDriver also lets you choose from two different command-line modes: - -- Interactive mode - Guides the user through a step-by-step input prompt. Primarily aimed towards demonstration purposes and first-time users of the program. - -- Single-command mode - Requires the user to include all the inputs and arguments needed to perform the task in a single command. Primarily aimed towards more advanced tasks such as batch primer design. - - -.. _design_mode: - -Choosing primer design modes ----------------------------- - -PrimerDriver asks you to choose from three different modes when using the command-line interface: - - Primer characterization - - DNA-based primer design - - Protein-based primer design diff --git a/docs/_static/PrimerDriver_logo.png b/docs/_static/PrimerDriver_logo.png deleted file mode 100644 index 3b5cf71..0000000 Binary files a/docs/_static/PrimerDriver_logo.png and /dev/null differ diff --git a/docs/_static/basic.css b/docs/_static/basic.css deleted file mode 100644 index 7577acb..0000000 --- a/docs/_static/basic.css +++ /dev/null @@ -1,903 +0,0 @@ -/* - * basic.css - * ~~~~~~~~~ - * - * Sphinx stylesheet -- basic theme. - * - * :copyright: Copyright 2007-2023 by the Sphinx team, see AUTHORS. - * :license: BSD, see LICENSE for details. - * - */ - -/* -- main layout ----------------------------------------------------------- */ - -div.clearer { - clear: both; -} - -div.section::after { - display: block; - content: ''; - clear: left; -} - -/* -- relbar ---------------------------------------------------------------- */ - -div.related { - width: 100%; - font-size: 90%; -} - -div.related h3 { - display: none; -} - -div.related ul { - margin: 0; - padding: 0 0 0 10px; - list-style: none; -} - -div.related li { - display: inline; -} - -div.related li.right { - float: right; - margin-right: 5px; -} - -/* -- sidebar --------------------------------------------------------------- */ - -div.sphinxsidebarwrapper { - padding: 10px 5px 0 10px; -} - -div.sphinxsidebar { - float: left; - width: 230px; - margin-left: -100%; - font-size: 90%; - word-wrap: break-word; - overflow-wrap : break-word; -} - -div.sphinxsidebar ul { - list-style: none; -} - -div.sphinxsidebar ul ul, -div.sphinxsidebar ul.want-points { - margin-left: 20px; - list-style: square; -} - -div.sphinxsidebar ul ul { - margin-top: 0; - margin-bottom: 0; -} - -div.sphinxsidebar form { - margin-top: 10px; -} - -div.sphinxsidebar input { - border: 1px solid #98dbcc; - font-family: sans-serif; - font-size: 1em; -} - -div.sphinxsidebar #searchbox form.search { - overflow: hidden; -} - -div.sphinxsidebar #searchbox input[type="text"] { - float: left; - width: 80%; - padding: 0.25em; - box-sizing: border-box; -} - -div.sphinxsidebar #searchbox input[type="submit"] { - float: left; - width: 20%; - border-left: none; - padding: 0.25em; - box-sizing: border-box; -} - - -img { - border: 0; - max-width: 100%; -} - -/* -- search page ----------------------------------------------------------- */ - -ul.search { - margin: 10px 0 0 20px; - padding: 0; -} - -ul.search li { - padding: 5px 0 5px 20px; - background-image: url(file.png); - background-repeat: no-repeat; - background-position: 0 7px; -} - -ul.search li a { - font-weight: bold; -} - -ul.search li p.context { - color: #888; - margin: 2px 0 0 30px; - text-align: left; -} - -ul.keywordmatches li.goodmatch a { - font-weight: bold; -} - -/* -- index page ------------------------------------------------------------ */ - -table.contentstable { - width: 90%; - margin-left: auto; - margin-right: auto; -} - -table.contentstable p.biglink { - line-height: 150%; -} - -a.biglink { - font-size: 1.3em; -} - -span.linkdescr { - font-style: italic; - padding-top: 5px; - font-size: 90%; -} - -/* -- general index --------------------------------------------------------- */ - -table.indextable { - width: 100%; -} - -table.indextable td { - text-align: left; - vertical-align: top; -} - -table.indextable ul { - margin-top: 0; - margin-bottom: 0; - list-style-type: none; -} - -table.indextable > tbody > tr > td > ul { - padding-left: 0em; -} - -table.indextable tr.pcap { - height: 10px; -} - -table.indextable tr.cap { - margin-top: 10px; - background-color: #f2f2f2; -} - -img.toggler { - margin-right: 3px; - margin-top: 3px; - cursor: pointer; -} - -div.modindex-jumpbox { - border-top: 1px solid #ddd; - border-bottom: 1px solid #ddd; - margin: 1em 0 1em 0; - padding: 0.4em; -} - -div.genindex-jumpbox { - border-top: 1px solid #ddd; - border-bottom: 1px solid #ddd; - margin: 1em 0 1em 0; - padding: 0.4em; -} - -/* -- domain module index --------------------------------------------------- */ - -table.modindextable td { - padding: 2px; - border-collapse: collapse; -} - -/* -- general body styles --------------------------------------------------- */ - -div.body { - min-width: 360px; - max-width: 800px; -} - -div.body p, div.body dd, div.body li, div.body blockquote { - -moz-hyphens: auto; - -ms-hyphens: auto; - -webkit-hyphens: auto; - hyphens: auto; -} - -a.headerlink { - visibility: hidden; -} - -h1:hover > a.headerlink, -h2:hover > a.headerlink, -h3:hover > a.headerlink, -h4:hover > a.headerlink, -h5:hover > a.headerlink, -h6:hover > a.headerlink, -dt:hover > a.headerlink, -caption:hover > a.headerlink, -p.caption:hover > a.headerlink, -div.code-block-caption:hover > a.headerlink { - visibility: visible; -} - -div.body p.caption { - text-align: inherit; -} - -div.body td { - text-align: left; -} - -.first { - margin-top: 0 !important; -} - -p.rubric { - margin-top: 30px; - font-weight: bold; -} - -img.align-left, figure.align-left, .figure.align-left, object.align-left { - clear: left; - float: left; - margin-right: 1em; -} - -img.align-right, figure.align-right, .figure.align-right, object.align-right { - clear: right; - float: right; - margin-left: 1em; -} - -img.align-center, figure.align-center, .figure.align-center, object.align-center { - display: block; - margin-left: auto; - margin-right: auto; -} - -img.align-default, figure.align-default, .figure.align-default { - display: block; - margin-left: auto; - margin-right: auto; -} - -.align-left { - text-align: left; -} - -.align-center { - text-align: center; -} - -.align-default { - text-align: center; -} - -.align-right { - text-align: right; -} - -/* -- sidebars -------------------------------------------------------------- */ - -div.sidebar, -aside.sidebar { - margin: 0 0 0.5em 1em; - border: 1px solid #ddb; - padding: 7px; - background-color: #ffe; - width: 40%; - float: right; - clear: right; - overflow-x: auto; -} - -p.sidebar-title { - font-weight: bold; -} - -nav.contents, -aside.topic, -div.admonition, div.topic, blockquote { - clear: left; -} - -/* -- topics ---------------------------------------------------------------- */ - -nav.contents, -aside.topic, -div.topic { - border: 1px solid #ccc; - padding: 7px; - margin: 10px 0 10px 0; -} - -p.topic-title { - font-size: 1.1em; - font-weight: bold; - margin-top: 10px; -} - -/* -- admonitions ----------------------------------------------------------- */ - -div.admonition { - margin-top: 10px; - margin-bottom: 10px; - padding: 7px; -} - -div.admonition dt { - font-weight: bold; -} - -p.admonition-title { - margin: 0px 10px 5px 0px; - font-weight: bold; -} - -div.body p.centered { - text-align: center; - margin-top: 25px; -} - -/* -- content of sidebars/topics/admonitions -------------------------------- */ - -div.sidebar > :last-child, -aside.sidebar > :last-child, -nav.contents > :last-child, -aside.topic > :last-child, -div.topic > :last-child, -div.admonition > :last-child { - margin-bottom: 0; -} - -div.sidebar::after, -aside.sidebar::after, -nav.contents::after, -aside.topic::after, -div.topic::after, -div.admonition::after, -blockquote::after { - display: block; - content: ''; - clear: both; -} - -/* -- tables ---------------------------------------------------------------- */ - -table.docutils { - margin-top: 10px; - margin-bottom: 10px; - border: 0; - border-collapse: collapse; -} - -table.align-center { - margin-left: auto; - margin-right: auto; -} - -table.align-default { - margin-left: auto; - margin-right: auto; -} - -table caption span.caption-number { - font-style: italic; -} - -table caption span.caption-text { -} - -table.docutils td, table.docutils th { - padding: 1px 8px 1px 5px; - border-top: 0; - border-left: 0; - border-right: 0; - border-bottom: 1px solid #aaa; -} - -th { - text-align: left; - padding-right: 5px; -} - -table.citation { - border-left: solid 1px gray; - margin-left: 1px; -} - -table.citation td { - border-bottom: none; -} - -th > :first-child, -td > :first-child { - margin-top: 0px; -} - -th > :last-child, -td > :last-child { - margin-bottom: 0px; -} - -/* -- figures --------------------------------------------------------------- */ - -div.figure, figure { - margin: 0.5em; - padding: 0.5em; -} - -div.figure p.caption, figcaption { - padding: 0.3em; -} - -div.figure p.caption span.caption-number, -figcaption span.caption-number { - font-style: italic; -} - -div.figure p.caption span.caption-text, -figcaption span.caption-text { -} - -/* -- field list styles ----------------------------------------------------- */ - -table.field-list td, table.field-list th { - border: 0 !important; -} - -.field-list ul { - margin: 0; - padding-left: 1em; -} - -.field-list p { - margin: 0; -} - -.field-name { - -moz-hyphens: manual; - -ms-hyphens: manual; - -webkit-hyphens: manual; - hyphens: manual; -} - -/* -- hlist styles ---------------------------------------------------------- */ - -table.hlist { - margin: 1em 0; -} - -table.hlist td { - vertical-align: top; -} - -/* -- object description styles --------------------------------------------- */ - -.sig { - font-family: 'Consolas', 'Menlo', 'DejaVu Sans Mono', 'Bitstream Vera Sans Mono', monospace; -} - -.sig-name, code.descname { - background-color: transparent; - font-weight: bold; -} - -.sig-name { - font-size: 1.1em; -} - -code.descname { - font-size: 1.2em; -} - -.sig-prename, code.descclassname { - background-color: transparent; -} - -.optional { - font-size: 1.3em; -} - -.sig-paren { - font-size: larger; -} - -.sig-param.n { - font-style: italic; -} - -/* C++ specific styling */ - -.sig-inline.c-texpr, -.sig-inline.cpp-texpr { - font-family: unset; -} - -.sig.c .k, .sig.c .kt, -.sig.cpp .k, .sig.cpp .kt { - color: #0033B3; -} - -.sig.c .m, -.sig.cpp .m { - color: #1750EB; -} - -.sig.c .s, .sig.c .sc, -.sig.cpp .s, .sig.cpp .sc { - color: #067D17; -} - - -/* -- other body styles ----------------------------------------------------- */ - -ol.arabic { - list-style: decimal; -} - -ol.loweralpha { - list-style: lower-alpha; -} - -ol.upperalpha { - list-style: upper-alpha; -} - -ol.lowerroman { - list-style: lower-roman; -} - -ol.upperroman { - list-style: upper-roman; -} - -:not(li) > ol > li:first-child > :first-child, -:not(li) > ul > li:first-child > :first-child { - margin-top: 0px; -} - -:not(li) > ol > li:last-child > :last-child, -:not(li) > ul > li:last-child > :last-child { - margin-bottom: 0px; -} - -ol.simple ol p, -ol.simple ul p, -ul.simple ol p, -ul.simple ul p { - margin-top: 0; -} - -ol.simple > li:not(:first-child) > p, -ul.simple > li:not(:first-child) > p { - margin-top: 0; -} - -ol.simple p, -ul.simple p { - margin-bottom: 0; -} - -aside.footnote > span, -div.citation > span { - float: left; -} -aside.footnote > span:last-of-type, -div.citation > span:last-of-type { - padding-right: 0.5em; -} -aside.footnote > p { - margin-left: 2em; -} -div.citation > p { - margin-left: 4em; -} -aside.footnote > p:last-of-type, -div.citation > p:last-of-type { - margin-bottom: 0em; -} -aside.footnote > p:last-of-type:after, -div.citation > p:last-of-type:after { - content: ""; - clear: both; -} - -dl.field-list { - display: grid; - grid-template-columns: fit-content(30%) auto; -} - -dl.field-list > dt { - font-weight: bold; - word-break: break-word; - padding-left: 0.5em; - padding-right: 5px; -} - -dl.field-list > dd { - padding-left: 0.5em; - margin-top: 0em; - margin-left: 0em; - margin-bottom: 0em; -} - -dl { - margin-bottom: 15px; -} - -dd > :first-child { - margin-top: 0px; -} - -dd ul, dd table { - margin-bottom: 10px; -} - -dd { - margin-top: 3px; - margin-bottom: 10px; - margin-left: 30px; -} - -dl > dd:last-child, -dl > dd:last-child > :last-child { - margin-bottom: 0; -} - -dt:target, span.highlighted { - background-color: #fbe54e; -} - -rect.highlighted { - fill: #fbe54e; -} - -dl.glossary dt { - font-weight: bold; - font-size: 1.1em; -} - -.versionmodified { - font-style: italic; -} - -.system-message { - background-color: #fda; - padding: 5px; - border: 3px solid red; -} - -.footnote:target { - background-color: #ffa; -} - -.line-block { - display: block; - margin-top: 1em; - margin-bottom: 1em; -} - -.line-block .line-block { - margin-top: 0; - margin-bottom: 0; - margin-left: 1.5em; -} - -.guilabel, .menuselection { - font-family: sans-serif; -} - -.accelerator { - text-decoration: underline; -} - -.classifier { - font-style: oblique; -} - -.classifier:before { - font-style: normal; - margin: 0 0.5em; - content: ":"; - display: inline-block; -} - -abbr, acronym { - border-bottom: dotted 1px; - cursor: help; -} - -/* -- code displays --------------------------------------------------------- */ - -pre { - overflow: auto; - overflow-y: hidden; /* fixes display issues on Chrome browsers */ -} - -pre, div[class*="highlight-"] { - clear: both; -} - -span.pre { - -moz-hyphens: none; - -ms-hyphens: none; - -webkit-hyphens: none; - hyphens: none; - white-space: nowrap; -} - -div[class*="highlight-"] { - margin: 1em 0; -} - -td.linenos pre { - border: 0; - background-color: transparent; - color: #aaa; -} - -table.highlighttable { - display: block; -} - -table.highlighttable tbody { - display: block; -} - -table.highlighttable tr { - display: flex; -} - -table.highlighttable td { - margin: 0; - padding: 0; -} - -table.highlighttable td.linenos { - padding-right: 0.5em; -} - -table.highlighttable td.code { - flex: 1; - overflow: hidden; -} - -.highlight .hll { - display: block; -} - -div.highlight pre, -table.highlighttable pre { - margin: 0; -} - -div.code-block-caption + div { - margin-top: 0; -} - -div.code-block-caption { - margin-top: 1em; - padding: 2px 5px; - font-size: small; -} - -div.code-block-caption code { - background-color: transparent; -} - -table.highlighttable td.linenos, -span.linenos, -div.highlight span.gp { /* gp: Generic.Prompt */ - user-select: none; - -webkit-user-select: text; /* Safari fallback only */ - -webkit-user-select: none; /* Chrome/Safari */ - -moz-user-select: none; /* Firefox */ - -ms-user-select: none; /* IE10+ */ -} - -div.code-block-caption span.caption-number { - padding: 0.1em 0.3em; - font-style: italic; -} - -div.code-block-caption span.caption-text { -} - -div.literal-block-wrapper { - margin: 1em 0; -} - -code.xref, a code { - background-color: transparent; - font-weight: bold; -} - -h1 code, h2 code, h3 code, h4 code, h5 code, h6 code { - background-color: transparent; -} - -.viewcode-link { - float: right; -} - -.viewcode-back { - float: right; - font-family: sans-serif; -} - -div.viewcode-block:target { - margin: -1px -10px; - padding: 0 10px; -} - -/* -- math display ---------------------------------------------------------- */ - -img.math { - vertical-align: middle; -} - -div.body div.math p { - text-align: center; -} - -span.eqno { - float: right; -} - -span.eqno a.headerlink { - position: absolute; - z-index: 1; -} - -div.math:hover a.headerlink { - visibility: visible; -} - -/* -- printout stylesheet --------------------------------------------------- */ - -@media print { - div.document, - div.documentwrapper, - div.bodywrapper { - margin: 0 !important; - width: 100%; - } - - div.sphinxsidebar, - div.related, - div.footer, - #top-link { - display: none; - } -} \ No newline at end of file diff --git a/docs/_static/debug.css b/docs/_static/debug.css deleted file mode 100644 index 74d4aec..0000000 --- a/docs/_static/debug.css +++ /dev/null @@ -1,69 +0,0 @@ -/* - This CSS file should be overridden by the theme authors. It's - meant for debugging and developing the skeleton that this theme provides. -*/ -body { - font-family: -apple-system, "Segoe UI", Roboto, Helvetica, Arial, sans-serif, - "Apple Color Emoji", "Segoe UI Emoji"; - background: lavender; -} -.sb-announcement { - background: rgb(131, 131, 131); -} -.sb-announcement__inner { - background: black; - color: white; -} -.sb-header { - background: lightskyblue; -} -.sb-header__inner { - background: royalblue; - color: white; -} -.sb-header-secondary { - background: lightcyan; -} -.sb-header-secondary__inner { - background: cornflowerblue; - color: white; -} -.sb-sidebar-primary { - background: lightgreen; -} -.sb-main { - background: blanchedalmond; -} -.sb-main__inner { - background: antiquewhite; -} -.sb-header-article { - background: lightsteelblue; -} -.sb-article-container { - background: snow; -} -.sb-article-main { - background: white; -} -.sb-footer-article { - background: lightpink; -} -.sb-sidebar-secondary { - background: lightgoldenrodyellow; -} -.sb-footer-content { - background: plum; -} -.sb-footer-content__inner { - background: palevioletred; -} -.sb-footer { - background: pink; -} -.sb-footer__inner { - background: salmon; -} -.sb-article { - background: white; -} diff --git a/docs/_static/doctools.js b/docs/_static/doctools.js deleted file mode 100644 index d06a71d..0000000 --- a/docs/_static/doctools.js +++ /dev/null @@ -1,156 +0,0 @@ -/* - * doctools.js - * ~~~~~~~~~~~ - * - * Base JavaScript utilities for all Sphinx HTML documentation. - * - * :copyright: Copyright 2007-2023 by the Sphinx team, see AUTHORS. - * :license: BSD, see LICENSE for details. - * - */ -"use strict"; - -const BLACKLISTED_KEY_CONTROL_ELEMENTS = new Set([ - "TEXTAREA", - "INPUT", - "SELECT", - "BUTTON", -]); - -const _ready = (callback) => { - if (document.readyState !== "loading") { - callback(); - } else { - document.addEventListener("DOMContentLoaded", callback); - } -}; - -/** - * Small JavaScript module for the documentation. - */ -const Documentation = { - init: () => { - Documentation.initDomainIndexTable(); - Documentation.initOnKeyListeners(); - }, - - /** - * i18n support - */ - TRANSLATIONS: {}, - PLURAL_EXPR: (n) => (n === 1 ? 0 : 1), - LOCALE: "unknown", - - // gettext and ngettext don't access this so that the functions - // can safely bound to a different name (_ = Documentation.gettext) - gettext: (string) => { - const translated = Documentation.TRANSLATIONS[string]; - switch (typeof translated) { - case "undefined": - return string; // no translation - case "string": - return translated; // translation exists - default: - return translated[0]; // (singular, plural) translation tuple exists - } - }, - - ngettext: (singular, plural, n) => { - const translated = Documentation.TRANSLATIONS[singular]; - if (typeof translated !== "undefined") - return translated[Documentation.PLURAL_EXPR(n)]; - return n === 1 ? singular : plural; - }, - - addTranslations: (catalog) => { - Object.assign(Documentation.TRANSLATIONS, catalog.messages); - Documentation.PLURAL_EXPR = new Function( - "n", - `return (${catalog.plural_expr})` - ); - Documentation.LOCALE = catalog.locale; - }, - - /** - * helper function to focus on search bar - */ - focusSearchBar: () => { - document.querySelectorAll("input[name=q]")[0]?.focus(); - }, - - /** - * Initialise the domain index toggle buttons - */ - initDomainIndexTable: () => { - const toggler = (el) => { - const idNumber = el.id.substr(7); - const toggledRows = document.querySelectorAll(`tr.cg-${idNumber}`); - if (el.src.substr(-9) === "minus.png") { - el.src = `${el.src.substr(0, el.src.length - 9)}plus.png`; - toggledRows.forEach((el) => (el.style.display = "none")); - } else { - el.src = `${el.src.substr(0, el.src.length - 8)}minus.png`; - toggledRows.forEach((el) => (el.style.display = "")); - } - }; - - const togglerElements = document.querySelectorAll("img.toggler"); - togglerElements.forEach((el) => - el.addEventListener("click", (event) => toggler(event.currentTarget)) - ); - togglerElements.forEach((el) => (el.style.display = "")); - if (DOCUMENTATION_OPTIONS.COLLAPSE_INDEX) togglerElements.forEach(toggler); - }, - - initOnKeyListeners: () => { - // only install a listener if it is really needed - if ( - !DOCUMENTATION_OPTIONS.NAVIGATION_WITH_KEYS && - !DOCUMENTATION_OPTIONS.ENABLE_SEARCH_SHORTCUTS - ) - return; - - document.addEventListener("keydown", (event) => { - // bail for input elements - if (BLACKLISTED_KEY_CONTROL_ELEMENTS.has(document.activeElement.tagName)) return; - // bail with special keys - if (event.altKey || event.ctrlKey || event.metaKey) return; - - if (!event.shiftKey) { - switch (event.key) { - case "ArrowLeft": - if (!DOCUMENTATION_OPTIONS.NAVIGATION_WITH_KEYS) break; - - const prevLink = document.querySelector('link[rel="prev"]'); - if (prevLink && prevLink.href) { - window.location.href = prevLink.href; - event.preventDefault(); - } - break; - case "ArrowRight": - if (!DOCUMENTATION_OPTIONS.NAVIGATION_WITH_KEYS) break; - - const nextLink = document.querySelector('link[rel="next"]'); - if (nextLink && nextLink.href) { - window.location.href = nextLink.href; - event.preventDefault(); - } - break; - } - } - - // some keyboard layouts may need Shift to get / - switch (event.key) { - case "/": - if (!DOCUMENTATION_OPTIONS.ENABLE_SEARCH_SHORTCUTS) break; - Documentation.focusSearchBar(); - event.preventDefault(); - } - }); - }, -}; - -// quick alias for translations -const _ = Documentation.gettext; - -_ready(Documentation.init); diff --git a/docs/_static/documentation_options.js b/docs/_static/documentation_options.js deleted file mode 100644 index 6d7ffe2..0000000 --- a/docs/_static/documentation_options.js +++ /dev/null @@ -1,14 +0,0 @@ -var DOCUMENTATION_OPTIONS = { - URL_ROOT: document.getElementById("documentation_options").getAttribute('data-url_root'), - VERSION: '1.5.0', - LANGUAGE: 'en', - COLLAPSE_INDEX: false, - BUILDER: 'html', - FILE_SUFFIX: '.html', - LINK_SUFFIX: '.html', - HAS_SOURCE: true, - SOURCELINK_SUFFIX: '.txt', - NAVIGATION_WITH_KEYS: false, - SHOW_SEARCH_SUMMARY: true, - ENABLE_SEARCH_SHORTCUTS: true, -}; \ No newline at end of file diff --git a/docs/_static/file.png b/docs/_static/file.png deleted file mode 100644 index a858a41..0000000 Binary files a/docs/_static/file.png and /dev/null differ diff --git a/docs/_static/language_data.js b/docs/_static/language_data.js deleted file mode 100644 index 250f566..0000000 --- a/docs/_static/language_data.js +++ /dev/null @@ -1,199 +0,0 @@ -/* - * language_data.js - * ~~~~~~~~~~~~~~~~ - * - * This script contains the language-specific data used by searchtools.js, - * namely the list of stopwords, stemmer, scorer and splitter. - * - * :copyright: Copyright 2007-2023 by the Sphinx team, see AUTHORS. - * :license: BSD, see LICENSE for details. - * - */ - -var stopwords = ["a", "and", "are", "as", "at", "be", "but", "by", "for", "if", "in", "into", "is", "it", "near", "no", "not", "of", "on", "or", "such", "that", "the", "their", "then", "there", "these", "they", "this", "to", "was", "will", "with"]; - - -/* Non-minified version is copied as a separate JS file, is available */ - -/** - * Porter Stemmer - */ -var Stemmer = function() { - - var step2list = { - ational: 'ate', - tional: 'tion', - enci: 'ence', - anci: 'ance', - izer: 'ize', - bli: 'ble', - alli: 'al', - entli: 'ent', - eli: 'e', - ousli: 'ous', - ization: 'ize', - ation: 'ate', - ator: 'ate', - alism: 'al', - iveness: 'ive', - fulness: 'ful', - ousness: 'ous', - aliti: 'al', - iviti: 'ive', - biliti: 'ble', - logi: 'log' - }; - - var step3list = { - icate: 'ic', - ative: '', - alize: 'al', - iciti: 'ic', - ical: 'ic', - ful: '', - ness: '' - }; - - var c = "[^aeiou]"; // consonant - var v = "[aeiouy]"; // vowel - var C = c + "[^aeiouy]*"; // consonant sequence - var V = v + "[aeiou]*"; // vowel sequence - - var mgr0 = "^(" + C + ")?" + V + C; // [C]VC... is m>0 - var meq1 = "^(" + C + ")?" + V + C + "(" + V + ")?$"; // [C]VC[V] is m=1 - var mgr1 = "^(" + C + ")?" + V + C + V + C; // [C]VCVC... is m>1 - var s_v = "^(" + C + ")?" + v; // vowel in stem - - this.stemWord = function (w) { - var stem; - var suffix; - var firstch; - var origword = w; - - if (w.length < 3) - return w; - - var re; - var re2; - var re3; - var re4; - - firstch = w.substr(0,1); - if (firstch == "y") - w = firstch.toUpperCase() + w.substr(1); - - // Step 1a - re = /^(.+?)(ss|i)es$/; - re2 = /^(.+?)([^s])s$/; - - if (re.test(w)) - w = w.replace(re,"$1$2"); - else if (re2.test(w)) - w = w.replace(re2,"$1$2"); - - // Step 1b - re = /^(.+?)eed$/; - re2 = /^(.+?)(ed|ing)$/; - if (re.test(w)) { - var fp = re.exec(w); - re = new RegExp(mgr0); - if (re.test(fp[1])) { - re = /.$/; - w = w.replace(re,""); - } - } - else if (re2.test(w)) { - var fp = re2.exec(w); - stem = fp[1]; - re2 = new RegExp(s_v); - if (re2.test(stem)) { - w = stem; - re2 = /(at|bl|iz)$/; - re3 = new RegExp("([^aeiouylsz])\\1$"); - re4 = new RegExp("^" + C + v + "[^aeiouwxy]$"); - if (re2.test(w)) - w = w + "e"; - else if (re3.test(w)) { - re = /.$/; - w = w.replace(re,""); - } - else if (re4.test(w)) - w = w + "e"; - } - } - - // Step 1c - re = /^(.+?)y$/; - if (re.test(w)) { - var fp = re.exec(w); - stem = fp[1]; - re = new RegExp(s_v); - if (re.test(stem)) - w = stem + "i"; - } - - // Step 2 - re = /^(.+?)(ational|tional|enci|anci|izer|bli|alli|entli|eli|ousli|ization|ation|ator|alism|iveness|fulness|ousness|aliti|iviti|biliti|logi)$/; - if (re.test(w)) { - var fp = re.exec(w); - stem = fp[1]; - suffix = fp[2]; - re = new RegExp(mgr0); - if (re.test(stem)) - w = stem + step2list[suffix]; - } - - // Step 3 - re = /^(.+?)(icate|ative|alize|iciti|ical|ful|ness)$/; - if (re.test(w)) { - var fp = re.exec(w); - stem = fp[1]; - suffix = fp[2]; - re = new RegExp(mgr0); - if (re.test(stem)) - w = stem + step3list[suffix]; - } - - // Step 4 - re = /^(.+?)(al|ance|ence|er|ic|able|ible|ant|ement|ment|ent|ou|ism|ate|iti|ous|ive|ize)$/; - re2 = /^(.+?)(s|t)(ion)$/; - if (re.test(w)) { - var fp = re.exec(w); - stem = fp[1]; - re = new RegExp(mgr1); - if (re.test(stem)) - w = stem; - } - else if (re2.test(w)) { - var fp = re2.exec(w); - stem = fp[1] + fp[2]; - re2 = new RegExp(mgr1); - if (re2.test(stem)) - w = stem; - } - - // Step 5 - re = /^(.+?)e$/; - if (re.test(w)) { - var fp = re.exec(w); - stem = fp[1]; - re = new RegExp(mgr1); - re2 = new RegExp(meq1); - re3 = new RegExp("^" + C + v + "[^aeiouwxy]$"); - if (re.test(stem) || (re2.test(stem) && !(re3.test(stem)))) - w = stem; - } - re = /ll$/; - re2 = new RegExp(mgr1); - if (re.test(w) && re2.test(w)) { - re = /.