xRange extracts a segment of characters from a DNA sequence file.
The user can specify the bases to extract using five different methods. Note that all ranges are inclusive.
Lets say the sequence is ACTCGTAATGAATAGGTCAGGGGTTCGATTCC
# Extract bases 3-10: TCGTAATG
python xRange.py define -i input.fasta --start 3 --stop 10
# Extract base 2 and the next 5 bases: CTCGTA
python xRange.py add -i input.fasta --start 2 --add 5
# Extract base 10 and the previous 5 bases: GTAATG
python xRange.py subtract -i input.fasta --stop 10 --sub 5
# Extract first 10 bases: ACTCGTAATG
python xRange.py first -i input.fasta --num 10
#Extract last 10 bases: GTTCGATTCC
python xRange.py last -i input.fasta --num 10
By default, xRange extracts a region from the first sequence it sees in the FASTA file. If a file contains multiple sequences, specify one sequence ID using the --id flag. To extract the reverse complement of a sequence, use the -r flag. Let's say a FASTA file has two sequences: seq1=ACCG and seq2= CCAT
# Extract the reverse complement of the first two bases of seq1: GT
python xRange.py first -i input.fasta --num 2 -r
# Extract the first 2 bases of seq2: CC
python xRange.py first -i input.fasta --num 2 --id seq2
By default, xRange will create an output direcotry called 'xSequences' located within the current working directory. To change the path to the output directory, use the -p or --output_path flag. to change the name of this output directory, use the -o or --output_directory flags.
By default, the name of the exported sequence extract will be xSeq.fasta. The prefix of this file can be set using the -s or --savename flag. The exported sequence will have the same sequence ID as the sequence it was extracted from unless the user wishes to change this using the --outID flag.