frontiers-nb-2015.bu.ipynb

{
 "metadata": {
  "name": "frontiers-nb-2015"
 },
 "nbformat": 3,
 "nbformat_minor": 0,
 "worksheets": [
  {
   "cells": [
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "# Introduction\n",
      "The largest challenge facing the usage of metagenomic approaches in microbiology is the need to extend traditional microbiology training to include metagenomic or sequencing data analysis. Sean Eddy (a compuational biologist at the Howard Hughes Medical Institute) nicely describes the impacts of high throughput sequencing on biology and its training in his keynote address (http://cryptogenomicon.org/2014/11/01/high-throughput-sequencing-for-neuroscience/#more-858).\n",
      "\n",
      "To facilitate the barriers to microbiologists for metagenomic assembly, we have complemented this review with a tutorial of how to estimate the abundance of reference sequences (e.g., genes, contigs, etc.) in a metagenome.  We include approaches that include using references that are both (i) available genome references or (ii) assembled from the metagenome. In general, to complete this tutorial and most metagenomic assembly, one would need:\n",
      "\n",
      "* Access to a server.  Most metagenomic assembly will require more memory than most researchers will have on their personal computers.  In this tutorial, we will provide training on the publicly accessible Amazon EC2 instances which can be rented by anyone with a registered account.\n",
      "* Access to a metagenomic dataset.  We have selected the usage of the HMP Mock Community WGS dataset (http://www.hmpdacc.org/HMMC/) for this tutorial given its availability, practical size, and availability of reference genomes.  This dataset represents a mock metagenome of 22 known organisms for which DNA was extracted from cultured isolates, combined, and sequenced.\n",
      "* Software for assembly, read mapping, and annotation.  We will demonstrate the installation of this software on an Ubuntu-based server.\n"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 0.  Getting on the same page.\n",
      "\n",
      "The first step in this tutorial is to provide all users access to a server for which these instructions can be used, regardless of what computer you may be on. To do this, we'll be using cloud computing. More specifically, Amazon Web Services Elastic Compute Cloud.\n",
      "To rent compute time off of Amazon Web Services, you'll have to sign up and pay with a credit card. The cost is pretty manageable, http://aws.amazon.com/ec2/pricing/. You should be able to complete this tutorial in less than four hours, which comes out to < $1.\n",
      "\n",
      "Once you are signed up for Amazon Web Services, you need to follow some instructions to launch a cloud \"instance\" or server. For this tutorial, we suggest you use the instructions from the Data Science Toolbox, http://datasciencetoolbox.org/#bundles. A couple things to note prior to running through those instructions:\n",
      "\n",
      "* Choose the \"in the cloud\" instructions\n",
      "* You can choose any AMI but we suggest US EAST, ami-d1737bb8\n",
      "* When you configure your instance, choose the m3.large instance\n",
      "* Do not forget to \"Add rule\" as described in the directions in Data Science Toolbox Step 2:  Add a \"custom TCP rule\" for port \"8888\" and source \"Anywhere\".\n",
      "* Complete the Data Science Instructions through Step 4.  Once you get to Step 5, refer below.\n",
      "\n",
      "If you have trouble logging into your instance and you are on a Mac or Linux OS: \n",
      "\n",
      "* Check to see that you changed permissions on your key file (the one that ends in *.pem)\n",
      "* Make sure you run the ssh command to log into the instance in the same directory as your security file or specify the location of that file\n",
      "\n",
      "Once you are logged into the instance, for example, you've successfully run the following command (except you'll have your own security file uniquely named and your own special EC2 address):\n",
      "\n",
      "    $ ssh -i MyKeyPair.pem ubuntu@ec2-XX-XX-XX-XXX.compute-1.amazonaws.com\n",
      "\n",
      "And you now have a command line that looks like:\n",
      "\n",
      "    ubuntu@ip-10-181-106-120:\n",
      "\n",
      "You need to do a couple things to get this tutorial running:\n",
      "\n",
      "Copy and paste the following commands one by one into your command line and press ENTER after each one:\n",
      "\n",
      "    cd /mnt\n",
      "    \n",
      "    sudo git clone https://github.com/germs-lab/frontiers-review-2015.git\n",
      "\n",
      "\n",
      "Next, copy and paste the following command and enter a notebook password of your choice when prompted:\n",
      "\n",
      "    dst setup base\n",
      "\n",
      "Then, copy and paste this command:\n",
      "\n",
      "    sudo ipython notebook --profile=dst --notebook-dir=/mnt/frontiers-review-2015\n",
      "\n",
      "This will start up an IPython Notebook for this tutorial.  Leave the terminal screen open and find your internet browser, preferablly Google Chrome.  You'll also need the address for your EC2 instance public DNS that you used to log in above \"e.g., ec2-XX-XX-XX-XXX\".  If you don't know it, you can always check on your AWS EC2 dashboard (see running instances) here, https://console.aws.amazon.com/ec2/v2/.\n",
      "\n",
      "On your web browser, navigate to https://ec2-XX-XX-XX-XXX:8888 (except with your specific EC2 public DNS).  Almost all web browsers will have a message that says you're heading to an unsafe place.  Don't be alarmed.  On Chrome, you can hit the \"Advanced\" options link and hit \"Proceed anyways\".  Then, type in the password (password is the one you chose above), and voila, you'll see a notebook that contains this text called \"frontiers-nb-2015\".\n",