$/; - w = w.replace(re,""); - } - - // and turn initial Y back to y - if (firstch == "y") - w = firstch.toLowerCase() + w.substr(1); - return w; - } -} - diff --git a/docs/_static/minus.png b/docs/_static/minus.png deleted file mode 100644 index d96755f..0000000 Binary files a/docs/_static/minus.png and /dev/null differ diff --git a/docs/_static/plus.png b/docs/_static/plus.png deleted file mode 100644 index 7107cec..0000000 Binary files a/docs/_static/plus.png and /dev/null differ diff --git a/docs/_static/pygments.css b/docs/_static/pygments.css deleted file mode 100644 index 7547150..0000000 --- a/docs/_static/pygments.css +++ /dev/null @@ -1,255 +0,0 @@ -.highlight pre { line-height: 125%; } -.highlight td.linenos .normal { color: inherit; background-color: transparent; padding-left: 5px; padding-right: 5px; } -.highlight span.linenos { color: inherit; background-color: transparent; padding-left: 5px; padding-right: 5px; } -.highlight td.linenos .special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -.highlight span.linenos.special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -.highlight .hll { background-color: #ffffcc } -.highlight { background: #f8f8f8; } -.highlight .c { color: #8f5902; font-style: italic } /* Comment */ -.highlight .err { color: #a40000; border: 1px solid #ef2929 } /* Error */ -.highlight .g { color: #000000 } /* Generic */ -.highlight .k { color: #204a87; font-weight: bold } /* Keyword */ -.highlight .l { color: #000000 } /* Literal */ -.highlight .n { color: #000000 } /* Name */ -.highlight .o { color: #ce5c00; font-weight: bold } /* Operator */ -.highlight .x { color: #000000 } /* Other */ -.highlight .p { color: #000000; font-weight: bold } /* Punctuation */ -.highlight .ch { color: #8f5902; font-style: italic } /* Comment.Hashbang */ -.highlight .cm { color: #8f5902; font-style: italic } /* Comment.Multiline */ -.highlight .cp { color: #8f5902; font-style: italic } /* Comment.Preproc */ -.highlight .cpf { color: #8f5902; font-style: italic } /* Comment.PreprocFile */ -.highlight .c1 { color: #8f5902; font-style: italic } /* Comment.Single */ -.highlight .cs { color: #8f5902; font-style: italic } /* Comment.Special */ -.highlight .gd { color: #a40000 } /* Generic.Deleted */ -.highlight .ge { color: #000000; font-style: italic } /* Generic.Emph */ -.highlight .gr { color: #ef2929 } /* Generic.Error */ -.highlight .gh { color: #000080; font-weight: bold } /* Generic.Heading */ -.highlight .gi { color: #00A000 } /* Generic.Inserted */ -.highlight .go { color: #000000; font-style: italic } /* Generic.Output */ -.highlight .gp { color: #8f5902 } /* Generic.Prompt */ -.highlight .gs { color: #000000; font-weight: bold } /* Generic.Strong */ -.highlight .gu { color: #800080; font-weight: bold } /* Generic.Subheading */ -.highlight .gt { color: #a40000; font-weight: bold } /* Generic.Traceback */ -.highlight .kc { color: #204a87; font-weight: bold } /* Keyword.Constant */ -.highlight .kd { color: #204a87; font-weight: bold } /* Keyword.Declaration */ -.highlight .kn { color: #204a87; font-weight: bold } /* Keyword.Namespace */ -.highlight .kp { color: #204a87; font-weight: bold } /* Keyword.Pseudo */ -.highlight .kr { color: #204a87; font-weight: bold } /* Keyword.Reserved */ -.highlight .kt { color: #204a87; font-weight: bold } /* Keyword.Type */ -.highlight .ld { color: #000000 } /* Literal.Date */ -.highlight .m { color: #0000cf; font-weight: bold } /* Literal.Number */ -.highlight .s { color: #4e9a06 } /* Literal.String */ -.highlight .na { color: #c4a000 } /* Name.Attribute */ -.highlight .nb { color: #204a87 } /* Name.Builtin */ -.highlight .nc { color: #000000 } /* Name.Class */ -.highlight .no { color: #000000 } /* Name.Constant */ -.highlight .nd { color: #5c35cc; font-weight: bold } /* Name.Decorator */ -.highlight .ni { color: #ce5c00 } /* Name.Entity */ -.highlight .ne { color: #cc0000; font-weight: bold } /* Name.Exception */ -.highlight .nf { color: #000000 } /* Name.Function */ -.highlight .nl { color: #f57900 } /* Name.Label */ -.highlight .nn { color: #000000 } /* Name.Namespace */ -.highlight .nx { color: #000000 } /* Name.Other */ -.highlight .py { color: #000000 } /* Name.Property */ -.highlight .nt { color: #204a87; font-weight: bold } /* Name.Tag */ -.highlight .nv { color: #000000 } /* Name.Variable */ -.highlight .ow { color: #204a87; font-weight: bold } /* Operator.Word */ -.highlight .pm { color: #000000; font-weight: bold } /* Punctuation.Marker */ -.highlight .w { color: #f8f8f8 } /* Text.Whitespace */ -.highlight .mb { color: #0000cf; font-weight: bold } /* Literal.Number.Bin */ -.highlight .mf { color: #0000cf; font-weight: bold } /* Literal.Number.Float */ -.highlight .mh { color: #0000cf; font-weight: bold } /* Literal.Number.Hex */ -.highlight .mi { color: #0000cf; font-weight: bold } /* Literal.Number.Integer */ -.highlight .mo { color: #0000cf; font-weight: bold } /* Literal.Number.Oct */ -.highlight .sa { color: #4e9a06 } /* Literal.String.Affix */ -.highlight .sb { color: #4e9a06 } /* Literal.String.Backtick */ -.highlight .sc { color: #4e9a06 } /* Literal.String.Char */ -.highlight .dl { color: #4e9a06 } /* Literal.String.Delimiter */ -.highlight .sd { color: #8f5902; font-style: italic } /* Literal.String.Doc */ -.highlight .s2 { color: #4e9a06 } /* Literal.String.Double */ -.highlight .se { color: #4e9a06 } /* Literal.String.Escape */ -.highlight .sh { color: #4e9a06 } /* Literal.String.Heredoc */ -.highlight .si { color: #4e9a06 } /* Literal.String.Interpol */ -.highlight .sx { color: #4e9a06 } /* Literal.String.Other */ -.highlight .sr { color: #4e9a06 } /* Literal.String.Regex */ -.highlight .s1 { color: #4e9a06 } /* Literal.String.Single */ -.highlight .ss { color: #4e9a06 } /* Literal.String.Symbol */ -.highlight .bp { color: #3465a4 } /* Name.Builtin.Pseudo */ -.highlight .fm { color: #000000 } /* Name.Function.Magic */ -.highlight .vc { color: #000000 } /* Name.Variable.Class */ -.highlight .vg { color: #000000 } /* Name.Variable.Global */ -.highlight .vi { color: #000000 } /* Name.Variable.Instance */ -.highlight .vm { color: #000000 } /* Name.Variable.Magic */ -.highlight .il { color: #0000cf; font-weight: bold } /* Literal.Number.Integer.Long */ -@media not print { -body[data-theme="dark"] .highlight pre { line-height: 125%; } -body[data-theme="dark"] .highlight td.linenos .normal { color: #aaaaaa; background-color: transparent; padding-left: 5px; padding-right: 5px; } -body[data-theme="dark"] .highlight span.linenos { color: #aaaaaa; background-color: transparent; padding-left: 5px; padding-right: 5px; } -body[data-theme="dark"] .highlight td.linenos .special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -body[data-theme="dark"] .highlight span.linenos.special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -body[data-theme="dark"] .highlight .hll { background-color: #404040 } -body[data-theme="dark"] .highlight { background: #202020; color: #d0d0d0 } -body[data-theme="dark"] .highlight .c { color: #ababab; font-style: italic } /* Comment */ -body[data-theme="dark"] .highlight .err { color: #a61717; background-color: #e3d2d2 } /* Error */ -body[data-theme="dark"] .highlight .esc { color: #d0d0d0 } /* Escape */ -body[data-theme="dark"] .highlight .g { color: #d0d0d0 } /* Generic */ -body[data-theme="dark"] .highlight .k { color: #6ebf26; font-weight: bold } /* Keyword */ -body[data-theme="dark"] .highlight .l { color: #d0d0d0 } /* Literal */ -body[data-theme="dark"] .highlight .n { color: #d0d0d0 } /* Name */ -body[data-theme="dark"] .highlight .o { color: #d0d0d0 } /* Operator */ -body[data-theme="dark"] .highlight .x { color: #d0d0d0 } /* Other */ -body[data-theme="dark"] .highlight .p { color: #d0d0d0 } /* Punctuation */ -body[data-theme="dark"] .highlight .ch { color: #ababab; font-style: italic } /* Comment.Hashbang */ -body[data-theme="dark"] .highlight .cm { color: #ababab; font-style: italic } /* Comment.Multiline */ -body[data-theme="dark"] .highlight .cp { color: #cd2828; font-weight: bold } /* Comment.Preproc */ -body[data-theme="dark"] .highlight .cpf { color: #ababab; font-style: italic } /* Comment.PreprocFile */ -body[data-theme="dark"] .highlight .c1 { color: #ababab; font-style: italic } /* Comment.Single */ -body[data-theme="dark"] .highlight .cs { color: #e50808; font-weight: bold; background-color: #520000 } /* Comment.Special */ -body[data-theme="dark"] .highlight .gd { color: #d22323 } /* Generic.Deleted */ -body[data-theme="dark"] .highlight .ge { color: #d0d0d0; font-style: italic } /* Generic.Emph */ -body[data-theme="dark"] .highlight .gr { color: #d22323 } /* Generic.Error */ -body[data-theme="dark"] .highlight .gh { color: #ffffff; font-weight: bold } /* Generic.Heading */ -body[data-theme="dark"] .highlight .gi { color: #589819 } /* Generic.Inserted */ -body[data-theme="dark"] .highlight .go { color: #cccccc } /* Generic.Output */ -body[data-theme="dark"] .highlight .gp { color: #aaaaaa } /* Generic.Prompt */ -body[data-theme="dark"] .highlight .gs { color: #d0d0d0; font-weight: bold } /* Generic.Strong */ -body[data-theme="dark"] .highlight .gu { color: #ffffff; text-decoration: underline } /* Generic.Subheading */ -body[data-theme="dark"] .highlight .gt { color: #d22323 } /* Generic.Traceback */ -body[data-theme="dark"] .highlight .kc { color: #6ebf26; font-weight: bold } /* Keyword.Constant */ -body[data-theme="dark"] .highlight .kd { color: #6ebf26; font-weight: bold } /* Keyword.Declaration */ -body[data-theme="dark"] .highlight .kn { color: #6ebf26; font-weight: bold } /* Keyword.Namespace */ -body[data-theme="dark"] .highlight .kp { color: #6ebf26 } /* Keyword.Pseudo */ -body[data-theme="dark"] .highlight .kr { color: #6ebf26; font-weight: bold } /* Keyword.Reserved */ -body[data-theme="dark"] .highlight .kt { color: #6ebf26; font-weight: bold } /* Keyword.Type */ -body[data-theme="dark"] .highlight .ld { color: #d0d0d0 } /* Literal.Date */ -body[data-theme="dark"] .highlight .m { color: #51b2fd } /* Literal.Number */ -body[data-theme="dark"] .highlight .s { color: #ed9d13 } /* Literal.String */ -body[data-theme="dark"] .highlight .na { color: #bbbbbb } /* Name.Attribute */ -body[data-theme="dark"] .highlight .nb { color: #2fbccd } /* Name.Builtin */ -body[data-theme="dark"] .highlight .nc { color: #71adff; text-decoration: underline } /* Name.Class */ -body[data-theme="dark"] .highlight .no { color: #40ffff } /* Name.Constant */ -body[data-theme="dark"] .highlight .nd { color: #ffa500 } /* Name.Decorator */ -body[data-theme="dark"] .highlight .ni { color: #d0d0d0 } /* Name.Entity */ -body[data-theme="dark"] .highlight .ne { color: #bbbbbb } /* Name.Exception */ -body[data-theme="dark"] .highlight .nf { color: #71adff } /* Name.Function */ -body[data-theme="dark"] .highlight .nl { color: #d0d0d0 } /* Name.Label */ -body[data-theme="dark"] .highlight .nn { color: #71adff; text-decoration: underline } /* Name.Namespace */ -body[data-theme="dark"] .highlight .nx { color: #d0d0d0 } /* Name.Other */ -body[data-theme="dark"] .highlight .py { color: #d0d0d0 } /* Name.Property */ -body[data-theme="dark"] .highlight .nt { color: #6ebf26; font-weight: bold } /* Name.Tag */ -body[data-theme="dark"] .highlight .nv { color: #40ffff } /* Name.Variable */ -body[data-theme="dark"] .highlight .ow { color: #6ebf26; font-weight: bold } /* Operator.Word */ -body[data-theme="dark"] .highlight .pm { color: #d0d0d0 } /* Punctuation.Marker */ -body[data-theme="dark"] .highlight .w { color: #666666 } /* Text.Whitespace */ -body[data-theme="dark"] .highlight .mb { color: #51b2fd } /* Literal.Number.Bin */ -body[data-theme="dark"] .highlight .mf { color: #51b2fd } /* Literal.Number.Float */ -body[data-theme="dark"] .highlight .mh { color: #51b2fd } /* Literal.Number.Hex */ -body[data-theme="dark"] .highlight .mi { color: #51b2fd } /* Literal.Number.Integer */ -body[data-theme="dark"] .highlight .mo { color: #51b2fd } /* Literal.Number.Oct */ -body[data-theme="dark"] .highlight .sa { color: #ed9d13 } /* Literal.String.Affix */ -body[data-theme="dark"] .highlight .sb { color: #ed9d13 } /* Literal.String.Backtick */ -body[data-theme="dark"] .highlight .sc { color: #ed9d13 } /* Literal.String.Char */ -body[data-theme="dark"] .highlight .dl { color: #ed9d13 } /* Literal.String.Delimiter */ -body[data-theme="dark"] .highlight .sd { color: #ed9d13 } /* Literal.String.Doc */ -body[data-theme="dark"] .highlight .s2 { color: #ed9d13 } /* Literal.String.Double */ -body[data-theme="dark"] .highlight .se { color: #ed9d13 } /* Literal.String.Escape */ -body[data-theme="dark"] .highlight .sh { color: #ed9d13 } /* Literal.String.Heredoc */ -body[data-theme="dark"] .highlight .si { color: #ed9d13 } /* Literal.String.Interpol */ -body[data-theme="dark"] .highlight .sx { color: #ffa500 } /* Literal.String.Other */ -body[data-theme="dark"] .highlight .sr { color: #ed9d13 } /* Literal.String.Regex */ -body[data-theme="dark"] .highlight .s1 { color: #ed9d13 } /* Literal.String.Single */ -body[data-theme="dark"] .highlight .ss { color: #ed9d13 } /* Literal.String.Symbol */ -body[data-theme="dark"] .highlight .bp { color: #2fbccd } /* Name.Builtin.Pseudo */ -body[data-theme="dark"] .highlight .fm { color: #71adff } /* Name.Function.Magic */ -body[data-theme="dark"] .highlight .vc { color: #40ffff } /* Name.Variable.Class */ -body[data-theme="dark"] .highlight .vg { color: #40ffff } /* Name.Variable.Global */ -body[data-theme="dark"] .highlight .vi { color: #40ffff } /* Name.Variable.Instance */ -body[data-theme="dark"] .highlight .vm { color: #40ffff } /* Name.Variable.Magic */ -body[data-theme="dark"] .highlight .il { color: #51b2fd } /* Literal.Number.Integer.Long */ -@media (prefers-color-scheme: dark) { -body:not([data-theme="light"]) .highlight pre { line-height: 125%; } -body:not([data-theme="light"]) .highlight td.linenos .normal { color: #aaaaaa; background-color: transparent; padding-left: 5px; padding-right: 5px; } -body:not([data-theme="light"]) .highlight span.linenos { color: #aaaaaa; background-color: transparent; padding-left: 5px; padding-right: 5px; } -body:not([data-theme="light"]) .highlight td.linenos .special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -body:not([data-theme="light"]) .highlight span.linenos.special { color: #000000; background-color: #ffffc0; padding-left: 5px; padding-right: 5px; } -body:not([data-theme="light"]) .highlight .hll { background-color: #404040 } -body:not([data-theme="light"]) .highlight { background: #202020; color: #d0d0d0 } -body:not([data-theme="light"]) .highlight .c { color: #ababab; font-style: italic } /* Comment */ -body:not([data-theme="light"]) .highlight .err { color: #a61717; background-color: #e3d2d2 } /* Error */ -body:not([data-theme="light"]) .highlight .esc { color: #d0d0d0 } /* Escape */ -body:not([data-theme="light"]) .highlight .g { color: #d0d0d0 } /* Generic */ -body:not([data-theme="light"]) .highlight .k { color: #6ebf26; font-weight: bold } /* Keyword */ -body:not([data-theme="light"]) .highlight .l { color: #d0d0d0 } /* Literal */ -body:not([data-theme="light"]) .highlight .n { color: #d0d0d0 } /* Name */ -body:not([data-theme="light"]) .highlight .o { color: #d0d0d0 } /* Operator */ -body:not([data-theme="light"]) .highlight .x { color: #d0d0d0 } /* Other */ -body:not([data-theme="light"]) .highlight .p { color: #d0d0d0 } /* Punctuation */ -body:not([data-theme="light"]) .highlight .ch { color: #ababab; font-style: italic } /* Comment.Hashbang */ -body:not([data-theme="light"]) .highlight .cm { color: #ababab; font-style: italic } /* Comment.Multiline */ -body:not([data-theme="light"]) .highlight .cp { color: #cd2828; font-weight: bold } /* Comment.Preproc */ -body:not([data-theme="light"]) .highlight .cpf { color: #ababab; font-style: italic } /* Comment.PreprocFile */ -body:not([data-theme="light"]) .highlight .c1 { color: #ababab; font-style: italic } /* Comment.Single */ -body:not([data-theme="light"]) .highlight .cs { color: #e50808; font-weight: bold; background-color: #520000 } /* Comment.Special */ -body:not([data-theme="light"]) .highlight .gd { color: #d22323 } /* Generic.Deleted */ -body:not([data-theme="light"]) .highlight .ge { color: #d0d0d0; font-style: italic } /* Generic.Emph */ -body:not([data-theme="light"]) .highlight .gr { color: #d22323 } /* Generic.Error */ -body:not([data-theme="light"]) .highlight .gh { color: #ffffff; font-weight: bold } /* Generic.Heading */ -body:not([data-theme="light"]) .highlight .gi { color: #589819 } /* Generic.Inserted */ -body:not([data-theme="light"]) .highlight .go { color: #cccccc } /* Generic.Output */ -body:not([data-theme="light"]) .highlight .gp { color: #aaaaaa } /* Generic.Prompt */ -body:not([data-theme="light"]) .highlight .gs { color: #d0d0d0; font-weight: bold } /* Generic.Strong */ -body:not([data-theme="light"]) .highlight .gu { color: #ffffff; text-decoration: underline } /* Generic.Subheading */ -body:not([data-theme="light"]) .highlight .gt { color: #d22323 } /* Generic.Traceback */ -body:not([data-theme="light"]) .highlight .kc { color: #6ebf26; font-weight: bold } /* Keyword.Constant */ -body:not([data-theme="light"]) .highlight .kd { color: #6ebf26; font-weight: bold } /* Keyword.Declaration */ -body:not([data-theme="light"]) .highlight .kn { color: #6ebf26; font-weight: bold } /* Keyword.Namespace */ -body:not([data-theme="light"]) .highlight .kp { color: #6ebf26 } /* Keyword.Pseudo */ -body:not([data-theme="light"]) .highlight .kr { color: #6ebf26; font-weight: bold } /* Keyword.Reserved */ -body:not([data-theme="light"]) .highlight .kt { color: #6ebf26; font-weight: bold } /* Keyword.Type */ -body:not([data-theme="light"]) .highlight .ld { color: #d0d0d0 } /* Literal.Date */ -body:not([data-theme="light"]) .highlight .m { color: #51b2fd } /* Literal.Number */ -body:not([data-theme="light"]) .highlight .s { color: #ed9d13 } /* Literal.String */ -body:not([data-theme="light"]) .highlight .na { color: #bbbbbb } /* Name.Attribute */ -body:not([data-theme="light"]) .highlight .nb { color: #2fbccd } /* Name.Builtin */ -body:not([data-theme="light"]) .highlight .nc { color: #71adff; text-decoration: underline } /* Name.Class */ -body:not([data-theme="light"]) .highlight .no { color: #40ffff } /* Name.Constant */ -body:not([data-theme="light"]) .highlight .nd { color: #ffa500 } /* Name.Decorator */ -body:not([data-theme="light"]) .highlight .ni { color: #d0d0d0 } /* Name.Entity */ -body:not([data-theme="light"]) .highlight .ne { color: #bbbbbb } /* Name.Exception */ -body:not([data-theme="light"]) .highlight .nf { color: #71adff } /* Name.Function */ -body:not([data-theme="light"]) .highlight .nl { color: #d0d0d0 } /* Name.Label */ -body:not([data-theme="light"]) .highlight .nn { color: #71adff; text-decoration: underline } /* Name.Namespace */ -body:not([data-theme="light"]) .highlight .nx { color: #d0d0d0 } /* Name.Other */ -body:not([data-theme="light"]) .highlight .py { color: #d0d0d0 } /* Name.Property */ -body:not([data-theme="light"]) .highlight .nt { color: #6ebf26; font-weight: bold } /* Name.Tag */ -body:not([data-theme="light"]) .highlight .nv { color: #40ffff } /* Name.Variable */ -body:not([data-theme="light"]) .highlight .ow { color: #6ebf26; font-weight: bold } /* Operator.Word */ -body:not([data-theme="light"]) .highlight .pm { color: #d0d0d0 } /* Punctuation.Marker */ -body:not([data-theme="light"]) .highlight .w { color: #666666 } /* Text.Whitespace */ -body:not([data-theme="light"]) .highlight .mb { color: #51b2fd } /* Literal.Number.Bin */ -body:not([data-theme="light"]) .highlight .mf { color: #51b2fd } /* Literal.Number.Float */ -body:not([data-theme="light"]) .highlight .mh { color: #51b2fd } /* Literal.Number.Hex */ -body:not([data-theme="light"]) .highlight .mi { color: #51b2fd } /* Literal.Number.Integer */ -body:not([data-theme="light"]) .highlight .mo { color: #51b2fd } /* Literal.Number.Oct */ -body:not([data-theme="light"]) .highlight .sa { color: #ed9d13 } /* Literal.String.Affix */ -body:not([data-theme="light"]) .highlight .sb { color: #ed9d13 } /* Literal.String.Backtick */ -body:not([data-theme="light"]) .highlight .sc { color: #ed9d13 } /* Literal.String.Char */ -body:not([data-theme="light"]) .highlight .dl { color: #ed9d13 } /* Literal.String.Delimiter */ -body:not([data-theme="light"]) .highlight .sd { color: #ed9d13 } /* Literal.String.Doc */ -body:not([data-theme="light"]) .highlight .s2 { color: #ed9d13 } /* Literal.String.Double */ -body:not([data-theme="light"]) .highlight .se { color: #ed9d13 } /* Literal.String.Escape */ -body:not([data-theme="light"]) .highlight .sh { color: #ed9d13 } /* Literal.String.Heredoc */ -body:not([data-theme="light"]) .highlight .si { color: #ed9d13 } /* Literal.String.Interpol */ -body:not([data-theme="light"]) .highlight .sx { color: #ffa500 } /* Literal.String.Other */ -body:not([data-theme="light"]) .highlight .sr { color: #ed9d13 } /* Literal.String.Regex */ -body:not([data-theme="light"]) .highlight .s1 { color: #ed9d13 } /* Literal.String.Single */ -body:not([data-theme="light"]) .highlight .ss { color: #ed9d13 } /* Literal.String.Symbol */ -body:not([data-theme="light"]) .highlight .bp { color: #2fbccd } /* Name.Builtin.Pseudo */ -body:not([data-theme="light"]) .highlight .fm { color: #71adff } /* Name.Function.Magic */ -body:not([data-theme="light"]) .highlight .vc { color: #40ffff } /* Name.Variable.Class */ -body:not([data-theme="light"]) .highlight .vg { color: #40ffff } /* Name.Variable.Global */ -body:not([data-theme="light"]) .highlight .vi { color: #40ffff } /* Name.Variable.Instance */ -body:not([data-theme="light"]) .highlight .vm { color: #40ffff } /* Name.Variable.Magic */ -body:not([data-theme="light"]) .highlight .il { color: #51b2fd } /* Literal.Number.Integer.Long */ -} -} \ No newline at end of file diff --git a/docs/_static/scripts/furo-extensions.js b/docs/_static/scripts/furo-extensions.js deleted file mode 100644 index e69de29..0000000 diff --git a/docs/_static/scripts/furo.js b/docs/_static/scripts/furo.js deleted file mode 100644 index cbf6487..0000000 --- a/docs/_static/scripts/furo.js +++ /dev/null @@ -1,3 +0,0 @@ -/*! For license information please see furo.js.LICENSE.txt */ -(()=>{var t={212:function(t,e,n){var o,r;r=void 0!==n.g?n.g:"undefined"!=typeof window?window:this,o=function(){return function(t){"use strict";var e={navClass:"active",contentClass:"active",nested:!1,nestedClass:"active",offset:0,reflow:!1,events:!0},n=function(t,e,n){if(n.settings.events){var o=new CustomEvent(t,{bubbles:!0,cancelable:!0,detail:n});e.dispatchEvent(o)}},o=function(t){var e=0;if(t.offsetParent)for(;t;)e+=t.offsetTop,t=t.offsetParent;return e>=0?e:0},r=function(t){t&&t.sort((function(t,e){return o(t.content)=Math.max(document.body.scrollHeight,document.documentElement.scrollHeight,document.body.offsetHeight,document.documentElement.offsetHeight,document.body.clientHeight,document.documentElement.clientHeight)},l=function(t,e){var n=t[t.length-1];if(function(t,e){return!(!s()||!c(t.content,e,!0))}(n,e))return n;for(var o=t.length-1;o>=0;o--)if(c(t[o].content,e))return t[o]},a=function(t,e){if(e.nested&&t.parentNode){var n=t.parentNode.closest("li");n&&(n.classList.remove(e.nestedClass),a(n,e))}},i=function(t,e){if(t){var o=t.nav.closest("li");o&&(o.classList.remove(e.navClass),t.content.classList.remove(e.contentClass),a(o,e),n("gumshoeDeactivate",o,{link:t.nav,content:t.content,settings:e}))}},u=function(t,e){if(e.nested){var n=t.parentNode.closest("li");n&&(n.classList.add(e.nestedClass),u(n,e))}};return function(o,c){var s,a,d,f,m,v={setup:function(){s=document.querySelectorAll(o),a=[],Array.prototype.forEach.call(s,(function(t){var e=document.getElementById(decodeURIComponent(t.hash.substr(1)));e&&a.push({nav:t,content:e})})),r(a)},detect:function(){var t=l(a,m);t?d&&t.content===d.content||(i(d,m),function(t,e){if(t){var o=t.nav.closest("li");o&&(o.classList.add(e.navClass),t.content.classList.add(e.contentClass),u(o,e),n("gumshoeActivate",o,{link:t.nav,content:t.content,settings:e}))}}(t,m),d=t):d&&(i(d,m),d=null)}},h=function(e){f&&t.cancelAnimationFrame(f),f=t.requestAnimationFrame(v.detect)},g=function(e){f&&t.cancelAnimationFrame(f),f=t.requestAnimationFrame((function(){r(a),v.detect()}))};return v.destroy=function(){d&&i(d,m),t.removeEventListener("scroll",h,!1),m.reflow&&t.removeEventListener("resize",g,!1),a=null,s=null,d=null,f=null,m=null},m=function(){var t={};return Array.prototype.forEach.call(arguments,(function(e){for(var n in e){if(!e.hasOwnProperty(n))return;t[n]=e[n]}})),t}(e,c||{}),v.setup(),v.detect(),t.addEventListener("scroll",h,!1),m.reflow&&t.addEventListener("resize",g,!1),v}}(r)}.apply(e,[]),void 0===o||(t.exports=o)}},e={};function n(o){var r=e[o];if(void 0!==r)return r.exports;var c=e[o]={exports:{}};return t[o].call(c.exports,c,c.exports,n),c.exports}n.n=t=>{var e=t&&t.__esModule?()=>t.default:()=>t;return n.d(e,{a:e}),e},n.d=(t,e)=>{for(var o in e)n.o(e,o)&&!n.o(t,o)&&Object.defineProperty(t,o,{enumerable:!0,get:e[o]})},n.g=function(){if("object"==typeof globalThis)return globalThis;try{return this||new Function("return this")()}catch(t){if("object"==typeof window)return window}}(),n.o=(t,e)=>Object.prototype.hasOwnProperty.call(t,e),(()=>{"use strict";var t=n(212),e=n.n(t),o=null,r=null,c=window.pageYOffset||document.documentElement.scrollTop;function s(){const t=localStorage.getItem("theme")||"auto";var e;"light"!==(e=window.matchMedia("(prefers-color-scheme: dark)").matches?"auto"===t?"light":"light"==t?"dark":"auto":"auto"===t?"dark":"dark"==t?"light":"auto")&&"dark"!==e&&"auto"!==e&&(console.error(`Got invalid theme mode: ${e}. Resetting to auto.`),e="auto"),document.body.dataset.theme=e,localStorage.setItem("theme",e),console.log(`Changed to ${e} mode.`)}function l(){!function(){const t=document.getElementsByClassName("theme-toggle");Array.from(t).forEach((t=>{t.addEventListener("click",s)}))}(),function(){let t=0,e=!1;window.addEventListener("scroll",(function(n){t=window.scrollY,e||(window.requestAnimationFrame((function(){var n;n=t,0==Math.floor(r.getBoundingClientRect().top)?r.classList.add("scrolled"):r.classList.remove("scrolled"),function(t){t<64?document.documentElement.classList.remove("show-back-to-top"):tc&&document.documentElement.classList.remove("show-back-to-top"),c=t}(n),function(t){null!==o&&(0==t?o.scrollTo(0,0):Math.ceil(t)>=Math.floor(document.documentElement.scrollHeight-window.innerHeight)?o.scrollTo(0,o.scrollHeight):document.querySelector(".scroll-current"))}(n),e=!1})),e=!0)})),window.scroll()}(),null!==o&&new(e())(".toc-tree a",{reflow:!0,recursive:!0,navClass:"scroll-current",offset:()=>{let t=parseFloat(getComputedStyle(document.documentElement).fontSize);return r.getBoundingClientRect().height+.5*t+1}})}document.addEventListener("DOMContentLoaded",(function(){document.body.parentNode.classList.remove("no-js"),r=document.querySelector("header"),o=document.querySelector(".toc-scroll"),l()}))})()})(); -//# sourceMappingURL=furo.js.map \ No newline at end of file diff --git a/docs/_static/scripts/furo.js.LICENSE.txt b/docs/_static/scripts/furo.js.LICENSE.txt deleted file mode 100644 index 1632189..0000000 --- a/docs/_static/scripts/furo.js.LICENSE.txt +++ /dev/null @@ -1,7 +0,0 @@ -/*! - * gumshoejs v5.1.2 (patched by @pradyunsg) - * A simple, framework-agnostic scrollspy script. - * (c) 2019 Chris Ferdinandi - * MIT License - * http://github.com/cferdinandi/gumshoe - */ diff --git a/docs/_static/scripts/furo.js.map b/docs/_static/scripts/furo.js.map deleted file mode 100644 index 7ed2be8..0000000 --- a/docs/_static/scripts/furo.js.map +++ /dev/null @@ -1 +0,0 @@ -{"version":3,"file":"scripts/furo.js","mappings":";iCAAA,MAQWA,SAWS,IAAX,EAAAC,EACH,EAAAA,EACkB,oBAAXC,OACPA,OACAC,KAbS,EAAF,WACP,OAaJ,SAAUD,GACR,aAMA,IAAIE,EAAW,CAEbC,SAAU,SACVC,aAAc,SAGdC,QAAQ,EACRC,YAAa,SAGbC,OAAQ,EACRC,QAAQ,EAGRC,QAAQ,GA6BNC,EAAY,SAAUC,EAAMC,EAAMC,GAEpC,GAAKA,EAAOC,SAASL,OAArB,CAGA,IAAIM,EAAQ,IAAIC,YAAYL,EAAM,CAChCM,SAAS,EACTC,YAAY,EACZL,OAAQA,IAIVD,EAAKO,cAAcJ,KAQjBK,EAAe,SAAUR,GAC3B,IAAIS,EAAW,EACf,GAAIT,EAAKU,aACP,KAAOV,GACLS,GAAYT,EAAKW,UACjBX,EAAOA,EAAKU,aAGhB,OAAOD,GAAY,EAAIA,EAAW,GAOhCG,EAAe,SAAUC,GACvBA,GACFA,EAASC,MAAK,SAAUC,EAAOC,GAG7B,OAFcR,EAAaO,EAAME,SACnBT,EAAaQ,EAAMC,UACF,EACxB,MA2CTC,EAAW,SAAUlB,EAAME,EAAUiB,GACvC,IAAIC,EAASpB,EAAKqB,wBACd1B,EAnCU,SAAUO,GAExB,MAA+B,mBAApBA,EAASP,OACX2B,WAAWpB,EAASP,UAItB2B,WAAWpB,EAASP,QA4Bd4B,CAAUrB,GACvB,OAAIiB,EAEAK,SAASJ,EAAOD,OAAQ,KACvB/B,EAAOqC,aAAeC,SAASC,gBAAgBC,cAG7CJ,SAASJ,EAAOS,IAAK,KAAOlC,GAOjCmC,EAAa,WACf,OACEC,KAAKC,KAAK5C,EAAOqC,YAAcrC,EAAO6C,cAnCjCF,KAAKG,IACVR,SAASS,KAAKC,aACdV,SAASC,gBAAgBS,aACzBV,SAASS,KAAKE,aACdX,SAASC,gBAAgBU,aACzBX,SAASS,KAAKP,aACdF,SAASC,gBAAgBC,eAqDzBU,EAAY,SAAUzB,EAAUX,GAClC,IAAIqC,EAAO1B,EAASA,EAAS2B,OAAS,GACtC,GAbgB,SAAUC,EAAMvC,GAChC,SAAI4B,MAAgBZ,EAASuB,EAAKxB,QAASf,GAAU,IAYjDwC,CAAYH,EAAMrC,GAAW,OAAOqC,EACxC,IAAK,IAAII,EAAI9B,EAAS2B,OAAS,EAAGG,GAAK,EAAGA,IACxC,GAAIzB,EAASL,EAAS8B,GAAG1B,QAASf,GAAW,OAAOW,EAAS8B,IAS7DC,EAAmB,SAAUC,EAAK3C,GAEpC,GAAKA,EAAST,QAAWoD,EAAIC,WAA7B,CAGA,IAAIC,EAAKF,EAAIC,WAAWE,QAAQ,MAC3BD,IAGLA,EAAGE,UAAUC,OAAOhD,EAASR,aAG7BkD,EAAiBG,EAAI7C,MAQnBiD,EAAa,SAAUC,EAAOlD,GAEhC,GAAKkD,EAAL,CAGA,IAAIL,EAAKK,EAAMP,IAAIG,QAAQ,MACtBD,IAGLA,EAAGE,UAAUC,OAAOhD,EAASX,UAC7B6D,EAAMnC,QAAQgC,UAAUC,OAAOhD,EAASV,cAGxCoD,EAAiBG,EAAI7C,GAGrBJ,EAAU,oBAAqBiD,EAAI,CACjCM,KAAMD,EAAMP,IACZ5B,QAASmC,EAAMnC,QACff,SAAUA,OASVoD,EAAiB,SAAUT,EAAK3C,GAElC,GAAKA,EAAST,OAAd,CAGA,IAAIsD,EAAKF,EAAIC,WAAWE,QAAQ,MAC3BD,IAGLA,EAAGE,UAAUM,IAAIrD,EAASR,aAG1B4D,EAAeP,EAAI7C,MA8LrB,OA1JkB,SAAUsD,EAAUC,GAKpC,IACIC,EAAU7C,EAAU8C,EAASC,EAAS1D,EADtC2D,EAAa,CAUjBA,MAAmB,WAEjBH,EAAWhC,SAASoC,iBAAiBN,GAGrC3C,EAAW,GAGXkD,MAAMC,UAAUC,QAAQC,KAAKR,GAAU,SAAUjB,GAE/C,IAAIxB,EAAUS,SAASyC,eACrBC,mBAAmB3B,EAAK4B,KAAKC,OAAO,KAEjCrD,GAGLJ,EAAS0D,KAAK,CACZ1B,IAAKJ,EACLxB,QAASA,OAKbL,EAAaC,IAMfgD,OAAoB,WAElB,IAAIW,EAASlC,EAAUzB,EAAUX,GAG5BsE,EASDb,GAAWa,EAAOvD,UAAY0C,EAAQ1C,UAG1CkC,EAAWQ,EAASzD,GAzFT,SAAUkD,EAAOlD,GAE9B,GAAKkD,EAAL,CAGA,IAAIL,EAAKK,EAAMP,IAAIG,QAAQ,MACtBD,IAGLA,EAAGE,UAAUM,IAAIrD,EAASX,UAC1B6D,EAAMnC,QAAQgC,UAAUM,IAAIrD,EAASV,cAGrC8D,EAAeP,EAAI7C,GAGnBJ,EAAU,kBAAmBiD,EAAI,CAC/BM,KAAMD,EAAMP,IACZ5B,QAASmC,EAAMnC,QACff,SAAUA,MAuEVuE,CAASD,EAAQtE,GAGjByD,EAAUa,GAfJb,IACFR,EAAWQ,EAASzD,GACpByD,EAAU,QAoBZe,EAAgB,SAAUvE,GAExByD,GACFxE,EAAOuF,qBAAqBf,GAI9BA,EAAUxE,EAAOwF,sBAAsBf,EAAWgB,SAOhDC,EAAgB,SAAU3E,GAExByD,GACFxE,EAAOuF,qBAAqBf,GAI9BA,EAAUxE,EAAOwF,uBAAsB,WACrChE,EAAaC,GACbgD,EAAWgB,aAoDf,OA7CAhB,EAAWkB,QAAU,WAEfpB,GACFR,EAAWQ,EAASzD,GAItBd,EAAO4F,oBAAoB,SAAUN,GAAe,GAChDxE,EAASN,QACXR,EAAO4F,oBAAoB,SAAUF,GAAe,GAItDjE,EAAW,KACX6C,EAAW,KACXC,EAAU,KACVC,EAAU,KACV1D,EAAW,MAQXA,EA3XS,WACX,IAAI+E,EAAS,GAOb,OANAlB,MAAMC,UAAUC,QAAQC,KAAKgB,WAAW,SAAUC,GAChD,IAAK,IAAIC,KAAOD,EAAK,CACnB,IAAKA,EAAIE,eAAeD,GAAM,OAC9BH,EAAOG,GAAOD,EAAIC,OAGfH,EAmXMK,CAAOhG,EAAUmE,GAAW,IAGvCI,EAAW0B,QAGX1B,EAAWgB,SAGXzF,EAAOoG,iBAAiB,SAAUd,GAAe,GAC7CxE,EAASN,QACXR,EAAOoG,iBAAiB,SAAUV,GAAe,GAS9CjB,GA7bA4B,CAAQvG,IAChB,QAFM,SAEN,uBCXDwG,EAA2B,GAG/B,SAASC,EAAoBC,GAE5B,IAAIC,EAAeH,EAAyBE,GAC5C,QAAqBE,IAAjBD,EACH,OAAOA,EAAaE,QAGrB,IAAIC,EAASN,EAAyBE,GAAY,CAGjDG,QAAS,IAOV,OAHAE,EAAoBL,GAAU1B,KAAK8B,EAAOD,QAASC,EAAQA,EAAOD,QAASJ,GAGpEK,EAAOD,QCpBfJ,EAAoBO,EAAKF,IACxB,IAAIG,EAASH,GAAUA,EAAOI,WAC7B,IAAOJ,EAAiB,QACxB,IAAM,EAEP,OADAL,EAAoBU,EAAEF,EAAQ,CAAEG,EAAGH,IAC5BA,GCLRR,EAAoBU,EAAI,CAACN,EAASQ,KACjC,IAAI,IAAInB,KAAOmB,EACXZ,EAAoBa,EAAED,EAAYnB,KAASO,EAAoBa,EAAET,EAASX,IAC5EqB,OAAOC,eAAeX,EAASX,EAAK,CAAEuB,YAAY,EAAMC,IAAKL,EAAWnB,MCJ3EO,EAAoBxG,EAAI,WACvB,GAA0B,iBAAf0H,WAAyB,OAAOA,WAC3C,IACC,OAAOxH,MAAQ,IAAIyH,SAAS,cAAb,GACd,MAAOC,GACR,GAAsB,iBAAX3H,OAAqB,OAAOA,QALjB,GCAxBuG,EAAoBa,EAAI,CAACrB,EAAK6B,IAAUP,OAAOzC,UAAUqB,eAAenB,KAAKiB,EAAK6B,4CCK9EC,EAAY,KACZC,EAAS,KACTC,EAAgB/H,OAAO6C,aAAeP,SAASC,gBAAgByF,UA4EnE,SAASC,IACP,MAAMC,EAAeC,aAAaC,QAAQ,UAAY,OAZxD,IAAkBC,EACH,WADGA,EAaIrI,OAAOsI,WAAW,gCAAgCC,QAI/C,SAAjBL,EACO,QACgB,SAAhBA,EACA,OAEA,OAIU,SAAjBA,EACO,OACgB,QAAhBA,EACA,QAEA,SA9BoB,SAATG,GAA4B,SAATA,IACzCG,QAAQC,MAAM,2BAA2BJ,yBACzCA,EAAO,QAGT/F,SAASS,KAAK2F,QAAQC,MAAQN,EAC9BF,aAAaS,QAAQ,QAASP,GAC9BG,QAAQK,IAAI,cAAcR,WA4E5B,SAASlC,KART,WAEE,MAAM2C,EAAUxG,SAASyG,uBAAuB,gBAChDpE,MAAMqE,KAAKF,GAASjE,SAASoE,IAC3BA,EAAI7C,iBAAiB,QAAS6B,MAKhCiB,GA9CF,WAEE,IAAIC,EAA6B,EAC7BC,GAAU,EAEdpJ,OAAOoG,iBAAiB,UAAU,SAAUuB,GAC1CwB,EAA6BnJ,OAAOqJ,QAE/BD,IACHpJ,OAAOwF,uBAAsB,WAzDnC,IAAuB8D,IA0DDH,EA9GkC,GAAlDxG,KAAK4G,MAAMzB,EAAO7F,wBAAwBQ,KAC5CqF,EAAOjE,UAAUM,IAAI,YAErB2D,EAAOjE,UAAUC,OAAO,YAI5B,SAAmCwF,GAC7BA,EAXmB,GAYrBhH,SAASC,gBAAgBsB,UAAUC,OAAO,oBAEtCwF,EAAYvB,EACdzF,SAASC,gBAAgBsB,UAAUM,IAAI,oBAC9BmF,EAAYvB,GACrBzF,SAASC,gBAAgBsB,UAAUC,OAAO,oBAG9CiE,EAAgBuB,EAqChBE,CAA0BF,GAlC5B,SAA6BA,GACT,OAAdzB,IAKa,GAAbyB,EACFzB,EAAU4B,SAAS,EAAG,GAGtB9G,KAAKC,KAAK0G,IACV3G,KAAK4G,MAAMjH,SAASC,gBAAgBS,aAAehD,OAAOqC,aAE1DwF,EAAU4B,SAAS,EAAG5B,EAAU7E,cAGhBV,SAASoH,cAAc,oBAmBzCC,CAAoBL,GAwDdF,GAAU,KAGZA,GAAU,MAGdpJ,OAAO4J,SA8BPC,GA1BkB,OAAdhC,GAKJ,IAAI,IAAJ,CAAY,cAAe,CACzBrH,QAAQ,EACRsJ,WAAW,EACX3J,SAAU,iBACVI,OAAQ,KACN,IAAIwJ,EAAM7H,WAAW8H,iBAAiB1H,SAASC,iBAAiB0H,UAChE,OAAOnC,EAAO7F,wBAAwBiI,OAAS,GAAMH,EAAM,KA+BjEzH,SAAS8D,iBAAiB,oBAT1B,WACE9D,SAASS,KAAKW,WAAWG,UAAUC,OAAO,SAE1CgE,EAASxF,SAASoH,cAAc,UAChC7B,EAAYvF,SAASoH,cAAc,eAEnCvD","sources":["webpack:///./src/furo/assets/scripts/gumshoe-patched.js","webpack:///webpack/bootstrap","webpack:///webpack/runtime/compat get default export","webpack:///webpack/runtime/define property getters","webpack:///webpack/runtime/global","webpack:///webpack/runtime/hasOwnProperty shorthand","webpack:///./src/furo/assets/scripts/furo.js"],"sourcesContent":["/*!