      "\n",
      "    \n",
      "\n",
      "\n"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 1. How to use this IPython Notebook\n",
      "IPython notebooks are very useful to collaboratively train bioinformatics. These notebooks have recently been featured in Nature News (http://www.nature.com/news/interactive-notebooks-sharing-the-code-1.16261 and http://www.nature.com/news/programming-pick-up-python-1.16833)\n",
      "\n",
      "In using these notebooks, there are a few imporant things to note. There are two types of content in this tutorial: text and code. This content is placed in this notebook as \"cells\". If you click around on this page, you'll see different cells highlighted. To execute each cell (regardless of content), you hit on your keyboard SHIFT+ENTER. If the cell contains text, the content will be displayed directly. If the cell contains code, the code will then execute. Also, you can execute all cells in the notebook by going to the Cell tab where \"File, Edit, View, Insert, Cell...\" are in the top left of this webpage and selecting _Run all_."
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 2.  Download the tutorial dataset.\n",
      "\n",
      "We will begin this tutorial by downloading the HMP mock metagenome from the NCBI Short Read Archives (SRA).  Many public metagenomes are stored as SRA files in the NCBI. The easiest way to get these SRA files is to use a special set of tools called the *sratoolkit*.  If you have your dataset SRA run ID (in this case SRR172903), you can download the dataset and convert it to the standard \"fasta\" or \"fastq\" sequencing format is to use a special program to convert the file.  \n",
      "\n"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget http://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/2.4.5-2/sratoolkit.2.4.5-2-ubuntu64.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 13:48:38--  http://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/2.4.5-2/sratoolkit.2.4.5-2-ubuntu64.tar.gz\r\n",
        "Resolving ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)... 130.14.250.11, 2607:f220:41e:250::10\r\n",
        "Connecting to ftp-trace.ncbi.nlm.nih.gov (ftp-trace.ncbi.nlm.nih.gov)|130.14.250.11|:80... connected.\r\n",
        "HTTP request sent, awaiting response... 200 OK\r\n",
        "Length: 62432226 (60M) [application/x-gzip]\r\n",
        "Saving to: \u2018sratoolkit.2.4.5-2-ubuntu64.tar.gz\u2019\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 4% [>                                      ] 2,594,464   11.5MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "29% [==========>                            ] 18,323,104  41.9MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "71% [===========================>           ] 44,926,376  68.9MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "100%[======================================>] 62,432,226  73.7MB/s   in 0.8s   \r\n",
        "\r\n",
        "2015-06-26 13:48:39 (73.7 MB/s) - \u2018sratoolkit.2.4.5-2-ubuntu64.tar.gz\u2019 saved [62432226/62432226]\r\n",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 1
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!tar -xvf sratoolkit.2.4.5-2-ubuntu64.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/README\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/README-blastn\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/README-vdb-config\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/default.kfg\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/ncbi/vdb-copy.kfg\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-dump.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/abi-load.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/align-info\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/align-info.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/align-info.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/bam-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/bam-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/bam-load.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/blastn_vdb.2.2.30-2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/cache-mgr.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/cg-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/cg-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/cg-load.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/fastq-load.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/helicos-load.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-dump.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/illumina-load.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/kar\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/kar.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/kar.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/kdbmeta.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/latf-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/latf-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/latf-load.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/pacbio-load.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/prefetch\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/prefetch.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/prefetch.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/rcexplain.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/remote-fuser.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sam-dump.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-dump.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sff-load.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-kar.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-pileup.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-sort.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/sra-stat.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/srapath\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/srapath.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/srapath.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/srf-load\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/srf-load.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/srf-load.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/tblastn_vdb.2.2.30-2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/test-sra\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/test-sra.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/test-sra.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-config.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-copy.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-decrypt.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-dump.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-encrypt.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-lock.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-passwd.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-unlock.2.4.5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate.2\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/bin/vdb-validate.2.4.5\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/base-stats.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/dump-reference.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/gene-lookup.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/mismatch-stats.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/quality-stats.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/simplefastq.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/example/perl/splitfastq.pl\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/align.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/mate-cache.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/qstat.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/refseq.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/align/seq.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/insdc/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/insdc/insdc.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/insdc/seq.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/insdc/sra.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/clip.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/ncbi.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/pnbrdb.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/seq-graph.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/seq.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/spotname.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/sra.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/stats.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/varloc.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/ncbi/wgs-contig.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/454.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/abi.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/helicos.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/illumina.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/ion-torrent.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/pacbio.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/sra/pevents.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/vdb/\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/vdb/built-in.vschema\r\n",
        "sratoolkit.2.4.5-2-ubuntu64/schema/vdb/vdb.vschema\r\n"
       ]
      }
     ],
     "prompt_number": 2
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "You can see that we now have a file containing the software with the \"ls\" command.  You'll also see this notebook in the list of files in the present location we are working in."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!ls"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "assemstats3.py\t\t    khmer-install.sh\r\n",
        "bowtie.sh\t\t    kmer-count-plot.py\r\n",
        "fastx_install.sh\t    LICENSE.md\r\n",
        "fetch-genomes-fasta.py\t    ncbi_acc.txt\r\n",
        "fraggenescan-install.sh     README.md\r\n",
        "frontiers-nb-2015.bu.ipynb  remove_output.py\r\n",
        "frontiers-nb-2015.ipynb     sratoolkit.2.4.5-2-ubuntu64\r\n",
        "install-megahit.sh\t    sratoolkit.2.4.5-2-ubuntu64.tar.gz\r\n",
        "ipython_notebook_config.py  unique-kmers.py\r\n",
        "khmer\r\n"
       ]
      }
     ],
     "prompt_number": 3
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Now we'll use the installed sratoolkit program to download the HMP mock dataset in \"fastq\" format. (This takes a minute or two.  You'll find that patience is require for working with metagenomes.  The nice thing about working in the cloud is that you are \"renting\" the computational power so it is not using your personal computer's memory -- freeing it up for things you can do while waiting.  You'll note that you can see that \"Kernel busy\" will be shown on the top-right corner of the screen below \"Logout\" button.)"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!sratoolkit.2.4.5-2-ubuntu64/bin/fastq-dump SRR172903"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Read 7932819 spots for SRR172903\r\n",
        "Written 7932819 spots for SRR172903\r\n"
       ]