\n * gumshoejs v5.1.2 (patched by @pradyunsg)\n * A simple, framework-agnostic scrollspy script.\n * (c) 2019 Chris Ferdinandi\n * MIT License\n * http://github.com/cferdinandi/gumshoe\n */\n\n(function (root, factory) {\n if (typeof define === \"function\" && define.amd) {\n define([], function () {\n return factory(root);\n });\n } else if (typeof exports === \"object\") {\n module.exports = factory(root);\n } else {\n root.Gumshoe = factory(root);\n }\n})(\n typeof global !== \"undefined\"\n ? global\n : typeof window !== \"undefined\"\n ? window\n : this,\n function (window) {\n \"use strict\";\n\n //\n // Defaults\n //\n\n var defaults = {\n // Active classes\n navClass: \"active\",\n contentClass: \"active\",\n\n // Nested navigation\n nested: false,\n nestedClass: \"active\",\n\n // Offset & reflow\n offset: 0,\n reflow: false,\n\n // Event support\n events: true,\n };\n\n //\n // Methods\n //\n\n /**\n * Merge two or more objects together.\n * @param {Object} objects The objects to merge together\n * @returns {Object} Merged values of defaults and options\n */\n var extend = function () {\n var merged = {};\n Array.prototype.forEach.call(arguments, function (obj) {\n for (var key in obj) {\n if (!obj.hasOwnProperty(key)) return;\n merged[key] = obj[key];\n }\n });\n return merged;\n };\n\n /**\n * Emit a custom event\n * @param {String} type The event type\n * @param {Node} elem The element to attach the event to\n * @param {Object} detail Any details to pass along with the event\n */\n var emitEvent = function (type, elem, detail) {\n // Make sure events are enabled\n if (!detail.settings.events) return;\n\n // Create a new event\n var event = new CustomEvent(type, {\n bubbles: true,\n cancelable: true,\n detail: detail,\n });\n\n // Dispatch the event\n elem.dispatchEvent(event);\n };\n\n /**\n * Get an element's distance from the top of the Document.\n * @param {Node} elem The element\n * @return {Number} Distance from the top in pixels\n */\n var getOffsetTop = function (elem) {\n var location = 0;\n if (elem.offsetParent) {\n while (elem) {\n location += elem.offsetTop;\n elem = elem.offsetParent;\n }\n }\n return location >= 0 ? location : 0;\n };\n\n /**\n * Sort content from first to last in the DOM\n * @param {Array} contents The content areas\n */\n var sortContents = function (contents) {\n if (contents) {\n contents.sort(function (item1, item2) {\n var offset1 = getOffsetTop(item1.content);\n var offset2 = getOffsetTop(item2.content);\n if (offset1 < offset2) return -1;\n return 1;\n });\n }\n };\n\n /**\n * Get the offset to use for calculating position\n * @param {Object} settings The settings for this instantiation\n * @return {Float} The number of pixels to offset the calculations\n */\n var getOffset = function (settings) {\n // if the offset is a function run it\n if (typeof settings.offset === \"function\") {\n return parseFloat(settings.offset());\n }\n\n // Otherwise, return it as-is\n return parseFloat(settings.offset);\n };\n\n /**\n * Get the document element's height\n * @private\n * @returns {Number}\n */\n var getDocumentHeight = function () {\n return Math.max(\n document.body.scrollHeight,\n document.documentElement.scrollHeight,\n document.body.offsetHeight,\n document.documentElement.offsetHeight,\n document.body.clientHeight,\n document.documentElement.clientHeight,\n );\n };\n\n /**\n * Determine if an element is in view\n * @param {Node} elem The element\n * @param {Object} settings The settings for this instantiation\n * @param {Boolean} bottom If true, check if element is above bottom of viewport instead\n * @return {Boolean} Returns true if element is in the viewport\n */\n var isInView = function (elem, settings, bottom) {\n var bounds = elem.getBoundingClientRect();\n var offset = getOffset(settings);\n if (bottom) {\n return (\n parseInt(bounds.bottom, 10) <\n (window.innerHeight || document.documentElement.clientHeight)\n );\n }\n return parseInt(bounds.top, 10) <= offset;\n };\n\n /**\n * Check if at the bottom of the viewport\n * @return {Boolean} If true, page is at the bottom of the viewport\n */\n var isAtBottom = function () {\n if (\n Math.ceil(window.innerHeight + window.pageYOffset) >=\n getDocumentHeight()\n )\n return true;\n return false;\n };\n\n /**\n * Check if the last item should be used (even if not at the top of the page)\n * @param {Object} item The last item\n * @param {Object} settings The settings for this instantiation\n * @return {Boolean} If true, use the last item\n */\n var useLastItem = function (item, settings) {\n if (isAtBottom() && isInView(item.content, settings, true)) return true;\n return false;\n };\n\n /**\n * Get the active content\n * @param {Array} contents The content areas\n * @param {Object} settings The settings for this instantiation\n * @return {Object} The content area and matching navigation link\n */\n var getActive = function (contents, settings) {\n var last = contents[contents.length - 1];\n if (useLastItem(last, settings)) return last;\n for (var i = contents.length - 1; i >= 0; i--) {\n if (isInView(contents[i].content, settings)) return contents[i];\n }\n };\n\n /**\n * Deactivate parent navs in a nested navigation\n * @param {Node} nav The starting navigation element\n * @param {Object} settings The settings for this instantiation\n */\n var deactivateNested = function (nav, settings) {\n // If nesting isn't activated, bail\n if (!settings.nested || !nav.parentNode) return;\n\n // Get the parent navigation\n var li = nav.parentNode.closest(\"li\");\n if (!li) return;\n\n // Remove the active class\n li.classList.remove(settings.nestedClass);\n\n // Apply recursively to any parent navigation elements\n deactivateNested(li, settings);\n };\n\n /**\n * Deactivate a nav and content area\n * @param {Object} items The nav item and content to deactivate\n * @param {Object} settings The settings for this instantiation\n */\n var deactivate = function (items, settings) {\n // Make sure there are items to deactivate\n if (!items) return;\n\n // Get the parent list item\n var li = items.nav.closest(\"li\");\n if (!li) return;\n\n // Remove the active class from the nav and content\n li.classList.remove(settings.navClass);\n items.content.classList.remove(settings.contentClass);\n\n // Deactivate any parent navs in a nested navigation\n deactivateNested(li, settings);\n\n // Emit a custom event\n emitEvent(\"gumshoeDeactivate\", li, {\n link: items.nav,\n content: items.content,\n settings: settings,\n });\n };\n\n /**\n * Activate parent navs in a nested navigation\n * @param {Node} nav The starting navigation element\n * @param {Object} settings The settings for this instantiation\n */\n var activateNested = function (nav, settings) {\n // If nesting isn't activated, bail\n if (!settings.nested) return;\n\n // Get the parent navigation\n var li = nav.parentNode.closest(\"li\");\n if (!li) return;\n\n // Add the active class\n li.classList.add(settings.nestedClass);\n\n // Apply recursively to any parent navigation elements\n activateNested(li, settings);\n };\n\n /**\n * Activate a nav and content area\n * @param {Object} items The nav item and content to activate\n * @param {Object} settings The settings for this instantiation\n */\n var activate = function (items, settings) {\n // Make sure there are items to activate\n if (!items) return;\n\n // Get the parent list item\n var li = items.nav.closest(\"li\");\n if (!li) return;\n\n // Add the active class to the nav and content\n li.classList.add(settings.navClass);\n items.content.classList.add(settings.contentClass);\n\n // Activate any parent navs in a nested navigation\n activateNested(li, settings);\n\n // Emit a custom event\n emitEvent(\"gumshoeActivate\", li, {\n link: items.nav,\n content: items.content,\n settings: settings,\n });\n };\n\n /**\n * Create the Constructor object\n * @param {String} selector The selector to use for navigation items\n * @param {Object} options User options and settings\n */\n var Constructor = function (selector, options) {\n //\n // Variables\n //\n\n var publicAPIs = {};\n var navItems, contents, current, timeout, settings;\n\n //\n // Methods\n //\n\n /**\n * Set variables from DOM elements\n */\n publicAPIs.setup = function () {\n // Get all nav items\n navItems = document.querySelectorAll(selector);\n\n // Create contents array\n contents = [];\n\n // Loop through each item, get it's matching content, and push to the array\n Array.prototype.forEach.call(navItems, function (item) {\n // Get the content for the nav item\n var content = document.getElementById(\n decodeURIComponent(item.hash.substr(1)),\n );\n if (!content) return;\n\n // Push to the contents array\n contents.push({\n nav: item,\n content: content,\n });\n });\n\n // Sort contents by the order they appear in the DOM\n sortContents(contents);\n };\n\n /**\n * Detect which content is currently active\n */\n publicAPIs.detect = function () {\n // Get the active content\n var active = getActive(contents, settings);\n\n // if there's no active content, deactivate and bail\n if (!active) {\n if (current) {\n deactivate(current, settings);\n current = null;\n }\n return;\n }\n\n // If the active content is the one currently active, do nothing\n if (current && active.content === current.content) return;\n\n // Deactivate the current content and activate the new content\n deactivate(current, settings);\n activate(active, settings);\n\n // Update the currently active content\n current = active;\n };\n\n /**\n * Detect the active content on scroll\n * Debounced for performance\n */\n var scrollHandler = function (event) {\n // If there's a timer, cancel it\n if (timeout) {\n window.cancelAnimationFrame(timeout);\n }\n\n // Setup debounce callback\n timeout = window.requestAnimationFrame(publicAPIs.detect);\n };\n\n /**\n * Update content sorting on resize\n * Debounced for performance\n */\n var resizeHandler = function (event) {\n // If there's a timer, cancel it\n if (timeout) {\n window.cancelAnimationFrame(timeout);\n }\n\n // Setup debounce callback\n timeout = window.requestAnimationFrame(function () {\n sortContents(contents);\n publicAPIs.detect();\n });\n };\n\n /**\n * Destroy the current instantiation\n */\n publicAPIs.destroy = function () {\n // Undo DOM changes\n if (current) {\n deactivate(current, settings);\n }\n\n // Remove event listeners\n window.removeEventListener(\"scroll\", scrollHandler, false);\n if (settings.reflow) {\n window.removeEventListener(\"resize\", resizeHandler, false);\n }\n\n // Reset variables\n contents = null;\n navItems = null;\n current = null;\n timeout = null;\n settings = null;\n };\n\n /**\n * Initialize the current instantiation\n */\n var init = function () {\n // Merge user options into defaults\n settings = extend(defaults, options || {});\n\n // Setup variables based on the current DOM\n publicAPIs.setup();\n\n // Find the currently active content\n publicAPIs.detect();\n\n // Setup event listeners\n window.addEventListener(\"scroll\", scrollHandler, false);\n if (settings.reflow) {\n window.addEventListener(\"resize\", resizeHandler, false);\n }\n };\n\n //\n // Initialize and return the public APIs\n //\n\n init();\n return publicAPIs;\n };\n\n //\n // Return the Constructor\n //\n\n return Constructor;\n },\n);\n","// The module cache\nvar __webpack_module_cache__ = {};\n\n// The require function\nfunction __webpack_require__(moduleId) {\n\t// Check if module is in cache\n\tvar cachedModule = __webpack_module_cache__[moduleId];\n\tif (cachedModule !== undefined) {\n\t\treturn cachedModule.exports;\n\t}\n\t// Create a new module (and put it into the cache)\n\tvar module = __webpack_module_cache__[moduleId] = {\n\t\t// no module.id needed\n\t\t// no module.loaded needed\n\t\texports: {}\n\t};\n\n\t// Execute the module function\n\t__webpack_modules__[moduleId].call(module.exports, module, module.exports, __webpack_require__);\n\n\t// Return the exports of the module\n\treturn module.exports;\n}\n\n","// getDefaultExport function for compatibility with non-harmony modules\n__webpack_require__.n = (module) => {\n\tvar getter = module && module.__esModule ?\n\t\t() => (module['default']) :\n\t\t() => (module);\n\t__webpack_require__.d(getter, { a: getter });\n\treturn getter;\n};","// define getter functions for harmony exports\n__webpack_require__.d = (exports, definition) => {\n\tfor(var key in definition) {\n\t\tif(__webpack_require__.o(definition, key) && !__webpack_require__.o(exports, key)) {\n\t\t\tObject.defineProperty(exports, key, { enumerable: true, get: definition[key] });\n\t\t}\n\t}\n};","__webpack_require__.g = (function() {\n\tif (typeof globalThis === 'object') return globalThis;\n\ttry {\n\t\treturn this || new Function('return this')();\n\t} catch (e) {\n\t\tif (typeof window === 'object') return window;\n\t}\n})();","__webpack_require__.o = (obj, prop) => (Object.prototype.hasOwnProperty.call(obj, prop))","import Gumshoe from \"./gumshoe-patched.js\";\n\n////////////////////////////////////////////////////////////////////////////////\n// Scroll Handling\n////////////////////////////////////////////////////////////////////////////////\nvar tocScroll = null;\nvar header = null;\nvar lastScrollTop = window.pageYOffset || document.documentElement.scrollTop;\nconst GO_TO_TOP_OFFSET = 64;\n\nfunction scrollHandlerForHeader() {\n if (Math.floor(header.getBoundingClientRect().top) == 0) {\n header.classList.add(\"scrolled\");\n } else {\n header.classList.remove(\"scrolled\");\n }\n}\n\nfunction scrollHandlerForBackToTop(positionY) {\n if (positionY < GO_TO_TOP_OFFSET) {\n document.documentElement.classList.remove(\"show-back-to-top\");\n } else {\n if (positionY < lastScrollTop) {\n document.documentElement.classList.add(\"show-back-to-top\");\n } else if (positionY > lastScrollTop) {\n document.documentElement.classList.remove(\"show-back-to-top\");\n }\n }\n lastScrollTop = positionY;\n}\n\nfunction scrollHandlerForTOC(positionY) {\n if (tocScroll === null) {\n return;\n }\n\n // top of page.\n if (positionY == 0) {\n tocScroll.scrollTo(0, 0);\n } else if (\n // bottom of page.\n Math.ceil(positionY) >=\n Math.floor(document.documentElement.scrollHeight - window.innerHeight)\n ) {\n tocScroll.scrollTo(0, tocScroll.scrollHeight);\n } else {\n // somewhere in the middle.\n const current = document.querySelector(\".scroll-current\");\n if (current == null) {\n return;\n }\n\n // https://github.com/pypa/pip/issues/9159 This breaks scroll behaviours.\n // // scroll the currently \"active\" heading in toc, into view.\n // const rect = current.getBoundingClientRect();\n // if (0 > rect.top) {\n // current.scrollIntoView(true); // the argument is \"alignTop\"\n // } else if (rect.bottom > window.innerHeight) {\n // current.scrollIntoView(false);\n // }\n }\n}\n\nfunction scrollHandler(positionY) {\n scrollHandlerForHeader();\n scrollHandlerForBackToTop(positionY);\n scrollHandlerForTOC(positionY);\n}\n\n////////////////////////////////////////////////////////////////////////////////\n// Theme Toggle\n////////////////////////////////////////////////////////////////////////////////\nfunction setTheme(mode) {\n if (mode !== \"light\" && mode !== \"dark\" && mode !== \"auto\") {\n console.error(`Got invalid theme mode: ${mode}. Resetting to auto.`);\n mode = \"auto\";\n }\n\n document.body.dataset.theme = mode;\n localStorage.setItem(\"theme\", mode);\n console.log(`Changed to ${mode} mode.`);\n}\n\nfunction cycleThemeOnce() {\n const currentTheme = localStorage.getItem(\"theme\") || \"auto\";\n const prefersDark = window.matchMedia(\"(prefers-color-scheme: dark)\").matches;\n\n if (prefersDark) {\n // Auto (dark) -> Light -> Dark\n if (currentTheme === \"auto\") {\n setTheme(\"light\");\n } else if (currentTheme == \"light\") {\n setTheme(\"dark\");\n } else {\n setTheme(\"auto\");\n }\n } else {\n // Auto (light) -> Dark -> Light\n if (currentTheme === \"auto\") {\n setTheme(\"dark\");\n } else if (currentTheme == \"dark\") {\n setTheme(\"light\");\n } else {\n setTheme(\"auto\");\n }\n }\n}\n\n////////////////////////////////////////////////////////////////////////////////\n// Setup\n////////////////////////////////////////////////////////////////////////////////\nfunction setupScrollHandler() {\n // Taken from https://developer.mozilla.org/en-US/docs/Web/API/Document/scroll_event\n let last_known_scroll_position = 0;\n let ticking = false;\n\n window.addEventListener(\"scroll\", function (e) {\n last_known_scroll_position = window.scrollY;\n\n if (!ticking) {\n window.requestAnimationFrame(function () {\n scrollHandler(last_known_scroll_position);\n ticking = false;\n });\n\n ticking = true;\n }\n });\n window.scroll();\n}\n\nfunction setupScrollSpy() {\n if (tocScroll === null) {\n return;\n }\n\n // Scrollspy -- highlight table on contents, based on scroll\n new Gumshoe(\".toc-tree a\", {\n reflow: true,\n recursive: true,\n navClass: \"scroll-current\",\n offset: () => {\n let rem = parseFloat(getComputedStyle(document.documentElement).fontSize);\n return header.getBoundingClientRect().height + 0.5 * rem + 1;\n },\n });\n}\n\nfunction setupTheme() {\n // Attach event handlers for toggling themes\n const buttons = document.getElementsByClassName(\"theme-toggle\");\n Array.from(buttons).forEach((btn) => {\n btn.addEventListener(\"click\", cycleThemeOnce);\n });\n}\n\nfunction setup() {\n setupTheme();\n setupScrollHandler();\n setupScrollSpy();\n}\n\n////////////////////////////////////////////////////////////////////////////////\n// Main entrypoint\n////////////////////////////////////////////////////////////////////////////////\nfunction main() {\n document.body.parentNode.classList.remove(\"no-js\");\n\n header = document.querySelector(\"header\");\n tocScroll = document.querySelector(\".toc-scroll\");\n\n setup();\n}\n\ndocument.addEventListener(\"DOMContentLoaded\", main);\n"],"names":["root","g","window","this","defaults","navClass","contentClass","nested","nestedClass","offset","reflow","events","emitEvent","type","elem","detail","settings","event","CustomEvent","bubbles","cancelable","dispatchEvent","getOffsetTop","location","offsetParent","offsetTop","sortContents","contents","sort","item1","item2","content","isInView","bottom","bounds","getBoundingClientRect","parseFloat","getOffset","parseInt","innerHeight","document","documentElement","clientHeight","top","isAtBottom","Math","ceil","pageYOffset","max","body","scrollHeight","offsetHeight","getActive","last","length","item","useLastItem","i","deactivateNested","nav","parentNode","li","closest","classList","remove","deactivate","items","link","activateNested","add","selector","options","navItems","current","timeout","publicAPIs","querySelectorAll","Array","prototype","forEach","call","getElementById","decodeURIComponent","hash","substr","push","active","activate","scrollHandler","cancelAnimationFrame","requestAnimationFrame","detect","resizeHandler","destroy","removeEventListener","merged","arguments","obj","key","hasOwnProperty","extend","setup","addEventListener","factory","__webpack_module_cache__","__webpack_require__","moduleId","cachedModule","undefined","exports","module","__webpack_modules__","n","getter","__esModule","d","a","definition","o","Object","defineProperty","enumerable","get","globalThis","Function","e","prop","tocScroll","header","lastScrollTop","scrollTop","cycleThemeOnce","currentTheme","localStorage","getItem","mode","matchMedia","matches","console","error","dataset","theme","setItem","log","buttons","getElementsByClassName","from","btn","setupTheme","last_known_scroll_position","ticking","scrollY","positionY","floor","scrollHandlerForBackToTop","scrollTo","querySelector","scrollHandlerForTOC","scroll","setupScrollHandler","recursive","rem","getComputedStyle","fontSize","height"],"sourceRoot":""} \ No newline at end of file diff --git a/docs/_static/searchtools.js b/docs/_static/searchtools.js deleted file mode 100644 index 97d56a7..0000000 --- a/docs/_static/searchtools.js +++ /dev/null @@ -1,566 +0,0 @@ -/* - * searchtools.js - * ~~~~~~~~~~~~~~~~ - * - * Sphinx JavaScript utilities for the full-text search. - * - * :copyright: Copyright 2007-2023 by the Sphinx team, see AUTHORS. - * :license: BSD, see LICENSE for details. - * - */ -"use strict"; - -/** - * Simple result scoring code. - */ -if (typeof Scorer === "undefined") { - var Scorer = { - // Implement the following function to further tweak the score for each result - // The function takes a result array [docname, title, anchor, descr, score, filename] - // and returns the new score. - /* - score: result => { - const [docname, title, anchor, descr, score, filename] = result - return score - }, - */ - - // query matches the full name of an object - objNameMatch: 11, - // or matches in the last dotted part of the object name - objPartialMatch: 6, - // Additive scores depending on the priority of the object - objPrio: { - 0: 15, // used to be importantResults - 1: 5, // used to be objectResults - 2: -5, // used to be unimportantResults - }, - // Used when the priority is not in the mapping. - objPrioDefault: 0, - - // query found in title - title: 15, - partialTitle: 7, - // query found in terms - term: 5, - partialTerm: 2, - }; -} - -const _removeChildren = (element) => { - while (element && element.lastChild) element.removeChild(element.lastChild); -}; - -/** - * See https://developer.mozilla.org/en-US/docs/Web/JavaScript/Guide/Regular_Expressions#escaping - */ -const _escapeRegExp = (string) => - string.replace(/[.*+\-?^${}()|[\]\\]/g, "\\$&"); // $& means the whole matched string - -const _displayItem = (item, searchTerms) => { - const docBuilder = DOCUMENTATION_OPTIONS.BUILDER; - const docUrlRoot = DOCUMENTATION_OPTIONS.URL_ROOT; - const docFileSuffix = DOCUMENTATION_OPTIONS.FILE_SUFFIX; - const docLinkSuffix = DOCUMENTATION_OPTIONS.LINK_SUFFIX; - const showSearchSummary = DOCUMENTATION_OPTIONS.SHOW_SEARCH_SUMMARY; - - const [docName, title, anchor, descr, score, _filename] = item; - - let listItem = document.createElement("li"); - let requestUrl; - let linkUrl; - if (docBuilder === "dirhtml") { - // dirhtml builder - let dirname = docName + "/"; - if (dirname.match(/\/index\/$/)) - dirname = dirname.substring(0, dirname.length - 6); - else if (dirname === "index/") dirname = ""; - requestUrl = docUrlRoot + dirname; - linkUrl = requestUrl; - } else { - // normal html builders - requestUrl = docUrlRoot + docName + docFileSuffix; - linkUrl = docName + docLinkSuffix; - } - let linkEl = listItem.appendChild(document.createElement("a")); - linkEl.href = linkUrl + anchor; - linkEl.dataset.score = score; - linkEl.innerHTML = title; - if (descr) - listItem.appendChild(document.createElement("span")).innerHTML = - " (" + descr + ")"; - else if (showSearchSummary) - fetch(requestUrl) - .then((responseData) => responseData.text()) - .then((data) => { - if (data) - listItem.appendChild( - Search.makeSearchSummary(data, searchTerms) - ); - }); - Search.output.appendChild(listItem); -}; -const _finishSearch = (resultCount) => { - Search.stopPulse(); - Search.title.innerText = _("Search Results"); - if (!resultCount) - Search.status.innerText = Documentation.gettext( - "Your search did not match any documents. Please make sure that all words are spelled correctly and that you've selected enough categories." - ); - else - Search.status.innerText = _( - `Search finished, found ${resultCount} page(s) matching the search query.` - ); -}; -const _displayNextItem = ( - results, - resultCount, - searchTerms -) => { - // results left, load the summary and display it - // this is intended to be dynamic (don't sub resultsCount) - if (results.length) { - _displayItem(results.pop(), searchTerms); - setTimeout( - () => _displayNextItem(results, resultCount, searchTerms), - 5 - ); - } - // search finished, update title and status message - else _finishSearch(resultCount); -}; - -/** - * Default splitQuery function. Can be overridden in ``sphinx.search`` with a - * custom function per language. - * - * The regular expression works by splitting the string on consecutive characters - * that are not Unicode letters, numbers, underscores, or emoji characters. - * This is the same as ``\W+`` in Python, preserving the surrogate pair area. - */ -if (typeof splitQuery === "undefined") { - var splitQuery = (query) => query - .split(/[^\p{Letter}\p{Number}_\p{Emoji_Presentation}]+/gu) - .filter(term => term) // remove remaining empty strings -} - -/** - * Search Module - */ -const Search = { - _index: null, - _queued_query: null, - _pulse_status: -1, - - htmlToText: (htmlString) => { - const htmlElement = new DOMParser().parseFromString(htmlString, 'text/html'); - htmlElement.querySelectorAll(".headerlink").forEach((el) => { el.remove() }); - const docContent = htmlElement.querySelector('[role="main"]'); - if (docContent !== undefined) return docContent.textContent; - console.warn( - "Content block not found. Sphinx search tries to obtain it via '[role=main]'. Could you check your theme or template." - ); - return ""; - }, - - init: () => { - const query = new URLSearchParams(window.location.search).get("q"); - document - .querySelectorAll('input[name="q"]') - .forEach((el) => (el.value = query)); - if (query) Search.performSearch(query); - }, - - loadIndex: (url) => - (document.body.appendChild(document.createElement("script")).src = url), - - setIndex: (index) => { - Search._index = index; - if (Search._queued_query !== null) { - const query = Search._queued_query; - Search._queued_query = null; - Search.query(query); - } - }, - - hasIndex: () => Search._index !