      }
     ],
     "prompt_number": 4
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 3.  Quality control\n",
      "\n",
      "There are a number of methods to determine the quality of the sequencing data that you will assemble.  First, one can look at the quality scores of your sequencing reads and if desired, trim reads with quality scores that are not sufficient for your needs.  A vast number of tools are available to perform quality trimming of sequencing reads, including tools with nice tutorials including FastX Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/ and http://khmer-protocols.readthedocs.org/en/v0.8-1/metagenomics/1-quality.html), FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ and http://ged.msu.edu/angus/tutorials-2013/short-read-quality-evaluation.html) and Sickle (https://github.com/najoshi/sickle and http://2014-5-metagenomics-workshop.readthedocs.org/en/latest/assembly/qtrim.html).\n",
      " \n",
      "The sequencing data file you have downloaded is a \"fastq\" text file, where data describing each sequencing read is shown on four lines.  Let's take a quick look:"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head -n 4 SRR172903.fastq"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "@SRR172903.1 USI-EAS376:2:1:2:1414 length=75\r\n",
        "CTTACCACCAGGAACNAACTTTGAGATTCCAAAAGATCGAGTACCAGAGGGATGGACAGTAACAGTAGATCCAGA\r\n",
        "+SRR172903.1 USI-EAS376:2:1:2:1414 length=75\r\n",
        "BB@BBBABB????<=%04@@>A?6><<AB@7:@A?@>A@AA8@>59==???887905<?6>25=###########\r\n"
       ]
      }
     ],
     "prompt_number": 5
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "* This first line (starting with \"@SRR172903.1\") is the read identifier, it usually shows the read ID, some information for the sequencing facility about the run that it was obtained on.\n",
      "* The second line is the DNA sequence.\n",
      "* The third line is the same as the first line but replacing the \"@\" with a \"+\", sometimes this is only a \"+\" in some datasets\n",
      "* The fourth line gives you information on the quality score of each base pair for the DNA sequence.  Note that it is the same length as the DNA sequence and that quality scores are based on ASCII character scores (with an offset determined by the sequencing technology, Illumina is currently an offset of 64, e.g., ASCII code 64 = 0 Phred score).  The quality score is equal to the -10 * log (p), where p is the probability of the base being called wrong (e.g., if Q= 20, p=0.01, 1% probability base is called wrong).    \n",
      "\n",
      "For this tutorial, we will be removing reads that have more than 50% of the read length with a Phred score of less than 33.  We will be using Fastx-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/commandline.html) which can be used for many types of quality control (e.g., adapter trimming).  First, we will download, uncompress, and then install this program."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget https://github.com/agordon/fastx_toolkit/releases/download/0.0.14/fastx_toolkit-0.0.14.tar.bz2\n",
      "!wget https://github.com/agordon/libgtextutils/releases/download/0.7/libgtextutils-0.7.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 13:49:56--  https://github.com/agordon/fastx_toolkit/releases/download/0.0.14/fastx_toolkit-0.0.14.tar.bz2\r\n",
        "Resolving github.com (github.com)... 192.30.252.131\r\n",
        "Connecting to github.com (github.com)|192.30.252.131|:443... connected.\r\n",
        "HTTP request sent, awaiting response... 302 Found\r\n",
        "Location: https://s3.amazonaws.com/github-cloud/releases/14233196/f0821c9e-764e-11e3-99f0-a5603899c05f.bz2?response-content-disposition=attachment%3B%20filename%3Dfastx_toolkit-0.0.14.tar.bz2&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=Djr691B6%2B06IT0vVIfSLO%2FT1PF8%3D [following]\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 13:49:56--  https://s3.amazonaws.com/github-cloud/releases/14233196/f0821c9e-764e-11e3-99f0-a5603899c05f.bz2?response-content-disposition=attachment%3B%20filename%3Dfastx_toolkit-0.0.14.tar.bz2&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=Djr691B6%2B06IT0vVIfSLO%2FT1PF8%3D\r\n",
        "Resolving s3.amazonaws.com (s3.amazonaws.com)... 54.231.13.104\r\n",
        "Connecting to s3.amazonaws.com (s3.amazonaws.com)|54.231.13.104|:443... connected.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "200 OK\r\n",
        "Length: 543018 (530K) [application/octet-stream]\r\n",
        "Saving to: \u2018fastx_toolkit-0.0.14.tar.bz2\u2019\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              \r",
        "100%[======================================>] 543,018     --.-K/s   in 0.01s   \r\n",
        "\r\n",
        "2015-06-26 13:49:56 (35.1 MB/s) - \u2018fastx_toolkit-0.0.14.tar.bz2\u2019 saved [543018/543018]\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 13:49:56--  https://github.com/agordon/libgtextutils/releases/download/0.7/libgtextutils-0.7.tar.gz\r\n",
        "Resolving github.com (github.com)... 192.30.252.131\r\n",
        "Connecting to github.com (github.com)|192.30.252.131|:443... connected.\r\n",
        "HTTP request sent, awaiting response... 302 Found\r\n",
        "Location: https://s3.amazonaws.com/github-cloud/releases/14094273/4a8d6664-764d-11e3-8b5c-5a4aa996a4a9.gz?response-content-disposition=attachment%3B%20filename%3Dlibgtextutils-0.7.tar.gz&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=q1YeK9XyC4UMf3nD0Xuu0NvBxvE%3D [following]\r\n",
        "--2015-06-26 13:49:56--  https://s3.amazonaws.com/github-cloud/releases/14094273/4a8d6664-764d-11e3-8b5c-5a4aa996a4a9.gz?response-content-disposition=attachment%3B%20filename%3Dlibgtextutils-0.7.tar.gz&response-content-type=application/octet-stream&AWSAccessKeyId=AKIAISTNZFOVBIJMK3TQ&Expires=1435326656&Signature=q1YeK9XyC4UMf3nD0Xuu0NvBxvE%3D\r\n",
        "Resolving s3.amazonaws.com (s3.amazonaws.com)... 54.231.13.104\r\n",
        "Connecting to s3.amazonaws.com (s3.amazonaws.com)|54.231.13.104|:443... connected.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "200 OK\r\n",
        "Length: 358602 (350K) [application/octet-stream]\r\n",
        "Saving to: \u2018libgtextutils-0.7.tar.gz\u2019\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              \r",
        "100%[======================================>] 358,602     --.-K/s   in 0.01s   \r\n",
        "\r\n",
        "2015-06-26 13:49:56 (28.4 MB/s) - \u2018libgtextutils-0.7.tar.gz\u2019 saved [358602/358602]\r\n",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 6
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!tar -xvf fastx_toolkit-0.0.14.tar.bz2\n",
      "!tar -xvf libgtextutils-0.7.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "fastx_toolkit-0.0.14/\r\n",
        "fastx_toolkit-0.0.14/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/m4/\r\n",
        "fastx_toolkit-0.0.14/m4/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/m4/ax_cxx_header_stdcxx_tr1.m4\r\n",
        "fastx_toolkit-0.0.14/m4/libtool.m4\r\n",
        "fastx_toolkit-0.0.14/m4/ax_c_long_long.m4\r\n",
        "fastx_toolkit-0.0.14/m4/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/m4/ax_cxx_compile_stdcxx_11.m4\r\n",
        "fastx_toolkit-0.0.14/m4/lt~obsolete.m4\r\n",
        "fastx_toolkit-0.0.14/m4/ltsugar.m4\r\n",
        "fastx_toolkit-0.0.14/m4/ltversion.m4\r\n",
        "fastx_toolkit-0.0.14/m4/ltoptions.m4\r\n",
        "fastx_toolkit-0.0.14/doc/\r\n",
        "fastx_toolkit-0.0.14/doc/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/doc/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/config.h.in\r\n",
        "fastx_toolkit-0.0.14/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/install_galaxy_files.sh\r\n",
        "fastx_toolkit-0.0.14/src/\r\n",
        "fastx_toolkit-0.0.14/src/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_converter/\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_converter/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_converter/fastq_quality_converter.c\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_converter/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_filter/\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_filter/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_filter/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_filter/fastq_quality_filter.c\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/fastx_args.c\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/sequence_alignment.h\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/fastx_args.h\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/fastx.h\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/fastx.c\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/sequence_alignment.cpp\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/chomp.h\r\n",
        "fastx_toolkit-0.0.14/src/libfastx/chomp.c\r\n",
        "fastx_toolkit-0.0.14/src/fastx_trimmer/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_trimmer/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_trimmer/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_trimmer/fastx_trimmer.c\r\n",
        "fastx_toolkit-0.0.14/src/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_reverse_complement/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_reverse_complement/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_reverse_complement/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_reverse_complement/fastx_reverse_complement.c\r\n",
        "fastx_toolkit-0.0.14/src/fastx_collapser/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_collapser/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_collapser/fastx_collapser.cpp\r\n",
        "fastx_toolkit-0.0.14/src/fastx_collapser/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_collapser/std_hash.h\r\n",
        "fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/\r\n",
        "fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/fasta_nucleotide_changer.c\r\n",
        "fastx_toolkit-0.0.14/src/fasta_nucleotide_changer/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_uncollapser/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_uncollapser/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_uncollapser/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_uncollapser/fastx_uncollapser.cpp\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_trimmer/\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_trimmer/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_trimmer/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastq_quality_trimmer/fastq_quality_trimmer.c\r\n",
        "fastx_toolkit-0.0.14/src/fastq_to_fasta/\r\n",
        "fastx_toolkit-0.0.14/src/fastq_to_fasta/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_to_fasta/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastq_to_fasta/fastq_to_fasta.c\r\n",
        "fastx_toolkit-0.0.14/src/fastx_renamer/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_renamer/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_renamer/fastx_renamer.c\r\n",
        "fastx_toolkit-0.0.14/src/fastx_renamer/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_artifacts_filter/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_artifacts_filter/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_artifacts_filter/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_artifacts_filter/fastx_artifacts_filter.c\r\n",