== null, - - deferQuery: (query) => (Search._queued_query = query), - - stopPulse: () => (Search._pulse_status = -1), - - startPulse: () => { - if (Search._pulse_status >= 0) return; - - const pulse = () => { - Search._pulse_status = (Search._pulse_status + 1) % 4; - Search.dots.innerText = ".".repeat(Search._pulse_status); - if (Search._pulse_status >= 0) window.setTimeout(pulse, 500); - }; - pulse(); - }, - - /** - * perform a search for something (or wait until index is loaded) - */ - performSearch: (query) => { - // create the required interface elements - const searchText = document.createElement("h2"); - searchText.textContent = _("Searching"); - const searchSummary = document.createElement("p"); - searchSummary.classList.add("search-summary"); - searchSummary.innerText = ""; - const searchList = document.createElement("ul"); - searchList.classList.add("search"); - - const out = document.getElementById("search-results"); - Search.title = out.appendChild(searchText); - Search.dots = Search.title.appendChild(document.createElement("span")); - Search.status = out.appendChild(searchSummary); - Search.output = out.appendChild(searchList); - - const searchProgress = document.getElementById("search-progress"); - // Some themes don't use the search progress node - if (searchProgress) { - searchProgress.innerText = _("Preparing search..."); - } - Search.startPulse(); - - // index already loaded, the browser was quick! - if (Search.hasIndex()) Search.query(query); - else Search.deferQuery(query); - }, - - /** - * execute search (requires search index to be loaded) - */ - query: (query) => { - const filenames = Search._index.filenames; - const docNames = Search._index.docnames; - const titles = Search._index.titles; - const allTitles = Search._index.alltitles; - const indexEntries = Search._index.indexentries; - - // stem the search terms and add them to the correct list - const stemmer = new Stemmer(); - const searchTerms = new Set(); - const excludedTerms = new Set(); - const highlightTerms = new Set(); - const objectTerms = new Set(splitQuery(query.toLowerCase().trim())); - splitQuery(query.trim()).forEach((queryTerm) => { - const queryTermLower = queryTerm.toLowerCase(); - - // maybe skip this "word" - // stopwords array is from language_data.js - if ( - stopwords.indexOf(queryTermLower) !== -1 || - queryTerm.match(/^\d+$/) - ) - return; - - // stem the word - let word = stemmer.stemWord(queryTermLower); - // select the correct list - if (word[0] === "-") excludedTerms.add(word.substr(1)); - else { - searchTerms.add(word); - highlightTerms.add(queryTermLower); - } - }); - - if (SPHINX_HIGHLIGHT_ENABLED) { // set in sphinx_highlight.js - localStorage.setItem("sphinx_highlight_terms", [...highlightTerms].join(" ")) - } - - // console.debug("SEARCH: searching for:"); - // console.info("required: ", [...searchTerms]); - // console.info("excluded: ", [...excludedTerms]); - - // array of [docname, title, anchor, descr, score, filename] - let results = []; - _removeChildren(document.getElementById("search-progress")); - - const queryLower = query.toLowerCase(); - for (const [title, foundTitles] of Object.entries(allTitles)) { - if (title.toLowerCase().includes(queryLower) && (queryLower.length >= title.length/2)) { - for (const [file, id] of foundTitles) { - let score = Math.round(100 * queryLower.length / title.length) - results.push([ - docNames[file], - titles[file] !== title ? `${titles[file]} > ${title}` : title, - id !== null ? "#" + id : "", - null, - score, - filenames[file], - ]); - } - } - } - - // search for explicit entries in index directives - for (const [entry, foundEntries] of Object.entries(indexEntries)) { - if (entry.includes(queryLower) && (queryLower.length >= entry.length/2)) { - for (const [file, id] of foundEntries) { - let score = Math.round(100 * queryLower.length / entry.length) - results.push([ - docNames[file], - titles[file], - id ? "#" + id : "", - null, - score, - filenames[file], - ]); - } - } - } - - // lookup as object - objectTerms.forEach((term) => - results.push(...Search.performObjectSearch(term, objectTerms)) - ); - - // lookup as search terms in fulltext - results.push(...Search.performTermsSearch(searchTerms, excludedTerms)); - - // let the scorer override scores with a custom scoring function - if (Scorer.score) results.forEach((item) => (item[4] = Scorer.score(item))); - - // now sort the results by score (in opposite order of appearance, since the - // display function below uses pop() to retrieve items) and then - // alphabetically - results.sort((a, b) => { - const leftScore = a[4]; - const rightScore = b[4]; - if (leftScore === rightScore) { - // same score: sort alphabetically - const leftTitle = a[1].toLowerCase(); - const rightTitle = b[1].toLowerCase(); - if (leftTitle === rightTitle) return 0; - return leftTitle > rightTitle ? -1 : 1; // inverted is intentional - } - return leftScore > rightScore ? 1 : -1; - }); - - // remove duplicate search results - // note the reversing of results, so that in the case of duplicates, the highest-scoring entry is kept - let seen = new Set(); - results = results.reverse().reduce((acc, result) => { - let resultStr = result.slice(0, 4).concat([result[5]]).map(v => String(v)).join(','); - if (!seen.has(resultStr)) { - acc.push(result); - seen.add(resultStr); - } - return acc; - }, []); - - results = results.reverse(); - - // for debugging - //Search.lastresults = results.slice(); // a copy - // console.info("search results:", Search.lastresults); - - // print the results - _displayNextItem(results, results.length, searchTerms); - }, - - /** - * search for object names - */ - performObjectSearch: (object, objectTerms) => { - const filenames = Search._index.filenames; - const docNames = Search._index.docnames; - const objects = Search._index.objects; - const objNames = Search._index.objnames; - const titles = Search._index.titles; - - const results = []; - - const objectSearchCallback = (prefix, match) => { - const name = match[4] - const fullname = (prefix ? prefix + "." : "") + name; - const fullnameLower = fullname.toLowerCase(); - if (fullnameLower.indexOf(object) < 0) return; - - let score = 0; - const parts = fullnameLower.split("."); - - // check for different match types: exact matches of full name or - // "last name" (i.e. last dotted part) - if (fullnameLower === object || parts.slice(-1)[0] === object) - score += Scorer.objNameMatch; - else if (parts.slice(-1)[0].indexOf(object) > -1) - score += Scorer.objPartialMatch; // matches in last name - - const objName = objNames[match[1]][2]; - const title = titles[match[0]]; - - // If more than one term searched for, we require other words to be - // found in the name/title/description - const otherTerms = new Set(objectTerms); - otherTerms.delete(object); - if (otherTerms.size > 0) { - const haystack = `${prefix} ${name} ${objName} ${title}`.toLowerCase(); - if ( - [...otherTerms].some((otherTerm) => haystack.indexOf(otherTerm) < 0) - ) - return; - } - - let anchor = match[3]; - if (anchor === "") anchor = fullname; - else if (anchor === "-") anchor = objNames[match[1]][1] + "-" + fullname; - - const descr = objName + _(", in ") + title; - - // add custom score for some objects according to scorer - if (Scorer.objPrio.hasOwnProperty(match[2])) - score += Scorer.objPrio[match[2]]; - else score += Scorer.objPrioDefault; - - results.push([ - docNames[match[0]], - fullname, - "#" + anchor, - descr, - score, - filenames[match[0]], - ]); - }; - Object.keys(objects).forEach((prefix) => - objects[prefix].forEach((array) => - objectSearchCallback(prefix, array) - ) - ); - return results; - }, - - /** - * search for full-text terms in the index - */ - performTermsSearch: (searchTerms, excludedTerms) => { - // prepare search - const terms = Search._index.terms; - const titleTerms = Search._index.titleterms; - const filenames = Search._index.filenames; - const docNames = Search._index.docnames; - const titles = Search._index.titles; - - const scoreMap = new Map(); - const fileMap = new Map(); - - // perform the search on the required terms - searchTerms.forEach((word) => { - const files = []; - const arr = [ - { files: terms[word], score: Scorer.term }, - { files: titleTerms[word], score: Scorer.title }, - ]; - // add support for partial matches - if (word.length > 2) { - const escapedWord = _escapeRegExp(word); - Object.keys(terms).forEach((term) => { - if (term.match(escapedWord) && !terms[word]) - arr.push({ files: terms[term], score: Scorer.partialTerm }); - }); - Object.keys(titleTerms).forEach((term) => { - if (term.match(escapedWord) && !titleTerms[word]) - arr.push({ files: titleTerms[word], score: Scorer.partialTitle }); - }); - } - - // no match but word was a required one - if (arr.every((record) => record.files === undefined)) return; - - // found search word in contents - arr.forEach((record) => { - if (record.files === undefined) return; - - let recordFiles = record.files; - if (recordFiles.length === undefined) recordFiles = [recordFiles]; - files.push(...recordFiles); - - // set score for the word in each file - recordFiles.forEach((file) => { - if (!scoreMap.has(file)) scoreMap.set(file, {}); - scoreMap.get(file)[word] = record.score; - }); - }); - - // create the mapping - files.forEach((file) => { - if (fileMap.has(file) && fileMap.get(file).indexOf(word) === -1) - fileMap.get(file).push(word); - else fileMap.set(file, [word]); - }); - }); - - // now check if the files don't contain excluded terms - const results = []; - for (const [file, wordList] of fileMap) { - // check if all requirements are matched - - // as search terms with length < 3 are discarded - const filteredTermCount = [...searchTerms].filter( - (term) => term.length > 2 - ).length; - if ( - wordList.length !== searchTerms.size && - wordList.length !== filteredTermCount - ) - continue; - - // ensure that none of the excluded terms is in the search result - if ( - [...excludedTerms].some( - (term) => - terms[term] === file || - titleTerms[term] === file || - (terms[term] || []).includes(file) || - (titleTerms[term] || []).includes(file) - ) - ) - break; - - // select one (max) score for the file. - const score = Math.max(...wordList.map((w) => scoreMap.get(file)[w])); - // add result to the result list - results.push([ - docNames[file], - titles[file], - "", - null, - score, - filenames[file], - ]); - } - return results; - }, - - /** - * helper function to return a node containing the - * search summary for a given text. keywords is a list - * of stemmed words. - */ - makeSearchSummary: (htmlText, keywords) => { - const text = Search.htmlToText(htmlText); - if (text === "") return null; - - const textLower = text.toLowerCase(); - const actualStartPosition = [...keywords] - .map((k) => textLower.indexOf(k.toLowerCase())) - .filter((i) => i > -1) - .slice(-1)[0]; - const startWithContext = Math.max(actualStartPosition - 120, 0); - - const top = startWithContext === 0 ? "" : "..."; - const tail = startWithContext + 240 < text.length ? "..." : ""; - - let summary = document.createElement("p"); - summary.classList.add("context"); - summary.textContent = top + text.substr(startWithContext, 240).trim() + tail; - - return summary; - }, -}; - -_ready(Search.init); diff --git a/docs/_static/skeleton.css b/docs/_static/skeleton.css deleted file mode 100644 index 467c878..0000000 --- a/docs/_static/skeleton.css +++ /dev/null @@ -1,296 +0,0 @@ -/* Some sane resets. */ -html { - height: 100%; -} - -body { - margin: 0; - min-height: 100%; -} - -/* All the flexbox magic! */ -body, -.sb-announcement, -.sb-content, -.sb-main, -.sb-container, -.sb-container__inner, -.sb-article-container, -.sb-footer-content, -.sb-header, -.sb-header-secondary, -.sb-footer { - display: flex; -} - -/* These order things vertically */ -body, -.sb-main, -.sb-article-container { - flex-direction: column; -} - -/* Put elements in the center */ -.sb-header, -.sb-header-secondary, -.sb-container, -.sb-content, -.sb-footer, -.sb-footer-content { - justify-content: center; -} -/* Put elements at the ends */ -.sb-article-container { - justify-content: space-between; -} - -/* These elements grow. */ -.sb-main, -.sb-content, -.sb-container, -article { - flex-grow: 1; -} - -/* Because padding making this wider is not fun */ -article { - box-sizing: border-box; -} - -/* The announcements element should never be wider than the page. */ -.sb-announcement { - max-width: 100%; -} - -.sb-sidebar-primary, -.sb-sidebar-secondary { - flex-shrink: 0; - width: 17rem; -} - -.sb-announcement__inner { - justify-content: center; - - box-sizing: border-box; - height: 3rem; - - overflow-x: auto; - white-space: nowrap; -} - -/* Sidebars, with checkbox-based toggle */ -.sb-sidebar-primary, -.sb-sidebar-secondary { - position: fixed; - height: 100%; - top: 0; -} - -.sb-sidebar-primary { - left: -17rem; - transition: left 250ms ease-in-out; -} -.sb-sidebar-secondary { - right: -17rem; - transition: right 250ms ease-in-out; -} - -.sb-sidebar-toggle { - display: none; -} -.sb-sidebar-overlay { - position: fixed; - top: 0; - width: 0; - height: 0; - - transition: width 0ms ease 250ms, height 0ms ease 250ms, opacity 250ms ease; - - opacity: 0; - background-color: rgba(0, 0, 0, 0.54); -} - -#sb-sidebar-toggle--primary:checked - ~ .sb-sidebar-overlay[for="sb-sidebar-toggle--primary"], -#sb-sidebar-toggle--secondary:checked - ~ .sb-sidebar-overlay[for="sb-sidebar-toggle--secondary"] { - width: 100%; - height: 100%; - opacity: 1; - transition: width 0ms ease, height 0ms ease, opacity 250ms ease; -} - -#sb-sidebar-toggle--primary:checked ~ .sb-container .sb-sidebar-primary { - left: 0; -} -#sb-sidebar-toggle--secondary:checked ~ .sb-container .sb-sidebar-secondary { - right: 0; -} - -/* Full-width mode */ -.drop-secondary-sidebar-for-full-width-content - .hide-when-secondary-sidebar-shown { - display: none !important; -} -.drop-secondary-sidebar-for-full-width-content .sb-sidebar-secondary { - display: none !important; -} - -/* Mobile views */ -.sb-page-width { - width: 100%; -} - -.sb-article-container, -.sb-footer-content__inner, -.drop-secondary-sidebar-for-full-width-content .sb-article, -.drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 100vw; -} - -.sb-article, -.match-content-width { - padding: 0 1rem; - box-sizing: border-box; -} - -@media (min-width: 32rem) { - .sb-article, - .match-content-width { - padding: 0 2rem; - } -} - -/* Tablet views */ -@media (min-width: 42rem) { - .sb-article-container { - width: auto; - } - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 42rem; - } - .sb-article, - .match-content-width { - width: 42rem; - } -} -@media (min-width: 46rem) { - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 46rem; - } - .sb-article, - .match-content-width { - width: 46rem; - } -} -@media (min-width: 50rem) { - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 50rem; - } - .sb-article, - .match-content-width { - width: 50rem; - } -} - -/* Tablet views */ -@media (min-width: 59rem) { - .sb-sidebar-secondary { - position: static; - } - .hide-when-secondary-sidebar-shown { - display: none !important; - } - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 59rem; - } - .sb-article, - .match-content-width { - width: 42rem; - } -} -@media (min-width: 63rem) { - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 63rem; - } - .sb-article, - .match-content-width { - width: 46rem; - } -} -@media (min-width: 67rem) { - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 67rem; - } - .sb-article, - .match-content-width { - width: 50rem; - } -} - -/* Desktop views */ -@media (min-width: 76rem) { - .sb-sidebar-primary { - position: static; - } - .hide-when-primary-sidebar-shown { - display: none !important; - } - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 59rem; - } - .sb-article, - .match-content-width { - width: 42rem; - } -} - -/* Full desktop views */ -@media (min-width: 80rem) { - .sb-article, - .match-content-width { - width: 46rem; - } - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 63rem; - } -} - -@media (min-width: 84rem) { - .sb-article, - .match-content-width { - width: 50rem; - } - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 67rem; - } -} - -@media (min-width: 88rem) { - .sb-footer-content__inner, - .drop-secondary-sidebar-for-full-width-content .sb-article, - .drop-secondary-sidebar-for-full-width-content .match-content-width { - width: 67rem; - } - .sb-page-width { - width: 88rem; - } -} diff --git a/docs/_static/sphinx_highlight.js b/docs/_static/sphinx_highlight.js deleted file mode 100644 index aae669d..0000000 --- a/docs/_static/sphinx_highlight.js +++ /dev/null @@ -1,144 +0,0 @@ -/* Highlighting utilities for Sphinx HTML documentation. */ -"use strict"; - -const SPHINX_HIGHLIGHT_ENABLED = true - -/** - * highlight a given string on a node by wrapping it in - * span elements with the given class name. - */ -const _highlight = (node, addItems, text, className) => { - if (node.nodeType === Node.TEXT_NODE) { - const val = node.nodeValue; - const parent = node.parentNode; - const pos = val.toLowerCase().indexOf(text); - if ( - pos >= 0 && - !parent.classList.contains(className) && - !parent.classList.contains("nohighlight") - ) { - let span; - - const closestNode = parent.closest("body, svg, foreignObject"); - const isInSVG = closestNode && closestNode.matches("svg"); - if (isInSVG) { - span = document.createElementNS("http://www.w3.org/2000/svg", "tspan"); - } else { - span = document.createElement("span"); - span.classList.add(className); - } - - span.appendChild(document.createTextNode(val.substr(pos, text.length))); - parent.insertBefore( - span, - parent.insertBefore( - document.createTextNode(val.substr(pos + text.length)), - node.nextSibling - ) - ); - node.nodeValue = val.substr(0, pos); - - if (isInSVG) { - const rect = document.createElementNS( - "http://www.w3.org/2000/svg", - "rect" - ); - const bbox = parent.getBBox(); - rect.x.baseVal.value = bbox.x; - rect.y.baseVal.value = bbox.y; - rect.width.baseVal.value = bbox.width; - rect.height.baseVal.value = bbox.height; - rect.setAttribute("class", className); - addItems.push({ parent: parent, target: rect }); - } - } - } else if (node.matches && !node.matches("button, select, textarea")) { - node.childNodes.forEach((el) => _highlight(el, addItems, text, className)); - } -}; -const _highlightText = (thisNode, text, className) => { - let addItems = []; - _highlight(thisNode, addItems, text, className); - addItems.forEach((obj) => - obj.parent.insertAdjacentElement("beforebegin", obj.target) - ); -}; - -/** - * Small JavaScript module for the documentation. - */ -const SphinxHighlight = { - - /** - * highlight the search words provided in localstorage in the text - */ - highlightSearchWords: () => { - if (!SPHINX_HIGHLIGHT_ENABLED) return; // bail if no highlight - - // get and clear terms from localstorage - const url = new URL(window.location); - const highlight = - localStorage.getItem("sphinx_highlight_terms") - || url.searchParams.get("highlight") - || ""; - localStorage.removeItem("sphinx_highlight_terms") - url.searchParams.delete("highlight"); - window.history.replaceState({}, "", url); - - // get individual terms from highlight string - const terms = highlight.toLowerCase().split(/\s+/).filter(x => x); - if (terms.length === 0) return; // nothing to do - - // There should never be more than one element matching "div.body" - const divBody = document.querySelectorAll("div.body"); - const body = divBody.length ? divBody[0] : document.querySelector("body"); - window.setTimeout(() => { - terms.forEach((term) => _highlightText(body, term, "highlighted")); - }, 10); - - const searchBox = document.getElementById("searchbox"); - if (searchBox === null) return; - searchBox.appendChild( - document - .createRange() - .createContextualFragment( - '

' + - '' + - _("Hide Search Matches") + - "

" - ) - ); - }, - - /** - * helper function to hide the search marks again - */ - hideSearchWords: () => { - document - .querySelectorAll("#searchbox .highlight-link") - .forEach((el) => el.remove()); - document - .querySelectorAll("span.highlighted") - .forEach((el) => el.classList.remove("highlighted")); - localStorage.removeItem("sphinx_highlight_terms") - }, - - initEscapeListener: () => { - // only install a listener if it is really needed - if (!DOCUMENTATION_OPTIONS.ENABLE_SEARCH_SHORTCUTS) return; - - document.addEventListener("keydown", (event) => { - // bail for input elements - if (BLACKLISTED_KEY_CONTROL_ELEMENTS.has(document.activeElement.tagName)) return; - // bail with special keys - if (event.shiftKey || event.altKey || event.ctrlKey || event.metaKey) return; - if (DOCUMENTATION_OPTIONS.ENABLE_SEARCH_SHORTCUTS && (event.key === "Escape")) { - SphinxHighlight.hideSearchWords(); - event.preventDefault(); - } - }); - }, -}; - -_ready(SphinxHighlight.highlightSearchWords); -_ready(SphinxHighlight.initEscapeListener); diff --git a/docs/_static/styles/furo-extensions.css b/docs/_static/styles/furo-extensions.css deleted file mode 100644 index bc447f2..0000000 --- a/docs/_static/styles/furo-extensions.css +++ /dev/null @@ -1,2 +0,0 @@ -#furo-sidebar-ad-placement{padding:var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal)}#furo-sidebar-ad-placement .ethical-sidebar{background:var(--color-background-secondary);border:none;box-shadow:none}#furo-sidebar-ad-placement .ethical-sidebar:hover{background:var(--color-background-hover)}#furo-sidebar-ad-placement .ethical-sidebar a{color:var(--color-foreground-primary)}#furo-sidebar-ad-placement .ethical-callout a{color:var(--color-foreground-secondary)!important}#furo-readthedocs-versions{background:transparent;display:block;position:static;width:100%}#furo-readthedocs-versions .rst-versions{background:#1a1c1e}#furo-readthedocs-versions .rst-current-version{background:var(--color-sidebar-item-background);cursor:unset}#furo-readthedocs-versions .rst-current-version:hover{background:var(--color-sidebar-item-background)}#furo-readthedocs-versions .rst-current-version .fa-book{color:var(--color-foreground-primary)}#furo-readthedocs-versions>.rst-other-versions{padding:0}#furo-readthedocs-versions>.rst-other-versions small{opacity:1}#furo-readthedocs-versions .injected .rst-versions{position:unset}#furo-readthedocs-versions:focus-within,#furo-readthedocs-versions:hover{box-shadow:0 0 0 1px var(--color-sidebar-background-border)}#furo-readthedocs-versions:focus-within .rst-current-version,#furo-readthedocs-versions:hover .rst-current-version{background:#1a1c1e;font-size:inherit;height:auto;line-height:inherit;padding:12px;text-align:right}#furo-readthedocs-versions:focus-within .rst-current-version .fa-book,#furo-readthedocs-versions:hover .rst-current-version .fa-book{color:#fff;float:left}#furo-readthedocs-versions:focus-within .fa-caret-down,#furo-readthedocs-versions:hover .fa-caret-down{display:none}#furo-readthedocs-versions:focus-within .injected,#furo-readthedocs-versions:focus-within .rst-current-version,#furo-readthedocs-versions:focus-within .rst-other-versions,#furo-readthedocs-versions:hover .injected,#furo-readthedocs-versions:hover .rst-current-version,#furo-readthedocs-versions:hover .rst-other-versions{display:block}#furo-readthedocs-versions:focus-within>.rst-current-version,#furo-readthedocs-versions:hover>.rst-current-version{display:none}.highlight:hover button.copybtn{color:var(--color-code-foreground)}.highlight button.copybtn{align-items:center;background-color:var(--color-code-background);border:none;color:var(--color-background-item);cursor:pointer;height:1.25em;opacity:1;right:.5rem;top:.625rem;transition:color .3s,opacity .3s;width:1.25em}.highlight button.copybtn:hover{background-color:var(--color-code-background);color:var(--color-brand-content)}.highlight button.copybtn:after{background-color:transparent;color:var(--color-code-foreground);display:none}.highlight button.copybtn.success{color:#22863a;transition:color 0ms}.highlight button.copybtn.success:after{display:block}.highlight button.copybtn svg{padding:0}body{--sd-color-primary:var(--color-brand-primary);--sd-color-primary-highlight:var(--color-brand-content);--sd-color-primary-text:var(--color-background-primary);--sd-color-shadow:rgba(0,0,0,.05);--sd-color-card-border:var(--color-card-border);--sd-color-card-border-hover:var(--color-brand-content);--sd-color-card-background:var(--color-card-background);--sd-color-card-text:var(--color-foreground-primary);--sd-color-card-header:var(--color-card-marginals-background);--sd-color-card-footer:var(--color-card-marginals-background);--sd-color-tabs-label-active:var(--color-brand-content);--sd-color-tabs-label-hover:var(--color-foreground-muted);--sd-color-tabs-label-inactive:var(--color-foreground-muted);--sd-color-tabs-underline-active:var(--color-brand-content);--sd-color-tabs-underline-hover:var(--color-foreground-border);--sd-color-tabs-underline-inactive:var(--color-background-border);--sd-color-tabs-overline:var(--color-background-border);--sd-color-tabs-underline:var(--color-background-border)}.sd-tab-content{box-shadow:0 -2px var(--sd-color-tabs-overline),0 1px var(--sd-color-tabs-underline)}.sd-card{box-shadow:0 .1rem .25rem var(--sd-color-shadow),0 0 .0625rem rgba(0,0,0,.1)}.sd-shadow-sm{box-shadow:0 .1rem .25rem var(--sd-color-shadow),0 0 .0625rem rgba(0,0,0,.1)!important}.sd-shadow-md{box-shadow:0 .3rem .75rem var(--sd-color-shadow),0 0 .0625rem rgba(0,0,0,.1)!important}.sd-shadow-lg{box-shadow:0 .6rem 1.5rem var(--sd-color-shadow),0 0 .0625rem rgba(0,0,0,.1)!important}.sd-card-hover:hover{transform:none}.sd-cards-carousel{gap:.25rem;padding:.25rem}body{--tabs--label-text:var(--color-foreground-muted);--tabs--label-text--hover:var(--color-foreground-muted);--tabs--label-text--active:var(--color-brand-content);--tabs--label-text--active--hover:var(--color-brand-content);--tabs--label-background:transparent;--tabs--label-background--hover:transparent;--tabs--label-background--active:transparent;--tabs--label-background--active--hover:transparent;--tabs--padding-x:0.25em;--tabs--margin-x:1em;--tabs--border:var(--color-background-border);--tabs--label-border:transparent;--tabs--label-border--hover:var(--color-foreground-muted);--tabs--label-border--active:var(--color-brand-content);--tabs--label-border--active--hover:var(--color-brand-content)}[role=main] .container{max-width:none;padding-left:0;padding-right:0}.shadow.docutils{border:none;box-shadow:0 .2rem .5rem rgba(0,0,0,.05),0 0 .0625rem rgba(0,0,0,.1)!important}.sphinx-bs .card{background-color:var(--color-background-secondary);color:var(--color-foreground)} -/*# sourceMappingURL=furo-extensions.css.map*/ \ No newline at end of file diff --git a/docs/_static/styles/furo-extensions.css.map b/docs/_static/styles/furo-extensions.css.map deleted file mode 100644 index 9ba5637..0000000 --- a/docs/_static/styles/furo-extensions.css.map +++ /dev/null @@ -1 +0,0 @@ -{"version":3,"file":"styles/furo-extensions.css","mappings":"AAGA,2BACE,oFACA,4CAKE,6CAHA,YACA,eAEA,CACA,kDACE,yCAEF,8CACE,sCAEJ,8CACE,kDAEJ,2BAGE,uBACA,cAHA,gBACA,UAEA,CAGA,yCACE,mBAEF,gDAEE,gDADA,YACA,CACA,sDACE,gDACF,yDACE,sCAEJ,+CACE,UACA,qDACE,UAGF,mDACE,eAEJ,yEAEE,4DAEA,mHASE,mBAPA,kBAEA,YADA,oBAGA,aADA,gBAIA,CAEA,qIAEE,WADA,UACA,CAEJ,uGACE,aAEF,iUAGE,cAEF,mHACE,aC1EJ,gCACE,mCAEF,0BAKE,mBAUA,8CACA,YAFA,mCAKA,eAZA,cALA,UASA,YADA,YAYA,iCAdA,YAcA,CAEA,gCAEE,8CADA,gCACA,CAEF,gCAGE,6BADA,mCADA,YAEA,CAEF,kCAEE,cADA,oBACA,CACA,wCACE,cAEJ,8BACE,UC5CN,KAEE,6CAA8C,CAC9C,uDAAwD,CACxD,uDAAwD,CAGxD,iCAAsC,CAGtC,+CAAgD,CAChD,uDAAwD,CACxD,uDAAwD,CACxD,oDAAqD,CACrD,6DAA8D,CAC9D,6DAA8D,CAG9D,uDAAwD,CACxD,yDAA0D,CAC1D,4DAA6D,CAC7D,2DAA4D,CAC5D,8DAA+D,CAC/D,iEAAkE,CAClE,uDAAwD,CACxD,wDAAyD,CAG3D,gBACE,qFAGF,SACE,6EAEF,cACE,uFAEF,cACE,uFAEF,cACE,uFAGF,qBACE,eAEF,mBACE,WACA,eChDF,KACE,gDAAiD,CACjD,uDAAwD,CACxD,qDAAsD,CACtD,4DAA6D,CAC7D,oCAAqC,CACrC,2CAA4C,CAC5C,4CAA6C,CAC7C,mDAAoD,CACpD,wBAAyB,CACzB,oBAAqB,CACrB,6CAA8C,CAC9C,gCAAiC,CACjC,yDAA0D,CAC1D,uDAAwD,CACxD,8DAA+D,CCbjE,uBACE,eACA,eACA,gBAGF,iBACE,YACA,+EAGF,iBACE,mDACA","sources":["webpack:///./src/furo/assets/styles/extensions/_readthedocs.sass","webpack:///./src/furo/assets/styles/extensions/_copybutton.sass","webpack:///./src/furo/assets/styles/extensions/_sphinx-design.sass","webpack:///./src/furo/assets/styles/extensions/_sphinx-inline-tabs.sass","webpack:///./src/furo/assets/styles/extensions/_sphinx-panels.sass"],"sourcesContent":["// This file contains the styles used for tweaking how ReadTheDoc's embedded\n// contents would show up inside the theme.\n\n#furo-sidebar-ad-placement\n padding: var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal)\n .ethical-sidebar\n // Remove the border and box-shadow.\n border: none\n box-shadow: none\n // Manage the background colors.\n background: var(--color-background-secondary)\n &:hover\n background: var(--color-background-hover)\n // Ensure the text is legible.\n a\n color: var(--color-foreground-primary)\n\n .ethical-callout a\n color: var(--color-foreground-secondary) !important\n\n#furo-readthedocs-versions\n position: static\n width: 100%\n background: transparent\n display: block\n\n // Make the background color fit with the theme's aesthetic.\n .rst-versions\n background: rgb(26, 28, 30)\n\n .rst-current-version\n cursor: unset\n background: var(--color-sidebar-item-background)\n &:hover\n background: var(--color-sidebar-item-background)\n .fa-book\n color: var(--color-foreground-primary)\n\n > .rst-other-versions\n padding: 0\n small\n opacity: 1\n\n .injected\n .rst-versions\n position: unset\n\n &:hover,\n &:focus-within\n box-shadow: 0 0 0 1px var(--color-sidebar-background-border)\n\n .rst-current-version\n // Undo the tweaks done in RTD's CSS\n font-size: inherit\n line-height: inherit\n height: auto\n text-align: right\n padding: 12px\n\n // Match the rest of the body\n background: #1a1c1e\n\n .fa-book\n float: left\n color: white\n\n .fa-caret-down\n display: none\n\n .rst-current-version,\n .rst-other-versions,\n .injected\n display: block\n\n > .rst-current-version\n display: none\n",".highlight\n &:hover button.copybtn\n color: var(--color-code-foreground)\n\n button.copybtn\n // Make it visible\n opacity: 1\n\n // Align things correctly\n align-items: center\n\n height: 1.25em\n width: 1.25em\n\n top: 0.625rem // $code-spacing-vertical\n right: 0.5rem\n\n // Make it look better\n color: var(--color-background-item)\n background-color: var(--color-code-background)\n border: none\n\n // Change to cursor to make it obvious that you can click on it\n cursor: pointer\n\n // Transition smoothly, for aesthetics\n transition: color 300ms, opacity 300ms\n\n &:hover\n color: var(--color-brand-content)\n background-color: var(--color-code-background)\n\n &::after\n display: none\n color: var(--color-code-foreground)\n background-color: transparent\n\n &.success\n transition: color 0ms\n color: #22863a\n &::after\n display: block\n\n svg\n padding: 0\n","body\n // Colors\n --sd-color-primary: var(--color-brand-primary)\n --sd-color-primary-highlight: var(--color-brand-content)\n --sd-color-primary-text: var(--color-background-primary)\n\n // Shadows\n --sd-color-shadow: rgba(0, 0, 0, 0.05)\n\n // Cards\n --sd-color-card-border: var(--color-card-border)\n --sd-color-card-border-hover: var(--color-brand-content)\n --sd-color-card-background: var(--color-card-background)\n --sd-color-card-text: var(--color-foreground-primary)\n --sd-color-card-header: var(--color-card-marginals-background)\n --sd-color-card-footer: var(--color-card-marginals-background)\n\n // Tabs\n --sd-color-tabs-label-active: var(--color-brand-content)\n --sd-color-tabs-label-hover: var(--color-foreground-muted)\n --sd-color-tabs-label-inactive: var(--color-foreground-muted)\n --sd-color-tabs-underline-active: var(--color-brand-content)\n --sd-color-tabs-underline-hover: var(--color-foreground-border)\n --sd-color-tabs-underline-inactive: var(--color-background-border)\n --sd-color-tabs-overline: var(--color-background-border)\n --sd-color-tabs-underline: var(--color-background-border)\n\n// Tabs\n.sd-tab-content\n box-shadow: 0 -2px var(--sd-color-tabs-overline), 0 1px var(--sd-color-tabs-underline)\n\n// Shadows\n.sd-card // Have a shadow by default\n box-shadow: 0 0.1rem 0.25rem var(--sd-color-shadow), 0 0 0.0625rem rgba(0, 0, 0, 0.1)\n\n.sd-shadow-sm\n box-shadow: 0 0.1rem 0.25rem var(--sd-color-shadow), 0 0 0.0625rem rgba(0, 0, 0, 0.1) !important\n\n.sd-shadow-md\n box-shadow: 0 0.3rem 0.75rem var(--sd-color-shadow), 0 0 0.0625rem rgba(0, 0, 0, 0.1) !important\n\n.sd-shadow-lg\n box-shadow: 0 0.6rem 1.5rem var(--sd-color-shadow), 0 0 0.0625rem rgba(0, 0, 0, 0.1) !important\n\n// Cards\n.sd-card-hover:hover // Don't change scale on hover\n transform: none\n\n.sd-cards-carousel // Have a bit of gap in the carousel by default\n gap: 0.25rem\n padding: 0.25rem\n","// This file contains styles to tweak sphinx-inline-tabs to work well with Furo.\n\nbody\n --tabs--label-text: var(--color-foreground-muted)\n --tabs--label-text--hover: var(--color-foreground-muted)\n --tabs--label-text--active: var(--color-brand-content)\n --tabs--label-text--active--hover: var(--color-brand-content)\n --tabs--label-background: transparent\n --tabs--label-background--hover: transparent\n --tabs--label-background--active: transparent\n --tabs--label-background--active--hover: transparent\n --tabs--padding-x: 0.25em\n --tabs--margin-x: 1em\n --tabs--border: var(--color-background-border)\n --tabs--label-border: transparent\n --tabs--label-border--hover: var(--color-foreground-muted)\n --tabs--label-border--active: var(--color-brand-content)\n --tabs--label-border--active--hover: var(--color-brand-content)\n","// This file contains styles to tweak sphinx-panels to work well with Furo.\n\n// sphinx-panels includes Bootstrap 4, which uses .container which can conflict\n// with docutils' `.. container::` directive.\n[role=\"main\"] .container\n max-width: initial\n padding-left: initial\n padding-right: initial\n\n// Make the panels look nicer!\n.shadow.docutils\n border: none\n box-shadow: 0 0.2rem 0.5rem rgba(0, 0, 0, 0.05), 0 0 0.0625rem rgba(0, 0, 0, 0.1) !important\n\n// Make panel colors respond to dark mode\n.sphinx-bs .card\n background-color: var(--color-background-secondary)\n color: var(--color-foreground)\n"],"names":[],"sourceRoot":""} \ No newline at end of file diff --git a/docs/_static/styles/furo.css b/docs/_static/styles/furo.css deleted file mode 100644 index b30989d..0000000 --- a/docs/_static/styles/furo.css +++ /dev/null @@ -1,2 +0,0 @@ -/*! normalize.css v8.0.1 | MIT License | github.com/necolas/normalize.css */html{-webkit-text-size-adjust:100%;line-height:1.15}body{margin:0}main{display:block}h1{font-size:2em;margin:.67em 0}hr{box-sizing:content-box;height:0;overflow:visible}pre{font-family:monospace,monospace;font-size:1em}a{background-color:transparent}abbr[title]{border-bottom:none;text-decoration:underline;text-decoration:underline dotted}b,strong{font-weight:bolder}code,kbd,samp{font-family:monospace,monospace;font-size:1em}sub,sup{font-size:75%;line-height:0;position:relative;vertical-align:baseline}sub{bottom:-.25em}sup{top:-.5em}img{border-style:none}button,input,optgroup,select,textarea{font-family:inherit;font-size:100%;line-height:1.15;margin:0}button,input{overflow:visible}button,select{text-transform:none}[type=button],[type=reset],[type=submit],button{-webkit-appearance:button}[type=button]::-moz-focus-inner,[type=reset]::-moz-focus-inner,[type=submit]::-moz-focus-inner,button::-moz-focus-inner{border-style:none;padding:0}[type=button]:-moz-focusring,[type=reset]:-moz-focusring,[type=submit]:-moz-focusring,button:-moz-focusring{outline:1px dotted ButtonText}fieldset{padding:.35em .75em .625em}legend{box-sizing:border-box;color:inherit;display:table;max-width:100%;padding:0;white-space:normal}progress{vertical-align:baseline}textarea{overflow:auto}[type=checkbox],[type=radio]{box-sizing:border-box;padding:0}[type=number]::-webkit-inner-spin-button,[type=number]::-webkit-outer-spin-button{height:auto}[type=search]{-webkit-appearance:textfield;outline-offset:-2px}[type=search]::-webkit-search-decoration{-webkit-appearance:none}::-webkit-file-upload-button{-webkit-appearance:button;font:inherit}details{display:block}summary{display:list-item}[hidden],template{display:none}@media print{.content-icon-container,.headerlink,.mobile-header,.related-pages{display:none!important}.highlight{border:.1pt solid var(--color-foreground-border)}a,blockquote,dl,ol,pre,table,ul{page-break-inside:avoid}caption,figure,h1,h2,h3,h4,h5,h6,img{page-break-after:avoid;page-break-inside:avoid}dl,ol,ul{page-break-before:avoid}}.visually-hidden{clip:rect(0,0,0,0)!important;border:0!important;height:1px!important;margin:-1px!important;overflow:hidden!important;padding:0!important;position:absolute!important;white-space:nowrap!important;width:1px!important}:-moz-focusring{outline:auto}body{--font-stack:-apple-system,BlinkMacSystemFont,Segoe UI,Helvetica,Arial,sans-serif,Apple Color Emoji,Segoe UI Emoji;--font-stack--monospace:"SFMono-Regular",Menlo,Consolas,Monaco,Liberation Mono,Lucida Console,monospace;--font-size--normal:100%;--font-size--small:87.5%;--font-size--small--2:81.25%;--font-size--small--3:75%;--font-size--small--4:62.5%;--sidebar-caption-font-size:var(--font-size--small--2);--sidebar-item-font-size:var(--font-size--small);--sidebar-search-input-font-size:var(--font-size--small);--toc-font-size:var(--font-size--small--3);--toc-font-size--mobile:var(--font-size--normal);--toc-title-font-size:var(--font-size--small--4);--admonition-font-size:0.8125rem;--admonition-title-font-size:0.8125rem;--code-font-size:var(--font-size--small--2);--api-font-size:var(--font-size--small);--header-height:calc(var(--sidebar-item-line-height) + var(--sidebar-item-spacing-vertical)*4);--header-padding:0.5rem;--sidebar-tree-space-above:1.5rem;--sidebar-caption-space-above:1rem;--sidebar-item-line-height:1rem;--sidebar-item-spacing-vertical:0.5rem;--sidebar-item-spacing-horizontal:1rem;--sidebar-item-height:calc(var(--sidebar-item-line-height) + var(--sidebar-item-spacing-vertical)*2);--sidebar-expander-width:var(--sidebar-item-height);--sidebar-search-space-above:0.5rem;--sidebar-search-input-spacing-vertical:0.5rem;--sidebar-search-input-spacing-horizontal:0.5rem;--sidebar-search-input-height:1rem;--sidebar-search-icon-size:var(--sidebar-search-input-height);--toc-title-padding:0.25rem 0;--toc-spacing-vertical:1.5rem;--toc-spacing-horizontal:1.5rem;--toc-item-spacing-vertical:0.4rem;--toc-item-spacing-horizontal:1rem;--icon-search:url('data:image/svg+xml;charset=utf-8,');--icon-pencil:url('data:image/svg+xml;charset=utf-8,');--icon-abstract:url('data:image/svg+xml;charset=utf-8,');--icon-info:url('data:image/svg+xml;charset=utf-8,');--icon-flame:url('data:image/svg+xml;charset=utf-8,');--icon-question:url('data:image/svg+xml;charset=utf-8,');--icon-warning:url('data:image/svg+xml;charset=utf-8,');--icon-failure:url('data:image/svg+xml;charset=utf-8,');--icon-spark:url('data:image/svg+xml;charset=utf-8,');--color-admonition-title--caution:#ff9100;--color-admonition-title-background--caution:rgba(255,145,0,.2);--color-admonition-title--warning:#ff9100;--color-admonition-title-background--warning:rgba(255,145,0,.2);--color-admonition-title--danger:#ff5252;--color-admonition-title-background--danger:rgba(255,82,82,.2);--color-admonition-title--attention:#ff5252;--color-admonition-title-background--attention:rgba(255,82,82,.2);--color-admonition-title--error:#ff5252;--color-admonition-title-background--error:rgba(255,82,82,.2);--color-admonition-title--hint:#00c852;--color-admonition-title-background--hint:rgba(0,200,82,.2);--color-admonition-title--tip:#00c852;--color-admonition-title-background--tip:rgba(0,200,82,.2);--color-admonition-title--important:#00bfa5;--color-admonition-title-background--important:rgba(0,191,165,.2);--color-admonition-title--note:#00b0ff;--color-admonition-title-background--note:rgba(0,176,255,.2);--color-admonition-title--seealso:#448aff;--color-admonition-title-background--seealso:rgba(68,138,255,.2);--color-admonition-title--admonition-todo:grey;--color-admonition-title-background--admonition-todo:hsla(0,0%,50%,.2);--color-admonition-title:#651fff;--color-admonition-title-background:rgba(101,31,255,.2);--icon-admonition-default:var(--icon-abstract);--color-topic-title:#14b8a6;--color-topic-title-background:rgba(20,184,166,.2);--icon-topic-default:var(--icon-pencil);--color-problematic:#b30000;--color-foreground-primary:#000;--color-foreground-secondary:#5a5c63;--color-foreground-muted:#646776;--color-foreground-border:#878787;--color-background-primary:#fff;--color-background-secondary:#f8f9fb;--color-background-hover:#efeff4;--color-background-hover--transparent:#efeff400;--color-background-border:#eeebee;--color-background-item:#ccc;--color-announcement-background:#000000dd;--color-announcement-text:#eeebee;--color-brand-primary:#2962ff;--color-brand-content:#2a5adf;--color-api-background:var(--color-background-hover--transparent);--color-api-background-hover:var(--color-background-hover);--color-api-overall:var(--color-foreground-secondary);--color-api-name:var(--color-problematic);--color-api-pre-name:var(--color-problematic);--color-api-paren:var(--color-foreground-secondary);--color-api-keyword:var(--color-foreground-primary);--color-highlight-on-target:#ffc;--color-inline-code-background:var(--color-background-secondary);--color-highlighted-background:#def;--color-highlighted-text:var(--color-foreground-primary);--color-guilabel-background:#ddeeff80;--color-guilabel-border:#bedaf580;--color-guilabel-text:var(--color-foreground-primary);--color-admonition-background:transparent;--color-table-header-background:var(--color-background-secondary);--color-table-border:var(--color-background-border);--color-card-border:var(--color-background-secondary);--color-card-background:transparent;--color-card-marginals-background:var(--color-background-secondary);--color-header-background:var(--color-background-primary);--color-header-border:var(--color-background-border);--color-header-text:var(--color-foreground-primary);--color-sidebar-background:var(--color-background-secondary);--color-sidebar-background-border:var(--color-background-border);--color-sidebar-brand-text:var(--color-foreground-primary);--color-sidebar-caption-text:var(--color-foreground-muted);--color-sidebar-link-text:var(--color-foreground-secondary);--color-sidebar-link-text--top-level:var(--color-brand-primary);--color-sidebar-item-background:var(--color-sidebar-background);--color-sidebar-item-background--current:var( --color-sidebar-item-background );--color-sidebar-item-background--hover:linear-gradient(90deg,var(--color-background-hover--transparent) 0%,var(--color-background-hover) var(--sidebar-item-spacing-horizontal),var(--color-background-hover) 100%);--color-sidebar-item-expander-background:transparent;--color-sidebar-item-expander-background--hover:var( --color-background-hover );--color-sidebar-search-text:var(--color-foreground-primary);--color-sidebar-search-background:var(--color-background-secondary);--color-sidebar-search-background--focus:var(--color-background-primary);--color-sidebar-search-border:var(--color-background-border);--color-sidebar-search-icon:var(--color-foreground-muted);--color-toc-background:var(--color-background-primary);--color-toc-title-text:var(--color-foreground-muted);--color-toc-item-text:var(--color-foreground-secondary);--color-toc-item-text--hover:var(--color-foreground-primary);--color-toc-item-text--active:var(--color-brand-primary);--color-content-foreground:var(--color-foreground-primary);--color-content-background:transparent;--color-link:var(--color-brand-content);--color-link--hover:var(--color-brand-content);--color-link-underline:var(--color-background-border);--color-link-underline--hover:var(--color-foreground-border)}.only-light{display:block!important}html body .only-dark{display:none!important}@media not print{body[data-theme=dark]{--color-problematic:#ee5151;--color-foreground-primary:#ffffffcc;--color-foreground-secondary:#9ca0a5;--color-foreground-muted:#81868d;--color-foreground-border:#666;--color-background-primary:#131416;--color-background-secondary:#1a1c1e;--color-background-hover:#1e2124;--color-background-hover--transparent:#1e212400;--color-background-border:#303335;--color-background-item:#444;--color-announcement-background:#000000dd;--color-announcement-text:#eeebee;--color-brand-primary:#2b8cee;--color-brand-content:#368ce2;--color-highlighted-background:#083563;--color-guilabel-background:#08356380;--color-guilabel-border:#13395f80;--color-api-keyword:var(--color-foreground-secondary);--color-highlight-on-target:#330;--color-admonition-background:#18181a;--color-card-border:var(--color-background-secondary);--color-card-background:#18181a;--color-card-marginals-background:var(--color-background-hover)}html body[data-theme=dark] .only-light{display:none!important}body[data-theme=dark] .only-dark{display:block!important}@media(prefers-color-scheme:dark){body:not([data-theme=light]){--color-problematic:#ee5151;--color-foreground-primary:#ffffffcc;--color-foreground-secondary:#9ca0a5;--color-foreground-muted:#81868d;--color-foreground-border:#666;--color-background-primary:#131416;--color-background-secondary:#1a1c1e;--color-background-hover:#1e2124;--color-background-hover--transparent:#1e212400;--color-background-border:#303335;--color-background-item:#444;--color-announcement-background:#000000dd;--color-announcement-text:#eeebee;--color-brand-primary:#2b8cee;--color-brand-content:#368ce2;--color-highlighted-background:#083563;--color-guilabel-background:#08356380;--color-guilabel-border:#13395f80;--color-api-keyword:var(--color-foreground-secondary);--color-highlight-on-target:#330;--color-admonition-background:#18181a;--color-card-border:var(--color-background-secondary);--color-card-background:#18181a;--color-card-marginals-background:var(--color-background-hover)}html body:not([data-theme=light]) .only-light{display:none!important}body:not([data-theme=light]) .only-dark{display:block!important}}}body[data-theme=auto] .theme-toggle svg.theme-icon-when-auto,body[data-theme=dark] .theme-toggle svg.theme-icon-when-dark,body[data-theme=light] .theme-toggle svg.theme-icon-when-light{display:block}body{font-family:var(--font-stack)}code,kbd,pre,samp{font-family:var(--font-stack--monospace)}body{-webkit-font-smoothing:antialiased;-moz-osx-font-smoothing:grayscale}article{line-height:1.5}h1,h2,h3,h4,h5,h6{border-radius:.5rem;font-weight:700;line-height:1.25;margin:.5rem -.5rem;padding-left:.5rem;padding-right:.5rem}h1+p,h2+p,h3+p,h4+p,h5+p,h6+p{margin-top:0}h1{font-size:2.5em;margin-bottom:1rem}h1,h2{margin-top:1.75rem}h2{font-size:2em}h3{font-size:1.5em}h4{font-size:1.25em}h5{font-size:1.125em}h6{font-size:1em}small{font-size:80%;opacity:75%}p{margin-bottom:.75rem;margin-top:.5rem}hr.docutils{background-color:var(--color-background-border);border:0;height:1px;margin:2rem 0;padding:0}.centered{text-align:center}a{color:var(--color-link);text-decoration:underline;-webkit-text-decoration-color:var(--color-link-underline);text-decoration-color:var(--color-link-underline)}a:hover{color:var(--color-link--hover);-webkit-text-decoration-color:var(--color-link-underline--hover);text-decoration-color:var(--color-link-underline--hover)}a.muted-link{color:inherit}a.muted-link:hover{color:var(--color-link);-webkit-text-decoration-color:var(--color-link-underline--hover);text-decoration-color:var(--color-link-underline--hover)}html{overflow-x:hidden;overflow-y:scroll;scroll-behavior:smooth}.sidebar-scroll,.toc-scroll,article[role=main] *{scrollbar-color:var(--color-foreground-border) transparent;scrollbar-width:thin}.sidebar-scroll::-webkit-scrollbar,.toc-scroll::-webkit-scrollbar,article[role=main] ::-webkit-scrollbar{height:.25rem;width:.25rem}.sidebar-scroll::-webkit-scrollbar-thumb,.toc-scroll::-webkit-scrollbar-thumb,article[role=main] ::-webkit-scrollbar-thumb{background-color:var(--color-foreground-border);border-radius:.125rem}body,html{background:var(--color-background-primary);color:var(--color-foreground-primary);height:100%}article{background:var(--color-content-background);color:var(--color-content-foreground)}.page{display:flex;min-height:100%}.mobile-header{background-color:var(--color-header-background);border-bottom:1px solid var(--color-header-border);color:var(--color-header-text);display:none;height:var(--header-height);width:100%;z-index:10}.mobile-header.scrolled{border-bottom:none;box-shadow:0 0 .2rem rgba(0,0,0,.1),0 .2rem .4rem rgba(0,0,0,.2)}.mobile-header .header-center a{color:var(--color-header-text);text-decoration:none}.main{display:flex;flex:1}.sidebar-drawer{background:var(--color-sidebar-background);border-right:1px solid var(--color-sidebar-background-border);box-sizing:border-box;display:flex;justify-content:flex-end;min-width:15em;width:calc(50% - 26em)}.sidebar-container,.toc-drawer{box-sizing:border-box;width:15em}.toc-drawer{background:var(--color-toc-background);padding-right:1rem}.sidebar-sticky,.toc-sticky{display:flex;flex-direction:column;height:min(100%,100vh);height:100vh;position:-webkit-sticky;position:sticky;top:0}.sidebar-scroll,.toc-scroll{flex-grow:1;flex-shrink:1;overflow:auto;scroll-behavior:smooth}.content{display:flex;flex-direction:column;justify-content:space-between;padding:0 3em;width:46em}.icon{display:inline-block;height:1rem;width:1rem}.icon svg{height:100%;width:100%}.announcement{align-items:center;background-color:var(--color-announcement-background);color:var(--color-announcement-text);display:flex;height:var(--header-height);overflow-x:auto}.announcement+.page{min-height:calc(100% - var(--header-height))}.announcement-content{box-sizing:border-box;min-width:100%;padding:.5rem;text-align:center;white-space:nowrap}.announcement-content a{color:var(--color-announcement-text);-webkit-text-decoration-color:var(--color-announcement-text);text-decoration-color:var(--color-announcement-text)}.announcement-content a:hover{color:var(--color-announcement-text);-webkit-text-decoration-color:var(--color-link--hover);text-decoration-color:var(--color-link--hover)}.no-js .theme-toggle-container{display:none}.theme-toggle-container{vertical-align:middle}.theme-toggle{background:transparent;border:none;cursor:pointer;padding:0}.theme-toggle svg{color:var(--color-foreground-primary);display:none;height:1rem;vertical-align:middle;width:1rem}.theme-toggle-header{float:left;padding:1rem .5rem}.nav-overlay-icon,.toc-overlay-icon{cursor:pointer;display:none}.nav-overlay-icon .icon,.toc-overlay-icon .icon{color:var(--color-foreground-secondary);height:1rem;width:1rem}.nav-overlay-icon,.toc-header-icon{align-items:center;justify-content:center}.toc-content-icon{height:1.5rem;width:1.5rem}.content-icon-container{display:flex;float:right;gap:.5rem;margin-bottom:1rem;margin-left:1rem;margin-top:1.5rem}.content-icon-container .edit-this-page svg{color:inherit;height:1rem;width:1rem}.sidebar-toggle{display:none;position:absolute}.sidebar-toggle[name=__toc]{left:20px}.sidebar-toggle:checked{left:40px}.overlay{background-color:rgba(0,0,0,.54);height:0;opacity:0;position:fixed;top:0;transition:width 0ms,height 0ms,opacity .25s ease-out;width:0}.sidebar-overlay{z-index:20}.toc-overlay{z-index:40}.sidebar-drawer{transition:left .25s ease-in-out;z-index:30}.toc-drawer{transition:right .25s ease-in-out;z-index:50}#__navigation:checked~.sidebar-overlay{height:100%;opacity:1;width:100%}#__navigation:checked~.page .sidebar-drawer{left:0;top:0}#__toc:checked~.toc-overlay{height:100%;opacity:1;width:100%}#__toc:checked~.page .toc-drawer{right:0;top:0}.back-to-top{background:var(--color-background-primary);border-radius:1rem;box-shadow:0 .2rem .5rem rgba(0,0,0,.05),0 0 1px 0 hsla(220,9%,46%,.502);display:none;font-size:.8125rem;left:0;margin-left:50%;padding:.5rem .75rem .5rem .5rem;position:fixed;text-decoration:none;top:1rem;transform:translateX(-50%);z-index:10}.back-to-top svg{fill:currentColor;display:inline-block;height:1rem;width:1rem}.back-to-top span{margin-left:.25rem}.show-back-to-top .back-to-top{align-items:center;display:flex}@media(min-width:97em){html{font-size:110%}}@media(max-width:82em){.toc-content-icon{display:flex}.toc-drawer{border-left:1px solid var(--color-background-muted);height:100vh;position:fixed;right:-15em;top:0}.toc-tree{border-left:none;font-size:var(--toc-font-size--mobile)}.sidebar-drawer{width:calc(50% - 18.5em)}}@media(max-width:67em){.nav-overlay-icon{display:flex}.sidebar-drawer{height:100vh;left:-15em;position:fixed;top:0;width:15em}.toc-header-icon{display:flex}.theme-toggle-content,.toc-content-icon{display:none}.theme-toggle-header{display:block}.mobile-header{align-items:center;display:flex;justify-content:space-between;position:-webkit-sticky;position:sticky;top:0}.mobile-header .header-left,.mobile-header .header-right{display:flex;height:var(--header-height);padding:0 var(--header-padding)}.mobile-header .header-left label,.mobile-header .header-right label{height:100%;-webkit-user-select:none;-moz-user-select:none;user-select:none;width:100%}.nav-overlay-icon .icon,.theme-toggle svg{height:1.25rem;width:1.25rem}:target{scroll-margin-top:var(--header-height)}.back-to-top{top:calc(var(--header-height) + .5rem)}.page{flex-direction:column;justify-content:center}.content{margin-left:auto;margin-right:auto}}@media(max-width:52em){.content{overflow-x:auto;width:100%}}@media(max-width:46em){.content{padding:0 1em}article aside.sidebar{float:none;margin:1rem 0;width:100%}}.admonition,.topic{background:var(--color-admonition-background);border-radius:.2rem;box-shadow:0 .2rem .5rem rgba(0,0,0,.05),0 0 .0625rem rgba(0,0,0,.1);font-size:var(--admonition-font-size);margin:1rem auto;overflow:hidden;padding:0 .5rem .5rem;page-break-inside:avoid}.admonition>:nth-child(2),.topic>:nth-child(2){margin-top:0}.admonition>:last-child,.topic>:last-child{margin-bottom:0}p.admonition-title,p.topic-title{font-size:var(--admonition-title-font-size);font-weight:500;line-height:1.3;margin:0 -.5rem .5rem;padding:.4rem .5rem .4rem 2rem;position:relative}p.admonition-title:before,p.topic-title:before{content:"";height:1rem;left:.5rem;position:absolute;width:1rem}p.admonition-title{background-color:var(--color-admonition-title-background)}p.admonition-title:before{background-color:var(--color-admonition-title);-webkit-mask-image:var(--icon-admonition-default);mask-image:var(--icon-admonition-default);-webkit-mask-repeat:no-repeat;mask-repeat:no-repeat}p.topic-title{background-color:var(--color-topic-title-background)}p.topic-title:before{background-color:var(--color-topic-title);-webkit-mask-image:var(--icon-topic-default);mask-image:var(--icon-topic-default);-webkit-mask-repeat:no-repeat;mask-repeat:no-repeat}.admonition{border-left:.2rem solid var(--color-admonition-title)}.admonition.caution{border-left-color:var(--color-admonition-title--caution)}.admonition.caution>.admonition-title{background-color:var(--color-admonition-title-background--caution)}.admonition.caution>.admonition-title:before{background-color:var(--color-admonition-title--caution);-webkit-mask-image:var(--icon-spark);mask-image:var(--icon-spark)}.admonition.warning{border-left-color:var(--color-admonition-title--warning)}.admonition.warning>.admonition-title{background-color:var(--color-admonition-title-background--warning)}.admonition.warning>.admonition-title:before{background-color:var(--color-admonition-title--warning);-webkit-mask-image:var(--icon-warning);mask-image:var(--icon-warning)}.admonition.danger{border-left-color:var(--color-admonition-title--danger)}.admonition.danger>.admonition-title{background-color:var(--color-admonition-title-background--danger)}.admonition.danger>.admonition-title:before{background-color:var(--color-admonition-title--danger);-webkit-mask-image:var(--icon-spark);mask-image:var(--icon-spark)}.admonition.attention{border-left-color:var(--color-admonition-title--attention)}.admonition.attention>.admonition-title{background-color:var(--color-admonition-title-background--attention)}.admonition.attention>.admonition-title:before{background-color:var(--color-admonition-title--attention);-webkit-mask-image:var(--icon-warning);mask-image:var(--icon-warning)}.admonition.error{border-left-color:var(--color-admonition-title--error)}.admonition.error>.admonition-title{background-color:var(--color-admonition-title-background--error)}.admonition.error>.admonition-title:before{background-color:var(--color-admonition-title--error);-webkit-mask-image:var(--icon-failure);mask-image:var(--icon-failure)}.admonition.hint{border-left-color:var(--color-admonition-title--hint)}.admonition.hint>.admonition-title{background-color:var(--color-admonition-title-background--hint)}.admonition.hint>.admonition-title:before{background-color:var(--color-admonition-title--hint);-webkit-mask-image:var(--icon-question);mask-image:var(--icon-question)}.admonition.tip{border-left-color:var(--color-admonition-title--tip)}.admonition.tip>.admonition-title{background-color:var(--color-admonition-title-background--tip)}.admonition.tip>.admonition-title:before{background-color:var(--color-admonition-title--tip);-webkit-mask-image:var(--icon-info);mask-image:var(--icon-info)}.admonition.important{border-left-color:var(--color-admonition-title--important)}.admonition.important>.admonition-title{background-color:var(--color-admonition-title-background--important)}.admonition.important>.admonition-title:before{background-color:var(--color-admonition-title--important);-webkit-mask-image:var(--icon-flame);mask-image:var(--icon-flame)}.admonition.note{border-left-color:var(--color-admonition-title--note)}.admonition.note>.admonition-title{background-color:var(--color-admonition-title-background--note)}.admonition.note>.admonition-title:before{background-color:var(--color-admonition-title--note);-webkit-mask-image:var(--icon-pencil);mask-image:var(--icon-pencil)}.admonition.seealso{border-left-color:var(--color-admonition-title--seealso)}.admonition.seealso>.admonition-title{background-color:var(--color-admonition-title-background--seealso)}.admonition.seealso>.admonition-title:before{background-color:var(--color-admonition-title--seealso);-webkit-mask-image:var(--icon-info);mask-image:var(--icon-info)}.admonition.admonition-todo{border-left-color:var(--color-admonition-title--admonition-todo)}.admonition.admonition-todo>.admonition-title{background-color:var(--color-admonition-title-background--admonition-todo)}.admonition.admonition-todo>.admonition-title:before{background-color:var(--color-admonition-title--admonition-todo);-webkit-mask-image:var(--icon-pencil);mask-image:var(--icon-pencil)}.admonition-todo>.admonition-title{text-transform:uppercase}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) dd{margin-left:2rem}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) dd>:first-child{margin-top:.125rem}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list,dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) dd>:last-child{margin-bottom:.75rem}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list>dt{font-size:var(--font-size--small);text-transform:uppercase}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list