        "fastx_toolkit-0.0.14/src/fastq_masker/\r\n",
        "fastx_toolkit-0.0.14/src/fastq_masker/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastq_masker/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastq_masker/fastq_masker.c\r\n",
        "fastx_toolkit-0.0.14/src/fastx_quality_stats/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_quality_stats/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_quality_stats/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fastx_quality_stats/fastx_quality_stats.c\r\n",
        "fastx_toolkit-0.0.14/src/seqalign_test/\r\n",
        "fastx_toolkit-0.0.14/src/seqalign_test/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/seqalign_test/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/seqalign_test/seqalign_test.cpp\r\n",
        "fastx_toolkit-0.0.14/src/fastx_clipper/\r\n",
        "fastx_toolkit-0.0.14/src/fastx_clipper/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fastx_clipper/fastx_clipper.cpp\r\n",
        "fastx_toolkit-0.0.14/src/fastx_clipper/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fasta_formatter/\r\n",
        "fastx_toolkit-0.0.14/src/fasta_formatter/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/src/fasta_formatter/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/src/fasta_formatter/sequence_writers.h\r\n",
        "fastx_toolkit-0.0.14/src/fasta_formatter/fasta_formatter.cpp\r\n",
        "fastx_toolkit-0.0.14/NEWS\r\n",
        "fastx_toolkit-0.0.14/README\r\n",
        "fastx_toolkit-0.0.14/configure.ac\r\n",
        "fastx_toolkit-0.0.14/ChangeLog\r\n",
        "fastx_toolkit-0.0.14/scripts/\r\n",
        "fastx_toolkit-0.0.14/scripts/Makefile.in\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "fastx_toolkit-0.0.14/scripts/fastx_barcode_splitter.pl\r\n",
        "fastx_toolkit-0.0.14/scripts/fastx_nucleotide_distribution_line_graph.sh\r\n",
        "fastx_toolkit-0.0.14/scripts/fastx_nucleotide_distribution_graph.sh\r\n",
        "fastx_toolkit-0.0.14/scripts/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/scripts/fasta_clipping_histogram.pl\r\n",
        "fastx_toolkit-0.0.14/scripts/fastq_quality_boxplot_graph.sh\r\n",
        "fastx_toolkit-0.0.14/build_scripts/\r\n",
        "fastx_toolkit-0.0.14/build_scripts/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/build_scripts/build_on_opensolaris_2009.6.sh\r\n",
        "fastx_toolkit-0.0.14/build_scripts/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/build_scripts/build_on_linux.sh\r\n",
        "fastx_toolkit-0.0.14/COPYING\r\n",
        "fastx_toolkit-0.0.14/galaxy/\r\n",
        "fastx_toolkit-0.0.14/galaxy/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/barcode_splitter_output_example.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_3.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_line_graph.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_4.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastx_clipper_illustration.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastx_clipper_example.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_rev_comp2.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_stats1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_stats1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1a.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_reverse_complement1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2n.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_collapser1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_collapser1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1b.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer2.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer2.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_filter1b.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts2.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.txt\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_trimmer1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_reverse_complement2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_to_fasta1a.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_artifacts1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastq_qual_conv1a.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_clipper1a.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_nuc_changer2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter2.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_rev_comp1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter1.out\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_clipper1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fasta_formatter1.fasta\r\n",
        "fastx_toolkit-0.0.14/galaxy/test-data/fastx_barcode_splitter1.fastq\r\n",
        "fastx_toolkit-0.0.14/galaxy/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/README\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_barcode_splitter_galaxy_wrapper.sh\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_trimmer.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_clipper.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution_line.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_masker.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_uncollapser.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_renamer.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_trimmer.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_trimmer_from_end.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/seqid_uncollapser.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastx_collapser.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_formatter.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit/fasta_nucleotide_changer.xml\r\n",