dd:empty{margin-bottom:.5rem}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list dd>ul{margin-left:-1.2rem}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list dd>ul>li>p:nth-child(2){margin-top:0}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple) .field-list dd>ul>li>p+p:last-child:empty{margin-bottom:0;margin-top:0}dl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple)>dt{color:var(--color-api-overall)}.sig:not(.sig-inline){background:var(--color-api-background);border-radius:.25rem;font-family:var(--font-stack--monospace);font-size:var(--api-font-size);font-weight:700;margin-left:-.25rem;margin-right:-.25rem;padding:.25rem .5rem .25rem 3em;text-indent:-2.5em;transition:background .1s ease-out}.sig:not(.sig-inline):hover{background:var(--color-api-background-hover)}.sig:not(.sig-inline) a.reference .viewcode-link{font-weight:400;width:3.5rem}.sig:not(.sig-inline) span.pre{overflow-wrap:anywhere}em.property{font-style:normal}em.property:first-child{color:var(--color-api-keyword)}.sig-name{color:var(--color-api-name)}.sig-prename{color:var(--color-api-pre-name);font-weight:400}.sig-paren{color:var(--color-api-paren)}.sig-param{font-style:normal}.versionmodified{font-style:italic}div.deprecated p,div.versionadded p,div.versionchanged p{margin-bottom:.125rem;margin-top:.125rem}.viewcode-back,.viewcode-link{float:right;text-align:right}.line-block{margin-bottom:.75rem;margin-top:.5rem}.line-block .line-block{margin-bottom:0;margin-top:0;padding-left:1rem}.code-block-caption,article p.caption,table>caption{font-size:var(--font-size--small);text-align:center}.toctree-wrapper.compound .caption,.toctree-wrapper.compound :not(.caption)>.caption-text{font-size:var(--font-size--small);margin-bottom:0;text-align:initial;text-transform:uppercase}.toctree-wrapper.compound>ul{margin-bottom:0;margin-top:0}.sig-inline,code.literal{background:var(--color-inline-code-background);border-radius:.2em;font-size:var(--font-size--small--2);overflow-wrap:break-word;padding:.1em .2em}p .sig-inline,p code.literal{border:1px solid var(--color-background-border)}.sig-inline{font-family:var(--font-stack--monospace)}div[class*=" highlight-"],div[class^=highlight-]{display:flex;margin:1em 0}div[class*=" highlight-"] .table-wrapper,div[class^=highlight-] .table-wrapper,pre{margin:0;padding:0}pre{overflow:auto}article[role=main] .highlight pre{line-height:1.5}.highlight pre,pre.literal-block{font-size:var(--code-font-size);padding:.625rem .875rem}pre.literal-block{background-color:var(--color-code-background);border-radius:.2rem;color:var(--color-code-foreground);margin-bottom:1rem;margin-top:1rem}.highlight{border-radius:.2rem;width:100%}.highlight .gp,.highlight span.linenos{pointer-events:none;-webkit-user-select:none;-moz-user-select:none;user-select:none}.highlight .hll{display:block;margin-left:-.875rem;margin-right:-.875rem;padding-left:.875rem;padding-right:.875rem}.code-block-caption{background-color:var(--color-code-background);border-bottom:1px solid;border-radius:.25rem;border-bottom-left-radius:0;border-bottom-right-radius:0;border-color:var(--color-background-border);color:var(--color-code-foreground);display:flex;font-weight:300;padding:.625rem .875rem}.code-block-caption+div[class]{margin-top:0}.code-block-caption+div[class] pre{border-top-left-radius:0;border-top-right-radius:0}.highlighttable{display:block;width:100%}.highlighttable tbody{display:block}.highlighttable tr{display:flex}.highlighttable td.linenos{background-color:var(--color-code-background);border-bottom-left-radius:.2rem;border-top-left-radius:.2rem;color:var(--color-code-foreground);padding:.625rem 0 .625rem .875rem}.highlighttable .linenodiv{box-shadow:-.0625rem 0 var(--color-foreground-border) inset;font-size:var(--code-font-size);padding-right:.875rem}.highlighttable td.code{display:block;flex:1;overflow:hidden;padding:0}.highlighttable td.code .highlight{border-bottom-left-radius:0;border-top-left-radius:0}.highlight span.linenos{box-shadow:-.0625rem 0 var(--color-foreground-border) inset;display:inline-block;margin-right:.875rem;padding-left:0;padding-right:.875rem}.footnote-reference{font-size:var(--font-size--small--4);vertical-align:super}dl.footnote.brackets{color:var(--color-foreground-secondary);display:grid;font-size:var(--font-size--small);grid-template-columns:-webkit-max-content auto;grid-template-columns:max-content auto}dl.footnote.brackets dt{margin:0}dl.footnote.brackets dt>.fn-backref{margin-left:.25rem}dl.footnote.brackets dt:after{content:":"}dl.footnote.brackets dt .brackets:before{content:"["}dl.footnote.brackets dt .brackets:after{content:"]"}dl.footnote.brackets dd{margin:0;padding:0 1rem}aside.footnote{color:var(--color-foreground-secondary);font-size:var(--font-size--small)}aside.footnote>span,div.citation>span{float:left;font-weight:500;padding-right:.25rem}aside.footnote>p,div.citation>p{margin-left:2rem}img{box-sizing:border-box;height:auto;max-width:100%}article .figure,article figure{border-radius:.2rem;margin:0}article .figure :last-child,article figure :last-child{margin-bottom:0}article .align-left{clear:left;float:left;margin:0 1rem 1rem}article .align-right{clear:right;float:right;margin:0 1rem 1rem}article .align-center,article .align-default{display:block;margin-left:auto;margin-right:auto;text-align:center}article table.align-default{display:table;text-align:initial}.domainindex-jumpbox,.genindex-jumpbox{border-bottom:1px solid var(--color-background-border);border-top:1px solid var(--color-background-border);padding:.25rem}.domainindex-section h2,.genindex-section h2{margin-bottom:.5rem;margin-top:.75rem}.domainindex-section ul,.genindex-section ul{margin-bottom:0;margin-top:0}ol,ul{margin-bottom:1rem;margin-top:1rem;padding-left:1.2rem}ol li>p:first-child,ul li>p:first-child{margin-bottom:.25rem;margin-top:.25rem}ol li>p:last-child,ul li>p:last-child{margin-top:.25rem}ol li>ol,ol li>ul,ul li>ol,ul li>ul{margin-bottom:.5rem;margin-top:.5rem}ol.arabic{list-style:decimal}ol.loweralpha{list-style:lower-alpha}ol.upperalpha{list-style:upper-alpha}ol.lowerroman{list-style:lower-roman}ol.upperroman{list-style:upper-roman}.simple li>ol,.simple li>ul,.toctree-wrapper li>ol,.toctree-wrapper li>ul{margin-bottom:0;margin-top:0}.field-list dt,.option-list dt,dl.footnote dt,dl.glossary dt,dl.simple dt,dl:not([class]) dt{font-weight:500;margin-top:.25rem}.field-list dt+dt,.option-list dt+dt,dl.footnote dt+dt,dl.glossary dt+dt,dl.simple dt+dt,dl:not([class]) dt+dt{margin-top:0}.field-list dt .classifier:before,.option-list dt .classifier:before,dl.footnote dt .classifier:before,dl.glossary dt .classifier:before,dl.simple dt .classifier:before,dl:not([class]) dt .classifier:before{content:":";margin-left:.2rem;margin-right:.2rem}.field-list dd ul,.field-list dd>p:first-child,.option-list dd ul,.option-list dd>p:first-child,dl.footnote dd ul,dl.footnote dd>p:first-child,dl.glossary dd ul,dl.glossary dd>p:first-child,dl.simple dd ul,dl.simple dd>p:first-child,dl:not([class]) dd ul,dl:not([class]) dd>p:first-child{margin-top:.125rem}.field-list dd ul,.option-list dd ul,dl.footnote dd ul,dl.glossary dd ul,dl.simple dd ul,dl:not([class]) dd ul{margin-bottom:.125rem}.math-wrapper{overflow-x:auto;width:100%}div.math{position:relative;text-align:center}div.math .headerlink,div.math:focus .headerlink{display:none}div.math:hover .headerlink{display:inline-block}div.math span.eqno{position:absolute;right:.5rem;top:50%;transform:translateY(-50%);z-index:1}abbr[title]{cursor:help}.problematic{color:var(--color-problematic)}kbd:not(.compound){background-color:var(--color-background-secondary);border:1px solid var(--color-foreground-border);border-radius:.2rem;box-shadow:0 .0625rem 0 rgba(0,0,0,.2),inset 0 0 0 .125rem var(--color-background-primary);color:var(--color-foreground-primary);display:inline-block;font-size:var(--font-size--small--3);margin:0 .2rem;padding:0 .2rem;vertical-align:text-bottom}blockquote{background:var(--color-background-secondary);border-left:4px solid var(--color-background-border);margin-left:0;margin-right:0;padding:.5rem 1rem}blockquote .attribution{font-weight:600;text-align:right}blockquote.highlights,blockquote.pull-quote{font-size:1.25em}blockquote.epigraph,blockquote.pull-quote{border-left-width:0;border-radius:.5rem}blockquote.highlights{background:transparent;border-left-width:0}p .reference img{vertical-align:middle}p.rubric{font-size:1.125em;font-weight:700;line-height:1.25}dd p.rubric{font-size:var(--font-size--small);font-weight:inherit;line-height:inherit;text-transform:uppercase}article .sidebar{background-color:var(--color-background-secondary);border:1px solid var(--color-background-border);border-radius:.2rem;clear:right;float:right;margin-left:1rem;margin-right:0;width:30%}article .sidebar>*{padding-left:1rem;padding-right:1rem}article .sidebar>ol,article .sidebar>ul{padding-left:2.2rem}article .sidebar .sidebar-title{border-bottom:1px solid var(--color-background-border);font-weight:500;margin:0;padding:.5rem 1rem}.table-wrapper{margin-bottom:.5rem;margin-top:1rem;overflow-x:auto;padding:.2rem .2rem .75rem;width:100%}table.docutils{border-collapse:collapse;border-radius:.2rem;border-spacing:0;box-shadow:0 .2rem .5rem rgba(0,0,0,.05),0 0 .0625rem rgba(0,0,0,.1)}table.docutils th{background:var(--color-table-header-background)}table.docutils td,table.docutils th{border-bottom:1px solid var(--color-table-border);border-left:1px solid var(--color-table-border);border-right:1px solid var(--color-table-border);padding:0 .25rem}table.docutils td p,table.docutils th p{margin:.25rem}table.docutils td:first-child,table.docutils th:first-child{border-left:none}table.docutils td:last-child,table.docutils th:last-child{border-right:none}table.docutils td.text-left,table.docutils th.text-left{text-align:left}table.docutils td.text-right,table.docutils th.text-right{text-align:right}table.docutils td.text-center,table.docutils th.text-center{text-align:center}:target{scroll-margin-top:.5rem}@media(max-width:67em){:target{scroll-margin-top:calc(.5rem + var(--header-height))}section>span:target{scroll-margin-top:calc(.8rem + var(--header-height))}}.headerlink{font-weight:100;-webkit-user-select:none;-moz-user-select:none;user-select:none}.code-block-caption>.headerlink,dl dt>.headerlink,figcaption p>.headerlink,h1>.headerlink,h2>.headerlink,h3>.headerlink,h4>.headerlink,h5>.headerlink,h6>.headerlink,p.caption>.headerlink,table>caption>.headerlink{margin-left:.5rem;visibility:hidden}.code-block-caption:hover>.headerlink,dl dt:hover>.headerlink,figcaption p:hover>.headerlink,h1:hover>.headerlink,h2:hover>.headerlink,h3:hover>.headerlink,h4:hover>.headerlink,h5:hover>.headerlink,h6:hover>.headerlink,p.caption:hover>.headerlink,table>caption:hover>.headerlink{visibility:visible}.code-block-caption>.toc-backref,dl dt>.toc-backref,figcaption p>.toc-backref,h1>.toc-backref,h2>.toc-backref,h3>.toc-backref,h4>.toc-backref,h5>.toc-backref,h6>.toc-backref,p.caption>.toc-backref,table>caption>.toc-backref{color:inherit;-webkit-text-decoration-line:none;text-decoration-line:none}figure:hover>figcaption>p>.headerlink,table:hover>caption>.headerlink{visibility:visible}:target>h1:first-of-type,:target>h2:first-of-type,:target>h3:first-of-type,:target>h4:first-of-type,:target>h5:first-of-type,:target>h6:first-of-type,span:target~h1:first-of-type,span:target~h2:first-of-type,span:target~h3:first-of-type,span:target~h4:first-of-type,span:target~h5:first-of-type,span:target~h6:first-of-type{background-color:var(--color-highlight-on-target)}:target>h1:first-of-type code.literal,:target>h2:first-of-type code.literal,:target>h3:first-of-type code.literal,:target>h4:first-of-type code.literal,:target>h5:first-of-type code.literal,:target>h6:first-of-type code.literal,span:target~h1:first-of-type code.literal,span:target~h2:first-of-type code.literal,span:target~h3:first-of-type code.literal,span:target~h4:first-of-type code.literal,span:target~h5:first-of-type code.literal,span:target~h6:first-of-type code.literal{background-color:transparent}.literal-block-wrapper:target .code-block-caption,.this-will-duplicate-information-and-it-is-still-useful-here li :target,figure:target,table:target>caption{background-color:var(--color-highlight-on-target)}dt:target{background-color:var(--color-highlight-on-target)!important}.footnote-reference:target,.footnote>dt:target+dd{background-color:var(--color-highlight-on-target)}.guilabel{background-color:var(--color-guilabel-background);border:1px solid var(--color-guilabel-border);border-radius:.5em;color:var(--color-guilabel-text);font-size:.9em;padding:0 .3em}footer{display:flex;flex-direction:column;font-size:var(--font-size--small);margin-top:2rem}.bottom-of-page{align-items:center;border-top:1px solid var(--color-background-border);color:var(--color-foreground-secondary);display:flex;justify-content:space-between;line-height:1.5;margin-top:1rem;padding-bottom:1rem;padding-top:1rem}@media(max-width:46em){.bottom-of-page{flex-direction:column-reverse;gap:.25rem;text-align:center}}.bottom-of-page .left-details{font-size:var(--font-size--small)}.bottom-of-page .right-details{display:flex;flex-direction:column;gap:.25rem;text-align:right}.bottom-of-page .icons{display:flex;font-size:1rem;gap:.25rem;justify-content:flex-end}.bottom-of-page .icons a{text-decoration:none}.bottom-of-page .icons img,.bottom-of-page .icons svg{font-size:1.125rem;height:1em;width:1em}.related-pages a{align-items:center;display:flex;text-decoration:none}.related-pages a:hover .page-info .title{color:var(--color-link);text-decoration:underline;-webkit-text-decoration-color:var(--color-link-underline);text-decoration-color:var(--color-link-underline)}.related-pages a svg.furo-related-icon,.related-pages a svg.furo-related-icon>use{color:var(--color-foreground-border);flex-shrink:0;height:.75rem;margin:0 .5rem;width:.75rem}.related-pages a.next-page{clear:right;float:right;max-width:50%;text-align:right}.related-pages a.prev-page{clear:left;float:left;max-width:50%}.related-pages a.prev-page svg{transform:rotate(180deg)}.page-info{display:flex;flex-direction:column;overflow-wrap:anywhere}.next-page .page-info{align-items:flex-end}.page-info .context{align-items:center;color:var(--color-foreground-muted);display:flex;font-size:var(--font-size--small);padding-bottom:.1rem;text-decoration:none}ul.search{list-style:none;padding-left:0}ul.search li{border-bottom:1px solid var(--color-background-border);padding:1rem 0}[role=main] .highlighted{background-color:var(--color-highlighted-background);color:var(--color-highlighted-text)}.sidebar-brand{display:flex;flex-direction:column;flex-shrink:0;padding:var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal);text-decoration:none}.sidebar-brand-text{color:var(--color-sidebar-brand-text);font-size:1.5rem;overflow-wrap:break-word}.sidebar-brand-text,.sidebar-logo-container{margin:var(--sidebar-item-spacing-vertical) 0}.sidebar-logo{display:block;margin:0 auto;max-width:100%}.sidebar-search-container{align-items:center;background:var(--color-sidebar-search-background);display:flex;margin-top:var(--sidebar-search-space-above);position:relative}.sidebar-search-container:focus-within,.sidebar-search-container:hover{background:var(--color-sidebar-search-background--focus)}.sidebar-search-container:before{background-color:var(--color-sidebar-search-icon);content:"";height:var(--sidebar-search-icon-size);left:var(--sidebar-item-spacing-horizontal);-webkit-mask-image:var(--icon-search);mask-image:var(--icon-search);position:absolute;width:var(--sidebar-search-icon-size)}.sidebar-search{background:transparent;border:none;border-bottom:1px solid var(--color-sidebar-search-border);border-top:1px solid var(--color-sidebar-search-border);box-sizing:border-box;color:var(--color-sidebar-search-foreground);padding:var(--sidebar-search-input-spacing-vertical) var(--sidebar-search-input-spacing-horizontal) var(--sidebar-search-input-spacing-vertical) calc(var(--sidebar-item-spacing-horizontal) + var(--sidebar-search-input-spacing-horizontal) + var(--sidebar-search-icon-size));width:100%;z-index:10}.sidebar-search:focus{outline:none}.sidebar-search::-moz-placeholder{font-size:var(--sidebar-search-input-font-size)}.sidebar-search::placeholder{font-size:var(--sidebar-search-input-font-size)}#searchbox .highlight-link{margin:0;padding:var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal) 0;text-align:center}#searchbox .highlight-link a{color:var(--color-sidebar-search-icon);font-size:var(--font-size--small--2)}.sidebar-tree{font-size:var(--sidebar-item-font-size);margin-bottom:var(--sidebar-item-spacing-vertical);margin-top:var(--sidebar-tree-space-above)}.sidebar-tree ul{display:flex;flex-direction:column;list-style:none;margin-bottom:0;margin-top:0;padding:0}.sidebar-tree li{margin:0;position:relative}.sidebar-tree li>ul{margin-left:var(--sidebar-item-spacing-horizontal)}.sidebar-tree .icon,.sidebar-tree .reference{color:var(--color-sidebar-link-text)}.sidebar-tree .reference{box-sizing:border-box;display:inline-block;height:100%;line-height:var(--sidebar-item-line-height);overflow-wrap:anywhere;padding:var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal);text-decoration:none;width:100%}.sidebar-tree .reference:hover{background:var(--color-sidebar-item-background--hover)}.sidebar-tree .reference.external:after{color:var(--color-sidebar-link-text);content:url("data:image/svg+xml;charset=utf-8,%3Csvg width='12' height='12' xmlns='http://www.w3.org/2000/svg' viewBox='0 0 24 24' stroke-width='1.5' stroke='%23607D8B' fill='none' stroke-linecap='round' stroke-linejoin='round'%3E%3Cpath d='M0 0h24v24H0z' stroke='none'/%3E%3Cpath d='M11 7H6a2 2 0 0 0-2 2v9a2 2 0 0 0 2 2h9a2 2 0 0 0 2-2v-5M10 14 20 4M15 4h5v5'/%3E%3C/svg%3E");margin:0 .25rem;vertical-align:middle}.sidebar-tree .current-page>.reference{font-weight:700}.sidebar-tree label{align-items:center;cursor:pointer;display:flex;height:var(--sidebar-item-height);justify-content:center;position:absolute;right:0;top:0;-webkit-user-select:none;-moz-user-select:none;user-select:none;width:var(--sidebar-expander-width)}.sidebar-tree .caption,.sidebar-tree :not(.caption)>.caption-text{color:var(--color-sidebar-caption-text);font-size:var(--sidebar-caption-font-size);font-weight:700;margin:var(--sidebar-caption-space-above) 0 0 0;padding:var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal);text-transform:uppercase}.sidebar-tree li.has-children>.reference{padding-right:var(--sidebar-expander-width)}.sidebar-tree .toctree-l1>.reference,.sidebar-tree .toctree-l1>label .icon{color:var(--color-sidebar-link-text--top-level)}.sidebar-tree label{background:var(--color-sidebar-item-expander-background)}.sidebar-tree label:hover{background:var(--color-sidebar-item-expander-background--hover)}.sidebar-tree .current>.reference{background:var(--color-sidebar-item-background--current)}.sidebar-tree .current>.reference:hover{background:var(--color-sidebar-item-background--hover)}.toctree-checkbox{display:none;position:absolute}.toctree-checkbox~ul{display:none}.toctree-checkbox~label .icon svg{transform:rotate(90deg)}.toctree-checkbox:checked~ul{display:block}.toctree-checkbox:checked~label .icon svg{transform:rotate(-90deg)}.toc-title-container{padding:var(--toc-title-padding);padding-top:var(--toc-spacing-vertical)}.toc-title{color:var(--color-toc-title-text);font-size:var(--toc-title-font-size);padding-left:var(--toc-spacing-horizontal);text-transform:uppercase}.no-toc{display:none}.toc-tree-container{padding-bottom:var(--toc-spacing-vertical)}.toc-tree{border-left:1px solid var(--color-background-border);font-size:var(--toc-font-size);line-height:1.3;padding-left:calc(var(--toc-spacing-horizontal) - var(--toc-item-spacing-horizontal))}.toc-tree>ul>li:first-child{padding-top:0}.toc-tree>ul>li:first-child>ul{padding-left:0}.toc-tree>ul>li:first-child>a{display:none}.toc-tree ul{list-style-type:none;margin-bottom:0;margin-top:0;padding-left:var(--toc-item-spacing-horizontal)}.toc-tree li{padding-top:var(--toc-item-spacing-vertical)}.toc-tree li.scroll-current>.reference{color:var(--color-toc-item-text--active);font-weight:700}.toc-tree .reference{color:var(--color-toc-item-text);overflow-wrap:anywhere;text-decoration:none}.toc-scroll{max-height:100vh;overflow-y:scroll}.contents:not(.this-will-duplicate-information-and-it-is-still-useful-here){background:rgba(255,0,0,.25);color:var(--color-problematic)}.contents:not(.this-will-duplicate-information-and-it-is-still-useful-here):before{content:"ERROR: Adding a table of contents in Furo-based documentation is unnecessary, and does not work well with existing styling.Add a 'this-will-duplicate-information-and-it-is-still-useful-here' class, if you want an escape hatch."}.text-align\:left>p{text-align:left}.text-align\:center>p{text-align:center}.text-align\:right>p{text-align:right} -/*# sourceMappingURL=furo.css.map*/ \ No newline at end of file diff --git a/docs/_static/styles/furo.css.map b/docs/_static/styles/furo.css.map deleted file mode 100644 index 92af407..0000000 --- a/docs/_static/styles/furo.css.map +++ /dev/null @@ -1 +0,0 @@ -{"version":3,"file":"styles/furo.css","mappings":"AAAA,2EAA2E,CAU3E,KAEE,6BAA8B,CAD9B,gBAEF,CASA,KACE,QACF,CAMA,KACE,aACF,CAOA,GACE,aAAc,CACd,cACF,CAUA,GACE,sBAAuB,CACvB,QAAS,CACT,gBACF,CAOA,IACE,+BAAiC,CACjC,aACF,CASA,EACE,4BACF,CAOA,YACE,kBAAmB,CACnB,yBAA0B,CAC1B,gCACF,CAMA,SAEE,kBACF,CAOA,cAGE,+BAAiC,CACjC,aACF,CAeA,QAEE,aAAc,CACd,aAAc,CACd,iBAAkB,CAClB,uBACF,CAEA,IACE,aACF,CAEA,IACE,SACF,CASA,IACE,iBACF,CAUA,sCAKE,mBAAoB,CACpB,cAAe,CACf,gBAAiB,CACjB,QACF,CAOA,aAEE,gBACF,CAOA,cAEE,mBACF,CAMA,gDAIE,yBACF,CAMA,wHAIE,iBAAkB,CAClB,SACF,CAMA,4GAIE,6BACF,CAMA,SACE,0BACF,CASA,OACE,qBAAsB,CACtB,aAAc,CACd,aAAc,CACd,cAAe,CACf,SAAU,CACV,kBACF,CAMA,SACE,uBACF,CAMA,SACE,aACF,CAOA,6BAEE,qBAAsB,CACtB,SACF,CAMA,kFAEE,WACF,CAOA,cACE,4BAA6B,CAC7B,mBACF,CAMA,yCACE,uBACF,CAOA,6BACE,yBAA0B,CAC1B,YACF,CASA,QACE,aACF,CAMA,QACE,iBACF,CAiBA,kBACE,YACF,CCvVA,aAcE,kEACE,uBAOF,WACE,iDAMF,gCACE,wBAEF,qCAEE,uBADA,uBACA,CAEF,SACE,wBAtBA,CCpBJ,iBAOE,6BAEA,mBANA,qBAEA,sBACA,0BAFA,oBAHA,4BAOA,6BANA,mBAOA,CAEF,gBACE,aCPF,KCGE,mHAEA,wGAGA,wBAAyB,CACzB,wBAAyB,CACzB,4BAA6B,CAC7B,yBAA0B,CAC1B,2BAA4B,CAG5B,sDAAuD,CACvD,gDAAiD,CACjD,wDAAyD,CAGzD,0CAA2C,CAC3C,gDAAiD,CACjD,gDAAiD,CAKjD,gCAAiC,CACjC,sCAAuC,CAGvC,2CAA4C,CAG5C,uCAAwC,CChCxC,+FAGA,uBAAwB,CAGxB,iCAAkC,CAClC,kCAAmC,CAEnC,+BAAgC,CAChC,sCAAuC,CACvC,sCAAuC,CACvC,qGAIA,mDAAoD,CAEpD,mCAAoC,CACpC,8CAA+C,CAC/C,gDAAiD,CACjD,kCAAmC,CACnC,6DAA8D,CAG9D,6BAA8B,CAC9B,6BAA8B,CAC9B,+BAAgC,CAChC,kCAAmC,CACnC,kCAAmC,CCPjC,ukBCYA,srCAZF,kaCVA,mLAOA,oTAWA,2UAaA,0CACA,gEACA,0CAGA,gEAUA,yCACA,+DAGA,4CACA,CACA,iEAGA,sGACA,uCACA,4DAGA,sCACA,2DAEA,4CACA,kEACA,oGACA,CAEA,0GACA,+CAGA,+MAOA,+EACA,wCAIA,4DACA,sEACA,kEACA,sEACA,gDAGA,+DACA,0CACA,gEACA,gGACA,CAGA,2DACA,qDAGA,0CACA,8CACA,oDACA,oDL7GF,iCAEA,iEAME,oCKyGA,yDAIA,sCACA,kCACA,sDAGA,0CACA,kEACA,oDAEA,sDAGA,oCACA,oEAIA,CAGA,yDAGA,qDACA,oDAGA,6DAIA,iEAGA,2DAEA,2DL9IE,4DAEA,gEAIF,gEKgGA,gFAIA,oNAOA,qDAEA,gFAIA,4DAIA,oEAMA,yEAIA,6DACA,0DAGA,uDAGA,qDAEA,wDLpII,6DAEA,yDACE,2DAMN,uCAIA,yCACE,8CAGF,sDMjDA,6DAKA,oCAIA,4CACA,kBAGF,sBAMA,2BAME,qCAGA,qCAEA,iCAEA,+BAEA,mCAEA,qCAIA,CACA,gCACA,gDAKA,kCAIA,6BAEA,0CAQA,kCAIF,8BAGE,8BACA,uCAGF,sCAKE,kCAEA,sDACA,uEAGE,sDACA,gGACF,wCAGI,sBACA,yHCzEJ,2BACA,qCAGF,sEAGE,kEAGA,sHAGA,2IACE,8BACA,8BAOF,uCAEA,wEAGA,sDACA,iCAKA,CAEF,qCAEE,sDACA,gCACA,gEAKA,+CAOE,sBACA,gEAGA,GAYF,yLACA,gDAGA,mBAEA,wCACA,wCAGF,CAEE,iCAGF,wBACE,mBAIF,oBAFE,eAEF,CAJE,gBAEA,CAMA,mBACA,mBAGA,mDAIA,YACA,mBAEA,CACA,kBAGF,OAJE,kBAQA,CAJF,GACE,aAGA,IACA,mCACA,qBAEF,IACE,oBAEA,aACA,CAFA,WAEA,GAEE,oBAKJ,CAPE,gBAOF,aACE,+CAGA,UAHA,kCAGA,4BACA,GAEA,uBACA,CAHA,yBAEA,CACA,yDAGF,kDAEE,SACA,8BAEA,iEAGE,yDACA,sEAEA,iEAEE,yHAKN,kDAMA,0DAIE,CANA,oBAMA,0GAOA,aAEF,CAHE,YAGF,4HAWE,+CACE,iCAIJ,0CAGE,CALE,qCAEJ,CAHI,WAMF,SAIA,0CAIA,CANF,qCAME,mBACA,gBACA,gBAIA,+CAEE,CAIF,kDAGF,CAPI,8BAGJ,CAKE,YACF,CAbE,2BAEA,CAHA,WAYF,UAEA,yBACE,kBAIA,iEAKA,iCAGA,mDAEA,mBACF,OACE,iBAQA,0CAIA,CAPA,6DAGA,CALF,qBAEE,CAOA,qCAEE,CAGA,eAHA,sBAGA,gCAKF,qBACE,WACA,aACA,sCAEA,mBAOJ,6BASE,kCACA,CAHA,sBACA,aACA,CARA,uBAGA,gBAEA,MAIA,6BAEA,yBACA,2DAEA,sBAGA,8BACA,CANA,wBAMA,2BAEE,YACA,sBACA,WAEF,CAFE,UAEF,eAeF,kBAEE,CAhBE,qDAGA,qCAOJ,CAEI,YAEJ,CAJA,2BAEI,CAIF,eACE,qBACF,4CAIE,uBACA,sBACF,cACE,CAFA,aACF,CAEE,kBADA,kBACA,yBAGF,oCACE,6DAMF,qDAGE,CC1VY,8BDgWd,oCAEA,uDAEA,CACE,8CAIA,gCAEA,YACA,8CACA,CAEA,oCAGE,CAHF,oCAGE,mBAEA,mDADA,YADA,qBACA,WACA,sBAEE,WACA,uDAEN,eAFM,YAEN,iDAGE,uCAIA,YAGF,+CAKE,kBACA,CALA,sBAKA,mBACF,aACE,aACA,yBAEJ,YAGI,CAHJ,YAOE,SACE,CAFJ,kBACE,CAHE,gBAEJ,CAHI,iBAKA,6CAIA,aACA,YEhaJ,4BAEE,aADA,iBACA,6BAEA,kCAEA,SACA,UAIA,gCACA,CALA,SAEA,SAEA,CAJA,0EAEA,CAFA,OAKA,CAGA,mDACE,iBAGF,gCACE,CADF,UACE,aAEJ,iCACE,CADF,UAEE,wCAEA,WACA,WAFA,UAEA,6CAIA,yCACA,WAGA,WAJA,UAIA,kCACE,OACA,CAFF,KAEE,cAQF,0CACE,CAFF,kBACA,CACE,wEACA,CARA,YACA,CAKF,mBAFF,OAII,eACA,CAJF,iCAJE,cAGJ,CANI,oBAEA,CAKF,SAIE,2BADA,UACA,kBAGF,sCACA,CAFF,WACE,WACA,qCACE,gCACA,2EACA,sDAKJ,aACE,mDAII,CAJJ,6CAII,kEACA,iBACE,iDACA,+CACE,aACA,WADA,+BACA,uEANN,YACE,mDAEE,kBACA,CADA,2CADF,uCACE,MACA,0DACE,yCACA,qGALJ,oCACA,uCACE,CAFF,UAEE,uEACA,+CACE,oDACA,6DANN,kCACE,kCACA,gBADA,UACA,yBACE,wDACA,cADA,UACA,qBACE,6CACA,yFALJ,sCACA,CAEE,gBACE,CAHJ,gBAGI,sBAHJ,uBACE,4DACA,4CACE,iDAJJ,2CACA,CADA,gBAEE,gBAGE,sBALJ,+BAII,iBAFF,gDACA,WACE,YADF,uCACE,6EACA,2BANN,8CACE,kDACA,0CACE,8BACA,yFACE,sBACA,sFALJ,mEACA,sBACE,kEACA,6EACE,uCACA,kEALJ,qGAEE,kEACA,6EACE,uCACA,kEALJ,8CACA,uDACE,sEACA,2EACE,sCACA,iEALJ,mGACA,qCACE,oDACA,0DACE,6GACA,gDAGR,yDCpEA,sEACE,CACA,6GACE,gEACF,iGAIF,wFACE,qDAGA,mGAEE,2CAEF,4FACE,gCACF,wGACE,8DAEE,6FAIA,iJAKN,6GACE,gDAKF,yDACA,qCAGA,6BACA,kBACA,qDAKA,oCAEA,+DAGA,2CAGE,oDAIA,oEAEE,qBAGJ,wDAIA,uCAEE,kEAEF,CACF,6CAEE,uDAEA,oCAIF,4BACE,6BAEA,gEAEE,+CAIF,0EC9FA,sDAGE,+DCLJ,sCAGE,8BAKA,wJAIE,gBACA,yGCZF,mBAQA,2MAIA,oBAOF,wGAKE,iCAEE,CAFF,wBAEE,8GAWF,mBAEE,2GAMA,mBAEA,6HAOF,YAGA,mIAOE,gBADA,YACA,4FAOF,8BACA,uBAYA,sCAEE,CAFF,qBARA,wCAEA,CAHA,8BACA,CAFA,eACA,CAGA,mBAEA,sBAEA,kDAEA,CAEE,kCACE,6BACA,4CAMJ,kDAGA,eAIA,6CACE,mCACA,0CACA,8BAEA,sCACA,cAEF,+BACE,CAHA,eAGA,YACA,4BACA,gEAGF,0DAME,sBAFA,kBAGE,+BACA,4BAIJ,aACE,oBACA,CAFF,gBAEE,yBAEA,eACA,CApHsB,YAmHtB,CACA,sECpIF,mDACA,2FAMA,iCAGA,0FAEE,eACA,CAFF,YAEE,0BACE,8CAEF,mBAIE,qCACE,CACF,yBADE,iBACF,8BAGJ,+CAKF,aACE,wCACA,kDAEF,YAEE,CAFF,YAEE,CClCA,mFDwCA,QCzCF,UAGE,CAFA,IACA,aACA,mCAGA,eACE,kCAGA,uDAGF,mBAKA,6CAGE,CALA,mBAEF,CAGE,kCAEF,CARE,kBACA,CAFA,eASF,YAEE,mBACA,CAHF,UAGE,wCC7BJ,oBDkCE,8CAEE,iBCpCJ,iBACE,wDACA,gEASE,6CCLF,CDIE,uBACA,CALF,oBACE,4BAEF,8BCAE,2CAEE,CALJ,kCAGE,CDHF,aAGA,eACE,CAJF,uBCKI,gCAEF,gDAGA,kDAGE,iBAIF,cADF,UACE,uBAEA,iCAEA,wCAEA,6CAEA,CASE,+BASJ,CAZE,4BAGE,CATF,kCAMA,kCAYF,4BACE,2DAEA,CAHF,+BACE,CADF,qBAGE,2GAGA,wIAEE,CAFF,8EAEE,qBACA,oCAGF,6RAIA,sGACE,oDChEJ,WAEF,yBACE,QACA,eAEA,gBAEE,uCAGA,CALF,iCAKE,uCAGA,0BACA,CACA,oBACA,iCClBJ,gBACE,KAGF,qBACE,YAGF,CAHE,cAGF,gCAEE,mBACA,iEAEA,oCACA,wCAEA,sBACA,WAEA,CAFA,YAEA,8EAEA,mCAFA,iBAEA,6BAIA,wEAKA,sDAIE,CARF,mDAIA,CAIE,cAEF,8CAIA,oBAFE,iBAEF,8CAGE,eAEF,CAFE,YAEF,OAEE,kBAGJ,CAJI,eACA,CAFF,mBAKF,yCCjDE,oBACA,CAFA,iBAEA,uCAKE,iBACA,qCAGA,mBCZJ,CDWI,gBCXJ,6BAEE,eACA,sBAGA,eAEA,sBACA,oDACA,iGAMA,gBAFE,YAEF,8FAME,iJClBF,YACA,gNAUE,6BAEF,oTAcI,kBACF,gHAIA,qBACE,eACF,qDACE,kBACF,6DACE,4BCxCJ,oBAEF,qCAEI,+CAGF,uBACE,uDAGJ,oBAkBE,mDAhBA,+CAaA,CAbA,oBAaA,0FAEE,CAFF,gGAbA,+BAaA,0BAGA,mQAIA,oNAEE,kCADA,gBACA,aAGJ,sDAHI,mBAGJ,yBAYI,+VACE,sDAGA,iBAHA,2BAGA,kWAGN,iDAEE,CALI,gGAGN,CAHM,gBAKJ,yCAGF,0EACE,2EAGF,iBACE,yDAOA,0EAGF,6EAEE,iBC/EA,wDACA,4DACA,qBAEA,oDCDA,6BACA,yBACA,sBAEA,iBAGF,sNAYE,iBAEA,kBAdF,wRA8BI,kBACA,iOAkBA,aACA,4DACE,uEAEA,uVAoBA,iDAKA,ieC1EJ,4BACA,CCFF,6JAEE,iDACA,sEAIA,mDAGA,iDAOF,4DAGE,8CAEA,CAEA,kBACA,CAHA,gCAEA,CACA,eADA,cACA,oBAEE,uBAFF,kCAEE,gCAEF,kBACE,CAIA,mDAEA,CAHA,uCACA,CALF,aACE,6BAEA,CAIA,gBAJA,mCACA,CADA,gBAIA,wBACA,6CAGF,YAHE,iBAGF,gCAGA,iEACA,6CAEA,qDACA,6EACA,2EACA,8GAEA,yCAGA,uBACA,CAFA,yBACA,CACA,yDAKA,kDACE,mFAKJ,oCACE,CANE,aAKJ,CACE,qEAIA,YAFA,WAEA,CAHA,aACA,CAEA,gBACE,4BACA,sBADA,aACA,gCAMF,oCACA,yDACA,2CAEA,qBAGE,kBAEA,CACA,mCAIF,CARE,YACA,CAOF,iCAEE,CAPA,oBACA,CAQA,oBACE,uDAEJ,sDAGA,CAHA,cAGA,0BACE,oDAIA,oCACA,4BACA,sBAGA,cAEA,oFAGA,sBAEA,yDACE,CAIA,iBAJA,wBAIA,6CAJA,6CAOA,4BAGJ,CAHI,cAGJ,yCAGA,kBACE,CAIA,iDAEA,CATA,YAEF,CACE,4CAGA,kBAIA,wEAEA,wDAIF,kCAOE,iDACA,CARF,WAIE,sCAGA,CANA,2CACA,CAMA,oEARF,iBACE,CACA,qCAMA,iBAuBE,uBAlBF,YAKA,2DALA,uDAKA,CALA,sBAiBA,4CACE,CALA,gRAIF,YACE,UAEN,uBACE,YACA,mCAOE,+CAGA,8BAGF,+CAGA,4BCjNA,SDiNA,qFCjNA,gDAGA,sCACA,qCACA,sDAIF,CAIE,kDAGA,CAPF,0CAOE,kBAEA,kDAEA,CAHA,eACA,CAFA,YACA,CADA,SAIA,mHAIE,CAGA,6CAFA,oCAeE,CAbF,yBACE,qBAEJ,CAGE,oBACA,CAEA,YAFA,2CACF,CACE,uBAEA,mFAEE,CALJ,oBACE,CAEA,UAEE,gCAGF,sDAEA,yCC7CJ,oCAGA,CD6CE,yXAQE,sCCrDJ,wCAGA,oCACE","sources":["webpack:///./node_modules/normalize.css/normalize.css","webpack:///./src/furo/assets/styles/base/_print.sass","webpack:///./src/furo/assets/styles/base/_screen-readers.sass","webpack:///./src/furo/assets/styles/base/_theme.sass","webpack:///./src/furo/assets/styles/variables/_fonts.scss","webpack:///./src/furo/assets/styles/variables/_spacing.scss","webpack:///./src/furo/assets/styles/variables/_icons.scss","webpack:///./src/furo/assets/styles/variables/_admonitions.scss","webpack:///./src/furo/assets/styles/variables/_colors.scss","webpack:///./src/furo/assets/styles/base/_typography.sass","webpack:///./src/furo/assets/styles/_scaffold.sass","webpack:///./src/furo/assets/styles/variables/_layout.scss","webpack:///./src/furo/assets/styles/content/_admonitions.sass","webpack:///./src/furo/assets/styles/content/_api.sass","webpack:///./src/furo/assets/styles/content/_blocks.sass","webpack:///./src/furo/assets/styles/content/_captions.sass","webpack:///./src/furo/assets/styles/content/_code.sass","webpack:///./src/furo/assets/styles/content/_footnotes.sass","webpack:///./src/furo/assets/styles/content/_images.sass","webpack:///./src/furo/assets/styles/content/_indexes.sass","webpack:///./src/furo/assets/styles/content/_lists.sass","webpack:///./src/furo/assets/styles/content/_math.sass","webpack:///./src/furo/assets/styles/content/_misc.sass","webpack:///./src/furo/assets/styles/content/_rubrics.sass","webpack:///./src/furo/assets/styles/content/_sidebar.sass","webpack:///./src/furo/assets/styles/content/_tables.sass","webpack:///./src/furo/assets/styles/content/_target.sass","webpack:///./src/furo/assets/styles/content/_gui-labels.sass","webpack:///./src/furo/assets/styles/components/_footer.sass","webpack:///./src/furo/assets/styles/components/_search.sass","webpack:///./src/furo/assets/styles/components/_sidebar.sass","webpack:///./src/furo/assets/styles/components/_table_of_contents.sass","webpack:///./src/furo/assets/styles/_shame.sass"],"sourcesContent":["/*! normalize.css v8.0.1 | MIT License | github.com/necolas/normalize.css */\n\n/* Document\n ========================================================================== */\n\n/**\n * 1. Correct the line height in all browsers.\n * 2. Prevent adjustments of font size after orientation changes in iOS.\n */\n\nhtml {\n line-height: 1.15; /* 1 */\n -webkit-text-size-adjust: 100%; /* 2 */\n}\n\n/* Sections\n ========================================================================== */\n\n/**\n * Remove the margin in all browsers.\n */\n\nbody {\n margin: 0;\n}\n\n/**\n * Render the `main` element consistently in IE.\n */\n\nmain {\n display: block;\n}\n\n/**\n * Correct the font size and margin on `h1` elements within `section` and\n * `article` contexts in Chrome, Firefox, and Safari.\n */\n\nh1 {\n font-size: 2em;\n margin: 0.67em 0;\n}\n\n/* Grouping content\n ========================================================================== */\n\n/**\n * 1. Add the correct box sizing in Firefox.\n * 2. Show the overflow in Edge and IE.\n */\n\nhr {\n box-sizing: content-box; /* 1 */\n height: 0; /* 1 */\n overflow: visible; /* 2 */\n}\n\n/**\n * 1. Correct the inheritance and scaling of font size in all browsers.\n * 2. Correct the odd `em` font sizing in all browsers.\n */\n\npre {\n font-family: monospace, monospace; /* 1 */\n font-size: 1em; /* 2 */\n}\n\n/* Text-level semantics\n ========================================================================== */\n\n/**\n * Remove the gray background on active links in IE 10.\n */\n\na {\n background-color: transparent;\n}\n\n/**\n * 1. Remove the bottom border in Chrome 57-\n * 2. Add the correct text decoration in Chrome, Edge, IE, Opera, and Safari.\n */\n\nabbr[title] {\n border-bottom: none; /* 1 */\n text-decoration: underline; /* 2 */\n text-decoration: underline dotted; /* 2 */\n}\n\n/**\n * Add the correct font weight in Chrome, Edge, and Safari.\n */\n\nb,\nstrong {\n font-weight: bolder;\n}\n\n/**\n * 1. Correct the inheritance and scaling of font size in all browsers.\n * 2. Correct the odd `em` font sizing in all browsers.\n */\n\ncode,\nkbd,\nsamp {\n font-family: monospace, monospace; /* 1 */\n font-size: 1em; /* 2 */\n}\n\n/**\n * Add the correct font size in all browsers.\n */\n\nsmall {\n font-size: 80%;\n}\n\n/**\n * Prevent `sub` and `sup` elements from affecting the line height in\n * all browsers.\n */\n\nsub,\nsup {\n font-size: 75%;\n line-height: 0;\n position: relative;\n vertical-align: baseline;\n}\n\nsub {\n bottom: -0.25em;\n}\n\nsup {\n top: -0.5em;\n}\n\n/* Embedded content\n ========================================================================== */\n\n/**\n * Remove the border on images inside links in IE 10.\n */\n\nimg {\n border-style: none;\n}\n\n/* Forms\n ========================================================================== */\n\n/**\n * 1. Change the font styles in all browsers.\n * 2. Remove the margin in Firefox and Safari.\n */\n\nbutton,\ninput,\noptgroup,\nselect,\ntextarea {\n font-family: inherit; /* 1 */\n font-size: 100%; /* 1 */\n line-height: 1.15; /* 1 */\n margin: 0; /* 2 */\n}\n\n/**\n * Show the overflow in IE.\n * 1. Show the overflow in Edge.\n */\n\nbutton,\ninput { /* 1 */\n overflow: visible;\n}\n\n/**\n * Remove the inheritance of text transform in Edge, Firefox, and IE.\n * 1. Remove the inheritance of text transform in Firefox.\n */\n\nbutton,\nselect { /* 1 */\n text-transform: none;\n}\n\n/**\n * Correct the inability to style clickable types in iOS and Safari.\n */\n\nbutton,\n[type=\"button\"],\n[type=\"reset\"],\n[type=\"submit\"] {\n -webkit-appearance: button;\n}\n\n/**\n * Remove the inner border and padding in Firefox.\n */\n\nbutton::-moz-focus-inner,\n[type=\"button\"]::-moz-focus-inner,\n[type=\"reset\"]::-moz-focus-inner,\n[type=\"submit\"]::-moz-focus-inner {\n border-style: none;\n padding: 0;\n}\n\n/**\n * Restore the focus styles unset by the previous rule.\n */\n\nbutton:-moz-focusring,\n[type=\"button\"]:-moz-focusring,\n[type=\"reset\"]:-moz-focusring,\n[type=\"submit\"]:-moz-focusring {\n outline: 1px dotted ButtonText;\n}\n\n/**\n * Correct the padding in Firefox.\n */\n\nfieldset {\n padding: 0.35em 0.75em 0.625em;\n}\n\n/**\n * 1. Correct the text wrapping in Edge and IE.\n * 2. Correct the color inheritance from `fieldset` elements in IE.\n * 3. Remove the padding so developers are not caught out when they zero out\n * `fieldset` elements in all browsers.\n */\n\nlegend {\n box-sizing: border-box; /* 1 */\n color: inherit; /* 2 */\n display: table; /* 1 */\n max-width: 100%; /* 1 */\n padding: 0; /* 3 */\n white-space: normal; /* 1 */\n}\n\n/**\n * Add the correct vertical alignment in Chrome, Firefox, and Opera.\n */\n\nprogress {\n vertical-align: baseline;\n}\n\n/**\n * Remove the default vertical scrollbar in IE 10+.\n */\n\ntextarea {\n overflow: auto;\n}\n\n/**\n * 1. Add the correct box sizing in IE 10.\n * 2. Remove the padding in IE 10.\n */\n\n[type=\"checkbox\"],\n[type=\"radio\"] {\n box-sizing: border-box; /* 1 */\n padding: 0; /* 2 */\n}\n\n/**\n * Correct the cursor style of increment and decrement buttons in Chrome.\n */\n\n[type=\"number\"]::-webkit-inner-spin-button,\n[type=\"number\"]::-webkit-outer-spin-button {\n height: auto;\n}\n\n/**\n * 1. Correct the odd appearance in Chrome and Safari.\n * 2. Correct the outline style in Safari.\n */\n\n[type=\"search\"] {\n -webkit-appearance: textfield; /* 1 */\n outline-offset: -2px; /* 2 */\n}\n\n/**\n * Remove the inner padding in Chrome and Safari on macOS.\n */\n\n[type=\"search\"]::-webkit-search-decoration {\n -webkit-appearance: none;\n}\n\n/**\n * 1. Correct the inability to style clickable types in iOS and Safari.\n * 2. Change font properties to `inherit` in Safari.\n */\n\n::-webkit-file-upload-button {\n -webkit-appearance: button; /* 1 */\n font: inherit; /* 2 */\n}\n\n/* Interactive\n ========================================================================== */\n\n/*\n * Add the correct display in Edge, IE 10+, and Firefox.\n */\n\ndetails {\n display: block;\n}\n\n/*\n * Add the correct display in all browsers.\n */\n\nsummary {\n display: list-item;\n}\n\n/* Misc\n ========================================================================== */\n\n/**\n * Add the correct display in IE 10+.\n */\n\ntemplate {\n display: none;\n}\n\n/**\n * Add the correct display in IE 10.\n */\n\n[hidden] {\n display: none;\n}\n","// This file contains styles for managing print media.\n\n////////////////////////////////////////////////////////////////////////////////\n// Hide elements not relevant to print media.\n////////////////////////////////////////////////////////////////////////////////\n@media print\n // Hide icon container.\n .content-icon-container\n display: none !important\n\n // Hide showing header links if hovering over when printing.\n .headerlink\n display: none !important\n\n // Hide mobile header.\n .mobile-header\n display: none !important\n\n // Hide navigation links.\n .related-pages\n display: none !important\n\n////////////////////////////////////////////////////////////////////////////////\n// Tweaks related to decolorization.\n////////////////////////////////////////////////////////////////////////////////\n@media print\n // Apply a border around code which no longer have a color background.\n .highlight\n border: 0.1pt solid var(--color-foreground-border)\n\n////////////////////////////////////////////////////////////////////////////////\n// Avoid page break in some relevant cases.\n////////////////////////////////////////////////////////////////////////////////\n@media print\n ul, ol, dl, a, table, pre, blockquote\n page-break-inside: avoid\n\n h1, h2, h3, h4, h5, h6, img, figure, caption\n page-break-inside: avoid\n page-break-after: avoid\n\n ul, ol, dl\n page-break-before: avoid\n",".visually-hidden\n position: absolute !important\n width: 1px !important\n height: 1px !important\n padding: 0 !important\n margin: -1px !important\n overflow: hidden !important\n clip: rect(0,0,0,0) !important\n white-space: nowrap !important\n border: 0 !important\n\n:-moz-focusring\n outline: auto\n","// This file serves as the \"skeleton\" of the theming logic.\n//\n// This contains the bulk of the logic for handling dark mode, color scheme\n// toggling and the handling of color-scheme-specific hiding of elements.\n\nbody\n @include fonts\n @include spacing\n @include icons\n @include admonitions\n @include default-admonition(#651fff, \"abstract\")\n @include default-topic(#14B8A6, \"pencil\")\n\n @include colors\n\n.only-light\n display: block !important\nhtml body .only-dark\n display: none !important\n\n// Ignore dark-mode hints if print media.\n@media not print\n // Enable dark-mode, if requested.\n body[data-theme=\"dark\"]\n @include colors-dark\n\n html & .only-light\n display: none !important\n .only-dark\n display: block !important\n\n // Enable dark mode, unless explicitly told to avoid.\n @media (prefers-color-scheme: dark)\n body:not([data-theme=\"light\"])\n @include colors-dark\n\n html & .only-light\n display: none !important\n .only-dark\n display: block !important\n\n//\n// Theme toggle presentation\n//\nbody[data-theme=\"auto\"]\n .theme-toggle svg.theme-icon-when-auto\n display: block\n\nbody[data-theme=\"dark\"]\n .theme-toggle svg.theme-icon-when-dark\n display: block\n\nbody[data-theme=\"light\"]\n .theme-toggle svg.theme-icon-when-light\n display: block\n","// Fonts used by this theme.\n//\n// There are basically two things here -- using the system font stack and\n// defining sizes for various elements in %ages. We could have also used `em`\n// but %age is easier to reason about for me.\n\n@mixin fonts {\n // These are adapted from https://systemfontstack.com/\n --font-stack: -apple-system, BlinkMacSystemFont, Segoe UI, Helvetica, Arial,\n sans-serif, Apple Color Emoji, Segoe UI Emoji;\n --font-stack--monospace: \"SFMono-Regular\", Menlo, Consolas, Monaco,\n Liberation Mono, Lucida Console, monospace;\n\n --font-size--normal: 100%;\n --font-size--small: 87.5%;\n --font-size--small--2: 81.25%;\n --font-size--small--3: 75%;\n --font-size--small--4: 62.5%;\n\n // Sidebar\n --sidebar-caption-font-size: var(--font-size--small--2);\n --sidebar-item-font-size: var(--font-size--small);\n --sidebar-search-input-font-size: var(--font-size--small);\n\n // Table of Contents\n --toc-font-size: var(--font-size--small--3);\n --toc-font-size--mobile: var(--font-size--normal);\n --toc-title-font-size: var(--font-size--small--4);\n\n // Admonitions\n //\n // These aren't defined in terms of %ages, since nesting these is permitted.\n --admonition-font-size: 0.8125rem;\n --admonition-title-font-size: 0.8125rem;\n\n // Code\n --code-font-size: var(--font-size--small--2);\n\n // API\n --api-font-size: var(--font-size--small);\n}\n","// Spacing for various elements on the page\n//\n// If the user wants to tweak things in a certain way, they are permitted to.\n// They also have to deal with the consequences though!\n\n@mixin spacing {\n // Header!\n --header-height: calc(\n var(--sidebar-item-line-height) + 4 * #{var(--sidebar-item-spacing-vertical)}\n );\n --header-padding: 0.5rem;\n\n // Sidebar\n --sidebar-tree-space-above: 1.5rem;\n --sidebar-caption-space-above: 1rem;\n\n --sidebar-item-line-height: 1rem;\n --sidebar-item-spacing-vertical: 0.5rem;\n --sidebar-item-spacing-horizontal: 1rem;\n --sidebar-item-height: calc(\n var(--sidebar-item-line-height) + 2 *#{var(--sidebar-item-spacing-vertical)}\n );\n\n --sidebar-expander-width: var(--sidebar-item-height); // be square\n\n --sidebar-search-space-above: 0.5rem;\n --sidebar-search-input-spacing-vertical: 0.5rem;\n --sidebar-search-input-spacing-horizontal: 0.5rem;\n --sidebar-search-input-height: 1rem;\n --sidebar-search-icon-size: var(--sidebar-search-input-height);\n\n // Table of Contents\n --toc-title-padding: 0.25rem 0;\n --toc-spacing-vertical: 1.5rem;\n --toc-spacing-horizontal: 1.5rem;\n --toc-item-spacing-vertical: 0.4rem;\n --toc-item-spacing-horizontal: 1rem;\n}\n","// Expose theme icons as CSS variables.\n\n$icons: (\n // Adapted from tabler-icons\n // url: https://tablericons.com/\n \"search\":\n url('data:image/svg+xml;charset=utf-8,'),\n // Factored out from mkdocs-material on 24-Aug-2020.\n // url: https://squidfunk.github.io/mkdocs-material/reference/admonitions/\n \"pencil\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"abstract\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"info\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"flame\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"question\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"warning\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"failure\":\n url('data:image/svg+xml;charset=utf-8,'),\n \"spark\":\n url('data:image/svg+xml;charset=utf-8,')\n);\n\n@mixin icons {\n @each $name, $glyph in $icons {\n --icon-#{$name}: #{$glyph};\n }\n}\n","// Admonitions\n\n// Structure of these is:\n// admonition-class: color \"icon-name\";\n//\n// The colors are translated into CSS variables below. The icons are\n// used directly in the main declarations to set the `mask-image` in\n// the title.\n\n// prettier-ignore\n$admonitions: (\n // Each of these has an reST directives for it.\n \"caution\": #ff9100 \"spark\",\n \"warning\": #ff9100 \"warning\",\n \"danger\": #ff5252 \"spark\",\n \"attention\": #ff5252 \"warning\",\n \"error\": #ff5252 \"failure\",\n \"hint\": #00c852 \"question\",\n \"tip\": #00c852 \"info\",\n \"important\": #00bfa5 \"flame\",\n \"note\": #00b0ff \"pencil\",\n \"seealso\": #448aff \"info\",\n \"admonition-todo\": #808080 \"pencil\"\n);\n\n@mixin default-admonition($color, $icon-name) {\n --color-admonition-title: #{$color};\n --color-admonition-title-background: #{rgba($color, 0.2)};\n\n --icon-admonition-default: var(--icon-#{$icon-name});\n}\n\n@mixin default-topic($color, $icon-name) {\n --color-topic-title: #{$color};\n --color-topic-title-background: #{rgba($color, 0.2)};\n\n --icon-topic-default: var(--icon-#{$icon-name});\n}\n\n@mixin admonitions {\n @each $name, $values in $admonitions {\n --color-admonition-title--#{$name}: #{nth($values, 1)};\n --color-admonition-title-background--#{$name}: #{rgba(\n nth($values, 1),\n 0.2\n )};\n }\n}\n","// Colors used throughout this theme.\n//\n// The aim is to give the user more control. Thus, instead of hard-coding colors\n// in various parts of the stylesheet, the approach taken is to define all\n// colors as CSS variables and reusing them in all the places.\n//\n// `colors-dark` depends on `colors` being included at a lower specificity.\n\n@mixin colors {\n --color-problematic: #b30000;\n\n // Base Colors\n --color-foreground-primary: black; // for main text and headings\n --color-foreground-secondary: #5a5c63; // for secondary text\n --color-foreground-muted: #646776; // for muted text\n --color-foreground-border: #878787; // for content borders\n\n --color-background-primary: white; // for content\n --color-background-secondary: #f8f9fb; // for navigation + ToC\n --color-background-hover: #efeff4ff; // for navigation-item hover\n --color-background-hover--transparent: #efeff400;\n --color-background-border: #eeebee; // for UI borders\n --color-background-item: #ccc; // for \"background\" items (eg: copybutton)\n\n // Announcements\n --color-announcement-background: #000000dd;\n --color-announcement-text: #eeebee;\n\n // Brand colors\n --color-brand-primary: #2962ff;\n --color-brand-content: #2a5adf;\n\n // API documentation\n --color-api-background: var(--color-background-hover--transparent);\n --color-api-background-hover: var(--color-background-hover);\n --color-api-overall: var(--color-foreground-secondary);\n --color-api-name: var(--color-problematic);\n --color-api-pre-name: var(--color-problematic);\n --color-api-paren: var(--color-foreground-secondary);\n --color-api-keyword: var(--color-foreground-primary);\n --color-highlight-on-target: #ffffcc;\n\n // Inline code background\n --color-inline-code-background: var(--color-background-secondary);\n\n // Highlighted text (search)\n --color-highlighted-background: #ddeeff;\n --color-highlighted-text: var(--color-foreground-primary);\n\n // GUI Labels\n --color-guilabel-background: #ddeeff80;\n --color-guilabel-border: #bedaf580;\n --color-guilabel-text: var(--color-foreground-primary);\n\n // Admonitions!\n --color-admonition-background: transparent;\n\n //////////////////////////////////////////////////////////////////////////////\n // Everything below this should be one of:\n // - var(...)\n // - *-gradient(...)\n // - special literal values (eg: transparent, none)\n //////////////////////////////////////////////////////////////////////////////\n\n // Tables\n --color-table-header-background: var(--color-background-secondary);\n --color-table-border: var(--color-background-border);\n\n // Cards\n --color-card-border: var(--color-background-secondary);\n --color-card-background: transparent;\n --color-card-marginals-background: var(--color-background-secondary);\n\n // Header\n --color-header-background: var(--color-background-primary);\n --color-header-border: var(--color-background-border);\n --color-header-text: var(--color-foreground-primary);\n\n // Sidebar (left)\n --color-sidebar-background: var(--color-background-secondary);\n --color-sidebar-background-border: var(--color-background-border);\n\n --color-sidebar-brand-text: var(--color-foreground-primary);\n --color-sidebar-caption-text: var(--color-foreground-muted);\n --color-sidebar-link-text: var(--color-foreground-secondary);\n --color-sidebar-link-text--top-level: var(--color-brand-primary);\n\n --color-sidebar-item-background: var(--color-sidebar-background);\n --color-sidebar-item-background--current: var(\n --color-sidebar-item-background\n );\n --color-sidebar-item-background--hover: linear-gradient(\n 90deg,\n var(--color-background-hover--transparent) 0%,\n var(--color-background-hover) var(--sidebar-item-spacing-horizontal),\n var(--color-background-hover) 100%\n );\n\n --color-sidebar-item-expander-background: transparent;\n --color-sidebar-item-expander-background--hover: var(\n --color-background-hover\n );\n\n --color-sidebar-search-text: var(--color-foreground-primary);\n --color-sidebar-search-background: var(--color-background-secondary);\n --color-sidebar-search-background--focus: var(--color-background-primary);\n --color-sidebar-search-border: var(--color-background-border);\n --color-sidebar-search-icon: var(--color-foreground-muted);\n\n // Table of Contents (right)\n --color-toc-background: var(--color-background-primary);\n --color-toc-title-text: var(--color-foreground-muted);\n --color-toc-item-text: var(--color-foreground-secondary);\n --color-toc-item-text--hover: var(--color-foreground-primary);\n --color-toc-item-text--active: var(--color-brand-primary);\n\n // Actual page contents\n --color-content-foreground: var(--color-foreground-primary);\n --color-content-background: transparent;\n\n // Links\n --color-link: var(--color-brand-content);\n --color-link--hover: var(--color-brand-content);\n --color-link-underline: var(--color-background-border);\n --color-link-underline--hover: var(--color-foreground-border);\n}\n\n@mixin colors-dark {\n --color-problematic: #ee5151;\n\n // Base Colors\n --color-foreground-primary: #ffffffcc; // for main text and headings\n --color-foreground-secondary: #9ca0a5; // for secondary text\n --color-foreground-muted: #81868d; // for muted text\n --color-foreground-border: #666666; // for content borders\n\n --color-background-primary: #131416; // for content\n --color-background-secondary: #1a1c1e; // for navigation + ToC\n --color-background-hover: #1e2124ff; // for navigation-item hover\n --color-background-hover--transparent: #1e212400;\n --color-background-border: #303335; // for UI borders\n --color-background-item: #444; // for \"background\" items (eg: copybutton)\n\n // Announcements\n --color-announcement-background: #000000dd;\n --color-announcement-text: #eeebee;\n\n // Brand colors\n --color-brand-primary: #2b8cee;\n --color-brand-content: #368ce2;\n\n // Highlighted text (search)\n --color-highlighted-background: #083563;\n\n // GUI Labels\n --color-guilabel-background: #08356380;\n --color-guilabel-border: #13395f80;\n\n // API documentation\n --color-api-keyword: var(--color-foreground-secondary);\n --color-highlight-on-target: #333300;\n\n // Admonitions\n --color-admonition-background: #18181a;\n\n // Cards\n --color-card-border: var(--color-background-secondary);\n --color-card-background: #18181a;\n --color-card-marginals-background: var(--color-background-hover);\n}\n","// This file contains the styling for making the content throughout the page,\n// including fonts, paragraphs, headings and spacing among these elements.\n\nbody\n font-family: var(--font-stack)\npre,\ncode,\nkbd,\nsamp\n font-family: var(--font-stack--monospace)\n\n// Make fonts look slightly nicer.\nbody\n -webkit-font-smoothing: antialiased\n -moz-osx-font-smoothing: grayscale\n\n// Line height from Bootstrap 4.1\narticle\n line-height: 1.5\n\n//\n// Headings\n//\nh1,\nh2,\nh3,\nh4,\nh5,\nh6\n line-height: 1.25\n font-weight: bold\n\n border-radius: 0.5rem\n margin-top: 0.5rem\n margin-bottom: 0.5rem\n margin-left: -0.5rem\n margin-right: -0.5rem\n padding-left: 0.5rem\n padding-right: 0.5rem\n\n + p\n margin-top: 0\n\nh1\n font-size: 2.5em\n margin-top: 1.75rem\n margin-bottom: 1rem\nh2\n font-size: 2em\n margin-top: 1.75rem\nh3\n font-size: 1.5em\nh4\n font-size: 1.25em\nh5\n font-size: 1.125em\nh6\n font-size: 1em\n\nsmall\n opacity: 75%\n font-size: 80%\n\n// Paragraph\np\n margin-top: 0.5rem\n margin-bottom: 0.75rem\n\n// Horizontal rules\nhr.docutils\n height: 1px\n padding: 0\n margin: 2rem 0\n background-color: var(--color-background-border)\n border: 0\n\n.centered\n text-align: center\n\n// Links\na\n text-decoration: underline\n\n color: var(--color-link)\n text-decoration-color: var(--color-link-underline)\n\n &:hover\n color: var(--color-link--hover)\n text-decoration-color: var(--color-link-underline--hover)\n &.muted-link\n color: inherit\n &:hover\n color: var(--color-link)\n text-decoration-color: var(--color-link-underline--hover)\n","// This file contains the styles for the overall layouting of the documentation\n// skeleton, including the responsive changes as well as sidebar toggles.\n//\n// This is implemented as a mobile-last design, which isn't ideal, but it is\n// reasonably good-enough and I got pretty tired by the time I'd finished this\n// to move the rules around to fix this. Shouldn't take more than 3-4 hours,\n// if you know what you're doing tho.\n\n// HACK: Not all browsers account for the scrollbar width in media queries.\n// This results in horizontal scrollbars in the breakpoint where we go\n// from displaying everything to hiding the ToC. We accomodate for this by\n// adding a bit of padding to the TOC drawer, disabling the horizontal\n// scrollbar and allowing the scrollbars to cover the padding.\n// https://www.456bereastreet.com/archive/201301/media_query_width_and_vertical_scrollbars/\n\n// HACK: Always having the scrollbar visible, prevents certain browsers from\n// causing the content to stutter horizontally between taller-than-viewport and\n// not-taller-than-viewport pages.\n\nhtml\n overflow-x: hidden\n overflow-y: scroll\n scroll-behavior: smooth\n\n.sidebar-scroll, .toc-scroll, article[role=main] *\n // Override Firefox scrollbar style\n scrollbar-width: thin\n scrollbar-color: var(--color-foreground-border) transparent\n\n // Override Chrome scrollbar styles\n &::-webkit-scrollbar\n width: 0.25rem\n height: 0.25rem\n &::-webkit-scrollbar-thumb\n background-color: var(--color-foreground-border)\n border-radius: 0.125rem\n\n//\n// Overalls\n//\nhtml,\nbody\n height: 100%\n color: var(--color-foreground-primary)\n background: var(--color-background-primary)\n\narticle\n color: var(--color-content-foreground)\n background: var(--color-content-background)\n\n.page\n display: flex\n // fill the viewport for pages with little content.\n min-height: 100%\n\n.mobile-header\n width: 100%\n height: var(--header-height)\n background-color: var(--color-header-background)\n color: var(--color-header-text)\n border-bottom: 1px solid var(--color-header-border)\n\n // Looks like sub-script/super-script have this, and we need this to\n // be \"on top\" of those.\n z-index: 10\n\n // We don't show the header on large screens.\n display: none\n\n // Add shadow when scrolled\n &.scrolled\n border-bottom: none\n box-shadow: 0 0 0.2rem rgba(0, 0, 0, 0.1), 0 0.2rem 0.4rem rgba(0, 0, 0, 0.2)\n\n .header-center\n a\n color: var(--color-header-text)\n text-decoration: none\n\n.main\n display: flex\n flex: 1\n\n// Sidebar (left) also covers the entire left portion of screen.\n.sidebar-drawer\n box-sizing: border-box\n\n border-right: 1px solid var(--color-sidebar-background-border)\n background: var(--color-sidebar-background)\n\n display: flex\n justify-content: flex-end\n // These next two lines took me two days to figure out.\n width: calc((100% - #{$full-width}) / 2 + #{$sidebar-width})\n min-width: $sidebar-width\n\n// Scroll-along sidebars\n.sidebar-container,\n.toc-drawer\n box-sizing: border-box\n width: $sidebar-width\n\n.toc-drawer\n background: var(--color-toc-background)\n // See HACK described on top of this document\n padding-right: 1rem\n\n.sidebar-sticky,\n.toc-sticky\n position: sticky\n top: 0\n height: min(100%, 100vh)\n height: 100vh\n\n display: flex\n flex-direction: column\n\n.sidebar-scroll,\n.toc-scroll\n flex-grow: 1\n flex-shrink: 1\n\n overflow: auto\n scroll-behavior: smooth\n\n// Central items.