        "fastx_toolkit-0.0.14/galaxy/tools/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/tool-data/\r\n",
        "fastx_toolkit-0.0.14/galaxy/tool-data/Makefile.in\r\n",
        "fastx_toolkit-0.0.14/galaxy/tool-data/fastx_clipper_sequences.txt\r\n",
        "fastx_toolkit-0.0.14/galaxy/tool-data/Makefile.am\r\n",
        "fastx_toolkit-0.0.14/galaxy/fastx_toolkit_conf.xml\r\n",
        "fastx_toolkit-0.0.14/INSTALL\r\n",
        "fastx_toolkit-0.0.14/aclocal.m4\r\n",
        "fastx_toolkit-0.0.14/AUTHORS\r\n",
        "fastx_toolkit-0.0.14/reconf\r\n",
        "fastx_toolkit-0.0.14/THANKS\r\n",
        "fastx_toolkit-0.0.14/config/\r\n",
        "fastx_toolkit-0.0.14/config/install-sh\r\n",
        "fastx_toolkit-0.0.14/config/compile\r\n",
        "fastx_toolkit-0.0.14/config/missing\r\n",
        "fastx_toolkit-0.0.14/config/depcomp\r\n",
        "fastx_toolkit-0.0.14/config/config.guess\r\n",
        "fastx_toolkit-0.0.14/config/ltmain.sh\r\n",
        "fastx_toolkit-0.0.14/config/config.sub\r\n",
        "fastx_toolkit-0.0.14/configure\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libgtextutils-0.7/\r\n",
        "libgtextutils-0.7/Makefile.in\r\n",
        "libgtextutils-0.7/m4/\r\n",
        "libgtextutils-0.7/m4/Makefile.in\r\n",
        "libgtextutils-0.7/m4/libtool.m4\r\n",
        "libgtextutils-0.7/m4/Makefile.am\r\n",
        "libgtextutils-0.7/m4/lt~obsolete.m4\r\n",
        "libgtextutils-0.7/m4/ltsugar.m4\r\n",
        "libgtextutils-0.7/m4/ltversion.m4\r\n",
        "libgtextutils-0.7/m4/ltoptions.m4\r\n",
        "libgtextutils-0.7/doc/\r\n",
        "libgtextutils-0.7/doc/Makefile.in\r\n",
        "libgtextutils-0.7/doc/Makefile.am\r\n",
        "libgtextutils-0.7/gtextutils.pc.in\r\n",
        "libgtextutils-0.7/config.h.in\r\n",
        "libgtextutils-0.7/Makefile.am\r\n",
        "libgtextutils-0.7/src/\r\n",
        "libgtextutils-0.7/src/Makefile.in\r\n",
        "libgtextutils-0.7/src/gtextutils/\r\n",
        "libgtextutils-0.7/src/gtextutils/Makefile.in\r\n",
        "libgtextutils-0.7/src/gtextutils/outbuf3.hpp\r\n",
        "libgtextutils-0.7/src/gtextutils/text_line_reader.h\r\n",
        "libgtextutils-0.7/src/gtextutils/pipe_fitter.c\r\n",
        "libgtextutils-0.7/src/gtextutils/stream_wrapper.cpp\r\n",
        "libgtextutils-0.7/src/gtextutils/tuple_parser.h\r\n",
        "libgtextutils-0.7/src/gtextutils/Makefile.am\r\n",
        "libgtextutils-0.7/src/gtextutils/string_tokenize.h\r\n",
        "libgtextutils-0.7/src/gtextutils/pipe_fitter.h\r\n",
        "libgtextutils-0.7/src/gtextutils/stream_wrapper.h\r\n",
        "libgtextutils-0.7/src/gtextutils/strnatcmp.h\r\n",
        "libgtextutils-0.7/src/gtextutils/exit_manip.h\r\n",
        "libgtextutils-0.7/src/gtextutils/inbuf1.hpp\r\n",
        "libgtextutils-0.7/src/gtextutils/text_line_reader.cpp\r\n",
        "libgtextutils-0.7/src/gtextutils/strnatcmp.c\r\n",
        "libgtextutils-0.7/src/gtextutils/container_join.h\r\n",
        "libgtextutils-0.7/src/gtextutils/natsort.h\r\n",
        "libgtextutils-0.7/src/Makefile.am\r\n",
        "libgtextutils-0.7/NEWS\r\n",
        "libgtextutils-0.7/README\r\n",
        "libgtextutils-0.7/configure.ac\r\n",
        "libgtextutils-0.7/ChangeLog\r\n",
        "libgtextutils-0.7/COPYING\r\n",
        "libgtextutils-0.7/INSTALL\r\n",
        "libgtextutils-0.7/aclocal.m4\r\n",
        "libgtextutils-0.7/tests/\r\n",
        "libgtextutils-0.7/tests/test_string_tokenize.cpp\r\n",
        "libgtextutils-0.7/tests/Makefile.in\r\n",
        "libgtextutils-0.7/tests/test_tuple_parser.cpp\r\n",
        "libgtextutils-0.7/tests/test_tuple_parser_file.cpp\r\n",
        "libgtextutils-0.7/tests/test_fd_inbuf.cpp\r\n",
        "libgtextutils-0.7/tests/test_text_reader_unget.cpp\r\n",
        "libgtextutils-0.7/tests/test_container_join.cpp\r\n",
        "libgtextutils-0.7/tests/Makefile.am\r\n",
        "libgtextutils-0.7/tests/test_pipe_fitter.c\r\n",
        "libgtextutils-0.7/tests/test_natural_sort.cpp\r\n",
        "libgtextutils-0.7/tests/tests_assertion.h\r\n",
        "libgtextutils-0.7/tests/test_text_reader.cpp\r\n",
        "libgtextutils-0.7/tests/test_in_out_buf.cpp\r\n",
        "libgtextutils-0.7/tests/test_input_stream_wrapper.cpp\r\n",
        "libgtextutils-0.7/tests/test_fd_outbuf.cpp\r\n",
        "libgtextutils-0.7/AUTHORS\r\n",
        "libgtextutils-0.7/reconf\r\n",
        "libgtextutils-0.7/THANKS\r\n",
        "libgtextutils-0.7/config/\r\n",
        "libgtextutils-0.7/config/install-sh\r\n",
        "libgtextutils-0.7/config/compile\r\n",
        "libgtextutils-0.7/config/missing\r\n",
        "libgtextutils-0.7/config/test-driver\r\n",
        "libgtextutils-0.7/config/depcomp\r\n",
        "libgtextutils-0.7/config/config.guess\r\n",
        "libgtextutils-0.7/config/ltmain.sh\r\n",
        "libgtextutils-0.7/config/config.sub\r\n",
        "libgtextutils-0.7/configure\r\n"
       ]
      }
     ],
     "prompt_number": 7
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash fastx_install.sh"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Reading package lists... 0%\r",
        "\r",
        "Reading package lists... 100%\r",
        "\r",
        "Reading package lists... Done\r",
        "\r\n",
        "\r",
        "Building dependency tree... 0%\r",
        "\r",
        "Building dependency tree... 0%\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Building dependency tree... 50%\r",
        "\r",