\n.content\n padding: 0 $content-padding\n width: $content-width\n\n display: flex\n flex-direction: column\n justify-content: space-between\n\n.icon\n display: inline-block\n height: 1rem\n width: 1rem\n svg\n width: 100%\n height: 100%\n\n//\n// Accommodate announcement banner\n//\n.announcement\n background-color: var(--color-announcement-background)\n color: var(--color-announcement-text)\n\n height: var(--header-height)\n display: flex\n align-items: center\n overflow-x: auto\n & + .page\n min-height: calc(100% - var(--header-height))\n\n.announcement-content\n box-sizing: border-box\n padding: 0.5rem\n min-width: 100%\n white-space: nowrap\n text-align: center\n\n a\n color: var(--color-announcement-text)\n text-decoration-color: var(--color-announcement-text)\n\n &:hover\n color: var(--color-announcement-text)\n text-decoration-color: var(--color-link--hover)\n\n////////////////////////////////////////////////////////////////////////////////\n// Toggles for theme\n////////////////////////////////////////////////////////////////////////////////\n.no-js .theme-toggle-container // don't show theme toggle if there's no JS\n display: none\n\n.theme-toggle-container\n vertical-align: middle\n\n.theme-toggle\n cursor: pointer\n border: none\n padding: 0\n background: transparent\n\n.theme-toggle svg\n vertical-align: middle\n height: 1rem\n width: 1rem\n color: var(--color-foreground-primary)\n display: none\n\n.theme-toggle-header\n float: left\n padding: 1rem 0.5rem\n\n////////////////////////////////////////////////////////////////////////////////\n// Toggles for elements\n////////////////////////////////////////////////////////////////////////////////\n.toc-overlay-icon, .nav-overlay-icon\n display: none\n cursor: pointer\n\n .icon\n color: var(--color-foreground-secondary)\n height: 1rem\n width: 1rem\n\n.toc-header-icon, .nav-overlay-icon\n // for when we set display: flex\n justify-content: center\n align-items: center\n\n.toc-content-icon\n height: 1.5rem\n width: 1.5rem\n\n.content-icon-container\n float: right\n display: flex\n margin-top: 1.5rem\n margin-left: 1rem\n margin-bottom: 1rem\n gap: 0.5rem\n\n .edit-this-page svg\n color: inherit\n height: 1rem\n width: 1rem\n\n.sidebar-toggle\n position: absolute\n display: none\n// \n.sidebar-toggle[name=\"__toc\"]\n left: 20px\n.sidebar-toggle:checked\n left: 40px\n// \n\n.overlay\n position: fixed\n top: 0\n width: 0\n height: 0\n\n transition: width 0ms, height 0ms, opacity 250ms ease-out\n\n opacity: 0\n background-color: rgba(0, 0, 0, 0.54)\n.sidebar-overlay\n z-index: 20\n.toc-overlay\n z-index: 40\n\n// Keep things on top and smooth.\n.sidebar-drawer\n z-index: 30\n transition: left 250ms ease-in-out\n.toc-drawer\n z-index: 50\n transition: right 250ms ease-in-out\n\n// Show the Sidebar\n#__navigation:checked\n & ~ .sidebar-overlay\n width: 100%\n height: 100%\n opacity: 1\n & ~ .page\n .sidebar-drawer\n top: 0\n left: 0\n // Show the toc sidebar\n#__toc:checked\n & ~ .toc-overlay\n width: 100%\n height: 100%\n opacity: 1\n & ~ .page\n .toc-drawer\n top: 0\n right: 0\n\n////////////////////////////////////////////////////////////////////////////////\n// Back to top\n////////////////////////////////////////////////////////////////////////////////\n.back-to-top\n text-decoration: none\n\n display: none\n position: fixed\n left: 0\n top: 1rem\n padding: 0.5rem\n padding-right: 0.75rem\n border-radius: 1rem\n font-size: 0.8125rem\n\n background: var(--color-background-primary)\n box-shadow: 0 0.2rem 0.5rem rgba(0, 0, 0, 0.05), #6b728080 0px 0px 1px 0px\n\n z-index: 10\n\n margin-left: 50%\n transform: translateX(-50%)\n svg\n height: 1rem\n width: 1rem\n fill: currentColor\n display: inline-block\n\n span\n margin-left: 0.25rem\n\n .show-back-to-top &\n display: flex\n align-items: center\n\n////////////////////////////////////////////////////////////////////////////////\n// Responsive layouting\n////////////////////////////////////////////////////////////////////////////////\n// Make things a bit bigger on bigger screens.\n@media (min-width: $full-width + $sidebar-width)\n html\n font-size: 110%\n\n@media (max-width: $full-width)\n // Collapse \"toc\" into the icon.\n .toc-content-icon\n display: flex\n .toc-drawer\n position: fixed\n height: 100vh\n top: 0\n right: -$sidebar-width\n border-left: 1px solid var(--color-background-muted)\n .toc-tree\n border-left: none\n font-size: var(--toc-font-size--mobile)\n\n // Accomodate for a changed content width.\n .sidebar-drawer\n width: calc((100% - #{$full-width - $sidebar-width}) / 2 + #{$sidebar-width})\n\n@media (max-width: $full-width - $sidebar-width)\n // Collapse \"navigation\".\n .nav-overlay-icon\n display: flex\n .sidebar-drawer\n position: fixed\n height: 100vh\n width: $sidebar-width\n\n top: 0\n left: -$sidebar-width\n\n // Swap which icon is visible.\n .toc-header-icon\n display: flex\n .toc-content-icon, .theme-toggle-content\n display: none\n .theme-toggle-header\n display: block\n\n // Show the header.\n .mobile-header\n position: sticky\n top: 0\n display: flex\n justify-content: space-between\n align-items: center\n\n .header-left,\n .header-right\n display: flex\n height: var(--header-height)\n padding: 0 var(--header-padding)\n label\n height: 100%\n width: 100%\n user-select: none\n\n .nav-overlay-icon .icon,\n .theme-toggle svg\n height: 1.25rem\n width: 1.25rem\n\n // Add a scroll margin for the content\n :target\n scroll-margin-top: var(--header-height)\n\n // Show back-to-top below the header\n .back-to-top\n top: calc(var(--header-height) + 0.5rem)\n\n // Center the page, and accommodate for the header.\n .page\n flex-direction: column\n justify-content: center\n .content\n margin-left: auto\n margin-right: auto\n\n@media (max-width: $content-width + 2* $content-padding)\n // Content should respect window limits.\n .content\n width: 100%\n overflow-x: auto\n\n@media (max-width: $content-width)\n .content\n padding: 0 $content-padding--small\n // Don't float sidebars to the right.\n article aside.sidebar\n float: none\n width: 100%\n margin: 1rem 0\n","// Overall Layout Variables\n//\n// Because CSS variables can't be used in media queries. The fact that this\n// makes the layout non-user-configurable is a good thing.\n$content-padding: 3em;\n$content-padding--small: 1em;\n$content-width: 46em;\n$sidebar-width: 15em;\n$full-width: $content-width + 2 * ($content-padding + $sidebar-width);\n","//\n// The design here is strongly inspired by mkdocs-material.\n.admonition, .topic\n margin: 1rem auto\n padding: 0 0.5rem 0.5rem 0.5rem\n\n background: var(--color-admonition-background)\n\n border-radius: 0.2rem\n box-shadow: 0 0.2rem 0.5rem rgba(0, 0, 0, 0.05), 0 0 0.0625rem rgba(0, 0, 0, 0.1)\n\n font-size: var(--admonition-font-size)\n\n overflow: hidden\n page-break-inside: avoid\n\n // First element should have no margin, since the title has it.\n > :nth-child(2)\n margin-top: 0\n\n // Last item should have no margin, since we'll control that w/ padding\n > :last-child\n margin-bottom: 0\n\np.admonition-title, p.topic-title\n position: relative\n margin: 0 -0.5rem 0.5rem\n padding-left: 2rem\n padding-right: .5rem\n padding-top: .4rem\n padding-bottom: .4rem\n\n font-weight: 500\n font-size: var(--admonition-title-font-size)\n line-height: 1.3\n\n // Our fancy icon\n &::before\n content: \"\"\n position: absolute\n left: 0.5rem\n width: 1rem\n height: 1rem\n\n// Default styles\np.admonition-title\n background-color: var(--color-admonition-title-background)\n &::before\n background-color: var(--color-admonition-title)\n mask-image: var(--icon-admonition-default)\n mask-repeat: no-repeat\n\np.topic-title\n background-color: var(--color-topic-title-background)\n &::before\n background-color: var(--color-topic-title)\n mask-image: var(--icon-topic-default)\n mask-repeat: no-repeat\n\n//\n// Variants\n//\n.admonition\n border-left: 0.2rem solid var(--color-admonition-title)\n\n @each $type, $value in $admonitions\n &.#{$type}\n border-left-color: var(--color-admonition-title--#{$type})\n > .admonition-title\n background-color: var(--color-admonition-title-background--#{$type})\n &::before\n background-color: var(--color-admonition-title--#{$type})\n mask-image: var(--icon-#{nth($value, 2)})\n\n.admonition-todo > .admonition-title\n text-transform: uppercase\n","// This file stylizes the API documentation (stuff generated by autodoc). It's\n// deeply nested due to how autodoc structures the HTML without enough classes\n// to select the relevant items.\n\n// API docs!\ndl[class]:not(.option-list):not(.field-list):not(.footnote):not(.glossary):not(.simple)\n // Tweak the spacing of all the things!\n dd\n margin-left: 2rem\n > :first-child\n margin-top: 0.125rem\n > :last-child\n margin-bottom: 0.75rem\n\n // This is used for the arguments\n .field-list\n margin-bottom: 0.75rem\n\n // \"Headings\" (like \"Parameters\" and \"Return\")\n > dt\n text-transform: uppercase\n font-size: var(--font-size--small)\n\n dd:empty\n margin-bottom: 0.5rem\n dd > ul\n margin-left: -1.2rem\n > li\n > p:nth-child(2)\n margin-top: 0\n // When the last-empty-paragraph follows a paragraph, it doesn't need\n // to augument the existing spacing.\n > p + p:last-child:empty\n margin-top: 0\n margin-bottom: 0\n\n // Colorize the elements\n > dt\n color: var(--color-api-overall)\n\n.sig:not(.sig-inline)\n font-weight: bold\n\n font-size: var(--api-font-size)\n font-family: var(--font-stack--monospace)\n\n margin-left: -0.25rem\n margin-right: -0.25rem\n padding-top: 0.25rem\n padding-bottom: 0.25rem\n padding-right: 0.5rem\n\n // These are intentionally em, to properly match the font size.\n padding-left: 3em\n text-indent: -2.5em\n\n border-radius: 0.25rem\n\n background: var(--color-api-background)\n transition: background 100ms ease-out\n\n &:hover\n background: var(--color-api-background-hover)\n\n // adjust the size of the [source] link on the right.\n a.reference\n .viewcode-link\n font-weight: normal\n width: 3.5rem\n\n // Break words when they're too long\n span.pre\n overflow-wrap: anywhere\n\nem.property\n font-style: normal\n &:first-child\n color: var(--color-api-keyword)\n.sig-name\n color: var(--color-api-name)\n.sig-prename\n font-weight: normal\n color: var(--color-api-pre-name)\n.sig-paren\n color: var(--color-api-paren)\n.sig-param\n font-style: normal\n\n.versionmodified\n font-style: italic\ndiv.versionadded, div.versionchanged, div.deprecated\n p\n margin-top: 0.125rem\n margin-bottom: 0.125rem\n\n// Align the [docs] and [source] to the right.\n.viewcode-link, .viewcode-back\n float: right\n text-align: right\n",".line-block\n margin-top: 0.5rem\n margin-bottom: 0.75rem\n .line-block\n margin-top: 0rem\n margin-bottom: 0rem\n padding-left: 1rem\n","// Captions\narticle p.caption,\ntable > caption,\n.code-block-caption\n font-size: var(--font-size--small)\n text-align: center\n\n// Caption above a TOCTree\n.toctree-wrapper.compound\n .caption, :not(.caption) > .caption-text\n font-size: var(--font-size--small)\n text-transform: uppercase\n\n text-align: initial\n margin-bottom: 0\n\n > ul\n margin-top: 0\n margin-bottom: 0\n","// Inline code\ncode.literal, .sig-inline\n background: var(--color-inline-code-background)\n border-radius: 0.2em\n // Make the font smaller, and use padding to recover.\n font-size: var(--font-size--small--2)\n padding: 0.1em 0.2em\n\n overflow-wrap: break-word\n\n p &\n border: 1px solid var(--color-background-border)\n\n.sig-inline\n font-family: var(--font-stack--monospace)\n\n// Code and Literal Blocks\n$code-spacing-vertical: 0.625rem\n$code-spacing-horizontal: 0.875rem\n\n// Wraps every literal block + line numbers.\ndiv[class*=\" highlight-\"],\ndiv[class^=\"highlight-\"]\n margin: 1em 0\n display: flex\n\n .table-wrapper\n margin: 0\n padding: 0\n\npre\n margin: 0\n padding: 0\n overflow: auto\n\n // Needed to have more specificity than pygments' \"pre\" selector. :(\n article[role=\"main\"] .highlight &\n line-height: 1.5\n\n &.literal-block,\n .highlight &\n font-size: var(--code-font-size)\n padding: $code-spacing-vertical $code-spacing-horizontal\n\n // Make it look like all the other blocks.\n &.literal-block\n margin-top: 1rem\n margin-bottom: 1rem\n\n border-radius: 0.2rem\n background-color: var(--color-code-background)\n color: var(--color-code-foreground)\n\n// All code is always contained in this.\n.highlight\n width: 100%\n border-radius: 0.2rem\n\n // Make line numbers and prompts un-selectable.\n .gp, span.linenos\n user-select: none\n pointer-events: none\n\n // Expand the line-highlighting.\n .hll\n display: block\n margin-left: -$code-spacing-horizontal\n margin-right: -$code-spacing-horizontal\n padding-left: $code-spacing-horizontal\n padding-right: $code-spacing-horizontal\n\n/* Make code block captions be nicely integrated */\n.code-block-caption\n display: flex\n padding: $code-spacing-vertical $code-spacing-horizontal\n\n border-radius: 0.25rem\n border-bottom-left-radius: 0\n border-bottom-right-radius: 0\n font-weight: 300\n border-bottom: 1px solid\n\n background-color: var(--color-code-background)\n color: var(--color-code-foreground)\n border-color: var(--color-background-border)\n\n + div[class]\n margin-top: 0\n pre\n border-top-left-radius: 0\n border-top-right-radius: 0\n\n// When `html_codeblock_linenos_style` is table.\n.highlighttable\n width: 100%\n display: block\n tbody\n display: block\n\n tr\n display: flex\n\n // Line numbers\n td.linenos\n background-color: var(--color-code-background)\n color: var(--color-code-foreground)\n padding: $code-spacing-vertical $code-spacing-horizontal\n padding-right: 0\n border-top-left-radius: 0.2rem\n border-bottom-left-radius: 0.2rem\n\n .linenodiv\n padding-right: $code-spacing-horizontal\n font-size: var(--code-font-size)\n box-shadow: -0.0625rem 0 var(--color-foreground-border) inset\n\n // Actual code\n td.code\n padding: 0\n display: block\n flex: 1\n overflow: hidden\n\n .highlight\n border-top-left-radius: 0\n border-bottom-left-radius: 0\n\n// When `html_codeblock_linenos_style` is inline.\n.highlight\n span.linenos\n display: inline-block\n padding-left: 0\n padding-right: $code-spacing-horizontal\n margin-right: $code-spacing-horizontal\n box-shadow: -0.0625rem 0 var(--color-foreground-border) inset\n","// Inline Footnote Reference\n.footnote-reference\n font-size: var(--font-size--small--4)\n vertical-align: super\n\n// Definition list, listing the content of each note.\n// docutils <= 0.17\ndl.footnote.brackets\n font-size: var(--font-size--small)\n color: var(--color-foreground-secondary)\n\n display: grid\n grid-template-columns: max-content auto\n dt\n margin: 0\n > .fn-backref\n margin-left: 0.25rem\n\n &:after\n content: \":\"\n\n .brackets\n &:before\n content: \"[\"\n &:after\n content: \"]\"\n\n dd\n margin: 0\n padding: 0 1rem\n\n// docutils >= 0.18\naside.footnote\n font-size: var(--font-size--small)\n color: var(--color-foreground-secondary)\n\naside.footnote > span,\ndiv.citation > span\n float: left\n font-weight: 500\n padding-right: 0.25rem\n\naside.footnote > p,\ndiv.citation > p\n margin-left: 2rem\n","//\n// Figures\n//\nimg\n box-sizing: border-box\n max-width: 100%\n height: auto\n\narticle\n figure, .figure\n border-radius: 0.2rem\n\n margin: 0\n :last-child\n margin-bottom: 0\n\n .align-left\n float: left\n clear: left\n margin: 0 1rem 1rem\n\n .align-right\n float: right\n clear: right\n margin: 0 1rem 1rem\n\n .align-default,\n .align-center\n display: block\n text-align: center\n margin-left: auto\n margin-right: auto\n\n // WELL, table needs to be stylised like a table.\n table.align-default\n display: table\n text-align: initial\n",".genindex-jumpbox, .domainindex-jumpbox\n border-top: 1px solid var(--color-background-border)\n border-bottom: 1px solid var(--color-background-border)\n padding: 0.25rem\n\n.genindex-section, .domainindex-section\n h2\n margin-top: 0.75rem\n margin-bottom: 0.5rem\n ul\n margin-top: 0\n margin-bottom: 0\n","ul,\nol\n padding-left: 1.2rem\n\n // Space lists out like paragraphs\n margin-top: 1rem\n margin-bottom: 1rem\n // reduce margins within li.\n li\n > p:first-child\n margin-top: 0.25rem\n margin-bottom: 0.25rem\n\n > p:last-child\n margin-top: 0.25rem\n\n > ul,\n > ol\n margin-top: 0.5rem\n margin-bottom: 0.5rem\n\nol\n &.arabic\n list-style: decimal\n &.loweralpha\n list-style: lower-alpha\n &.upperalpha\n list-style: upper-alpha\n &.lowerroman\n list-style: lower-roman\n &.upperroman\n list-style: upper-roman\n\n// Don't space lists out when they're \"simple\" or in a `.. toctree::`\n.simple,\n.toctree-wrapper\n li\n > ul,\n > ol\n margin-top: 0\n margin-bottom: 0\n\n// Definition Lists\n.field-list,\n.option-list,\ndl:not([class]),\ndl.simple,\ndl.footnote,\ndl.glossary\n dt\n font-weight: 500\n margin-top: 0.25rem\n + dt\n margin-top: 0\n\n .classifier::before\n content: \":\"\n margin-left: 0.2rem\n margin-right: 0.2rem\n\n dd\n > p:first-child,\n ul\n margin-top: 0.125rem\n\n ul\n margin-bottom: 0.125rem\n",".math-wrapper\n width: 100%\n overflow-x: auto\n\ndiv.math\n position: relative\n text-align: center\n\n .headerlink,\n &:focus .headerlink\n display: none\n\n &:hover .headerlink\n display: inline-block\n\n span.eqno\n position: absolute\n right: 0.5rem\n top: 50%\n transform: translate(0, -50%)\n z-index: 1\n","// Abbreviations\nabbr[title]\n cursor: help\n\n// \"Problematic\" content, as identified by Sphinx\n.problematic\n color: var(--color-problematic)\n\n// Keyboard / Mouse \"instructions\"\nkbd:not(.compound)\n margin: 0 0.2rem\n padding: 0 0.2rem\n border-radius: 0.2rem\n border: 1px solid var(--color-foreground-border)\n color: var(--color-foreground-primary)\n vertical-align: text-bottom\n\n font-size: var(--font-size--small--3)\n display: inline-block\n\n box-shadow: 0 0.0625rem 0 rgba(0, 0, 0, 0.2), inset 0 0 0 0.125rem var(--color-background-primary)\n\n background-color: var(--color-background-secondary)\n\n// Blockquote\nblockquote\n border-left: 4px solid var(--color-background-border)\n background: var(--color-background-secondary)\n\n margin-left: 0\n margin-right: 0\n padding: 0.5rem 1rem\n\n .attribution\n font-weight: 600\n text-align: right\n\n &.pull-quote,\n &.highlights\n font-size: 1.25em\n\n &.epigraph,\n &.pull-quote\n border-left-width: 0\n border-radius: 0.5rem\n\n &.highlights\n border-left-width: 0\n background: transparent\n\n// Center align embedded-in-text images\np .reference img\n vertical-align: middle\n","p.rubric\n line-height: 1.25\n font-weight: bold\n font-size: 1.125em\n\n // For Numpy-style documentation that's got rubrics within it.\n // https://github.com/pradyunsg/furo/discussions/505\n dd &\n line-height: inherit\n font-weight: inherit\n\n font-size: var(--font-size--small)\n text-transform: uppercase\n","article .sidebar\n float: right\n clear: right\n width: 30%\n\n margin-left: 1rem\n margin-right: 0\n\n border-radius: 0.2rem\n background-color: var(--color-background-secondary)\n border: var(--color-background-border) 1px solid\n\n > *\n padding-left: 1rem\n padding-right: 1rem\n\n > ul, > ol // lists need additional padding, because bullets.\n padding-left: 2.2rem\n\n .sidebar-title\n margin: 0\n padding: 0.5rem 1rem\n border-bottom: var(--color-background-border) 1px solid\n\n font-weight: 500\n\n// TODO: subtitle\n// TODO: dedicated variables?\n",".table-wrapper\n width: 100%\n overflow-x: auto\n margin-top: 1rem\n margin-bottom: 0.5rem\n padding: 0.2rem 0.2rem 0.75rem\n\ntable.docutils\n border-radius: 0.2rem\n border-spacing: 0\n border-collapse: collapse\n\n box-shadow: 0 0.2rem 0.5rem rgba(0, 0, 0, 0.05), 0 0 0.0625rem rgba(0, 0, 0, 0.1)\n\n th\n background: var(--color-table-header-background)\n\n td,\n th\n // Space things out properly\n padding: 0 0.25rem\n\n // Get the borders looking just-right.\n border-left: 1px solid var(--color-table-border)\n border-right: 1px solid var(--color-table-border)\n border-bottom: 1px solid var(--color-table-border)\n\n p\n margin: 0.25rem\n\n &:first-child\n border-left: none\n &:last-child\n border-right: none\n\n // MyST-parser tables set these classes for control of column alignment\n &.text-left\n text-align: left\n &.text-right\n text-align: right\n &.text-center\n text-align: center\n",":target\n scroll-margin-top: 0.5rem\n\n@media (max-width: $full-width - $sidebar-width)\n :target\n scroll-margin-top: calc(0.5rem + var(--header-height))\n\n // When a heading is selected\n section > span:target\n scroll-margin-top: calc(0.8rem + var(--header-height))\n\n// Permalinks\n.headerlink\n font-weight: 100\n user-select: none\n\nh1,\nh2,\nh3,\nh4,\nh5,\nh6,\ndl dt,\np.caption,\nfigcaption p,\ntable > caption,\n.code-block-caption\n > .headerlink\n margin-left: 0.5rem\n visibility: hidden\n &:hover > .headerlink\n visibility: visible\n\n // Don't change to link-like, if someone adds the contents directive.\n > .toc-backref\n color: inherit\n text-decoration-line: none\n\n// Figure and table captions are special.\nfigure:hover > figcaption > p > .headerlink,\ntable:hover > caption > .headerlink\n visibility: visible\n\n:target >, // Regular section[id] style anchors\nspan:target ~ // Non-regular span[id] style \"extra\" anchors\n h1,\n h2,\n h3,\n h4,\n h5,\n h6\n &:nth-of-type(1)\n background-color: var(--color-highlight-on-target)\n // .headerlink\n // visibility: visible\n code.literal\n background-color: transparent\n\ntable:target > caption,\nfigure:target\n background-color: var(--color-highlight-on-target)\n\n// Inline page contents\n.this-will-duplicate-information-and-it-is-still-useful-here li :target\n background-color: var(--color-highlight-on-target)\n\n// Code block permalinks\n.literal-block-wrapper:target .code-block-caption\n background-color: var(--color-highlight-on-target)\n\n// When a definition list item is selected\n//\n// There isn't really an alternative to !important here, due to the\n// high-specificity of API documentation's selector.\ndt:target\n background-color: var(--color-highlight-on-target) !important\n\n// When a footnote reference is selected\n.footnote > dt:target + dd,\n.footnote-reference:target\n background-color: var(--color-highlight-on-target)\n",".guilabel\n background-color: var(--color-guilabel-background)\n border: 1px solid var(--color-guilabel-border)\n color: var(--color-guilabel-text)\n\n padding: 0 0.3em\n border-radius: 0.5em\n font-size: 0.9em\n","// This file contains the styles used for stylizing the footer that's shown\n// below the content.\n\nfooter\n font-size: var(--font-size--small)\n display: flex\n flex-direction: column\n\n margin-top: 2rem\n\n// Bottom of page information\n.bottom-of-page\n display: flex\n align-items: center\n justify-content: space-between\n\n margin-top: 1rem\n padding-top: 1rem\n padding-bottom: 1rem\n\n color: var(--color-foreground-secondary)\n border-top: 1px solid var(--color-background-border)\n\n line-height: 1.5\n\n @media (max-width: $content-width)\n text-align: center\n flex-direction: column-reverse\n gap: 0.25rem\n\n .left-details\n font-size: var(--font-size--small)\n\n .right-details\n display: flex\n flex-direction: column\n gap: 0.25rem\n text-align: right\n\n .icons\n display: flex\n justify-content: flex-end\n gap: 0.25rem\n font-size: 1rem\n\n a\n text-decoration: none\n\n svg,\n img\n font-size: 1.125rem\n height: 1em\n width: 1em\n\n// Next/Prev page information\n.related-pages\n a\n display: flex\n align-items: center\n\n text-decoration: none\n &:hover .page-info .title\n text-decoration: underline\n color: var(--color-link)\n text-decoration-color: var(--color-link-underline)\n\n svg.furo-related-icon,\n svg.furo-related-icon > use\n flex-shrink: 0\n\n color: var(--color-foreground-border)\n\n width: 0.75rem\n height: 0.75rem\n margin: 0 0.5rem\n\n &.next-page\n max-width: 50%\n\n float: right\n clear: right\n text-align: right\n\n &.prev-page\n max-width: 50%\n\n float: left\n clear: left\n\n svg\n transform: rotate(180deg)\n\n.page-info\n display: flex\n flex-direction: column\n overflow-wrap: anywhere\n\n .next-page &\n align-items: flex-end\n\n .context\n display: flex\n align-items: center\n\n padding-bottom: 0.1rem\n\n color: var(--color-foreground-muted)\n font-size: var(--font-size--small)\n text-decoration: none\n","//\n// Search Page Listing\n//\nul.search\n padding-left: 0\n list-style: none\n\n li\n padding: 1rem 0\n border-bottom: 1px solid var(--color-background-border)\n\n//\n// Highlighted by links in search page\n//\n[role=main] .highlighted\n background-color: var(--color-highlighted-background)\n color: var(--color-highlighted-text)\n","// This file contains the styles for the contents of the left sidebar, which\n// contains the navigation tree, logo, search etc.\n\n////////////////////////////////////////////////////////////////////////////////\n// Brand on top of the scrollable tree.\n////////////////////////////////////////////////////////////////////////////////\n.sidebar-brand\n display: flex\n flex-direction: column\n flex-shrink: 0\n\n padding: var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal)\n text-decoration: none\n\n.sidebar-brand-text\n color: var(--color-sidebar-brand-text)\n overflow-wrap: break-word\n margin: var(--sidebar-item-spacing-vertical) 0\n font-size: 1.5rem\n\n.sidebar-logo-container\n margin: var(--sidebar-item-spacing-vertical) 0\n\n.sidebar-logo\n margin: 0 auto\n display: block\n max-width: 100%\n\n////////////////////////////////////////////////////////////////////////////////\n// Search\n////////////////////////////////////////////////////////////////////////////////\n.sidebar-search-container\n display: flex\n align-items: center\n margin-top: var(--sidebar-search-space-above)\n\n position: relative\n\n background: var(--color-sidebar-search-background)\n &:hover,\n &:focus-within\n background: var(--color-sidebar-search-background--focus)\n\n &::before\n content: \"\"\n position: absolute\n left: var(--sidebar-item-spacing-horizontal)\n width: var(--sidebar-search-icon-size)\n height: var(--sidebar-search-icon-size)\n\n background-color: var(--color-sidebar-search-icon)\n mask-image: var(--icon-search)\n\n.sidebar-search\n box-sizing: border-box\n\n border: none\n border-top: 1px solid var(--color-sidebar-search-border)\n border-bottom: 1px solid var(--color-sidebar-search-border)\n\n padding-top: var(--sidebar-search-input-spacing-vertical)\n padding-bottom: var(--sidebar-search-input-spacing-vertical)\n padding-right: var(--sidebar-search-input-spacing-horizontal)\n padding-left: calc(var(--sidebar-item-spacing-horizontal) + var(--sidebar-search-input-spacing-horizontal) + var(--sidebar-search-icon-size))\n\n width: 100%\n\n color: var(--color-sidebar-search-foreground)\n background: transparent\n z-index: 10\n\n &:focus\n outline: none\n\n &::placeholder\n font-size: var(--sidebar-search-input-font-size)\n\n//\n// Hide Search Matches link\n//\n#searchbox .highlight-link\n padding: var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal) 0\n margin: 0\n text-align: center\n\n a\n color: var(--color-sidebar-search-icon)\n font-size: var(--font-size--small--2)\n\n////////////////////////////////////////////////////////////////////////////////\n// Structure/Skeleton of the navigation tree (left)\n////////////////////////////////////////////////////////////////////////////////\n.sidebar-tree\n font-size: var(--sidebar-item-font-size)\n margin-top: var(--sidebar-tree-space-above)\n margin-bottom: var(--sidebar-item-spacing-vertical)\n\n ul\n padding: 0\n margin-top: 0\n margin-bottom: 0\n\n display: flex\n flex-direction: column\n\n list-style: none\n\n li\n position: relative\n margin: 0\n\n > ul\n margin-left: var(--sidebar-item-spacing-horizontal)\n\n .icon\n color: var(--color-sidebar-link-text)\n\n .reference\n box-sizing: border-box\n color: var(--color-sidebar-link-text)\n\n // Fill the parent.\n display: inline-block\n line-height: var(--sidebar-item-line-height)\n text-decoration: none\n\n // Don't allow long words to cause wrapping.\n overflow-wrap: anywhere\n\n height: 100%\n width: 100%\n\n padding: var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal)\n\n &:hover\n background: var(--color-sidebar-item-background--hover)\n\n // Add a nice little \"external-link\" arrow here.\n &.external::after\n content: url('data:image/svg+xml,')\n margin: 0 0.25rem\n vertical-align: middle\n color: var(--color-sidebar-link-text)\n\n // Make the current page reference bold.\n .current-page > .reference\n font-weight: bold\n\n label\n position: absolute\n top: 0\n right: 0\n height: var(--sidebar-item-height)\n width: var(--sidebar-expander-width)\n\n cursor: pointer\n user-select: none\n\n display: flex\n justify-content: center\n align-items: center\n\n .caption, :not(.caption) > .caption-text\n font-size: var(--sidebar-caption-font-size)\n color: var(--color-sidebar-caption-text)\n\n font-weight: bold\n text-transform: uppercase\n\n margin: var(--sidebar-caption-space-above) 0 0 0\n padding: var(--sidebar-item-spacing-vertical) var(--sidebar-item-spacing-horizontal)\n\n // If it has children, add a bit more padding to wrap the content to avoid\n // overlapping with the