        "Building dependency tree... 50%\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Building dependency tree       \r",
        "\r\n",
        "\r",
        "Reading state information... 0%\r",
        "\r",
        "Reading state information... 0%\r",
        "\r",
        "Reading state information... Done\r",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ is already the newest version.\r\n",
        "gcc is already the newest version.\r\n",
        "pkg-config is already the newest version.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "0 upgraded, 0 newly installed, 0 to remove and 14 not upgraded.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for a BSD-compatible install... /usr/bin/install -c\r\n",
        "checking whether build environment is sane... yes\r\n",
        "/mnt/frontiers-review-2015/libgtextutils-0.7/config/missing: Unknown `--is-lightweight' option\r\n",
        "Try `/mnt/frontiers-review-2015/libgtextutils-0.7/config/missing --help' for more information\r\n",
        "configure: WARNING: 'missing' script is too old or missing\r\n",
        "checking for a thread-safe mkdir -p... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "/bin/mkdir -p\r\n",
        "checking for gawk... gawk\r\n",
        "checking whether make sets $(MAKE)... yes\r\n",
        "checking whether make supports nested variables... yes\r\n",
        "checking for gcc... gcc\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking whether the C compiler works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for C compiler default output file name... a.out\r\n",
        "checking for suffix of executables... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "checking whether we are cross compiling... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking for suffix of object files... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "o\r\n",
        "checking whether we are using the GNU C compiler... yes\r\n",
        "checking whether gcc accepts -g... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for gcc option to accept ISO C89... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "none needed\r\n",
        "checking whether gcc understands -c and -o together... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for style of include used by make... GNU\r\n",
        "checking dependency style of gcc... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc3\r\n",
        "checking for g++... g++\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking whether we are using the GNU C++ compiler... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether g++ accepts -g... yes\r\n",
        "checking dependency style of g++... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc3\r\n",
        "checking build system type... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-unknown-linux-gnu\r\n",
        "checking host system type... x86_64-unknown-linux-gnu\r\n",
        "checking for a sed that does not truncate output... /bin/sed\r\n",
        "checking for grep that handles long lines and -e... /bin/grep\r\n",
        "checking for egrep... /bin/grep -E\r\n",
        "checking for fgrep... /bin/grep -F\r\n",
        "checking for ld used by gcc... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "/usr/bin/ld\r\n",
        "checking if the linker (/usr/bin/ld) is GNU ld... yes\r\n",
        "checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B\r\n",
        "checking the name lister (/usr/bin/nm -B) interface... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "BSD nm\r\n",
        "checking whether ln -s works... yes\r\n",
        "checking the maximum length of command line arguments... 1572864\r\n",
        "checking whether the shell understands some XSI constructs... yes\r\n",
        "checking whether the shell understands \"+=\"... yes\r\n",
        "checking for /usr/bin/ld option to reload object files... -r\r\n",
        "checking for objdump... objdump\r\n",
        "checking how to recognize dependent libraries... pass_all\r\n",
        "checking for ar... ar\r\n",
        "checking for strip... strip\r\n",
        "checking for ranlib... ranlib\r\n",
        "checking command to parse /usr/bin/nm -B output from gcc object... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ok\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking how to run the C preprocessor... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -E\r\n",
        "checking for ANSI C header files... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for sys/types.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for sys/stat.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for stdlib.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for string.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for memory.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for strings.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for inttypes.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for stdint.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for unistd.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for dlfcn.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking whether we are using the GNU C++ compiler... (cached) yes\r\n",
        "checking whether g++ accepts -g... (cached) yes\r\n",
        "checking dependency style of g++... (cached) gcc3\r\n",
        "checking how to run the C++ preprocessor... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -E\r\n",
        "checking for objdir... .libs\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking if gcc supports -fno-rtti -fno-exceptions... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking for gcc option to produce PIC... -fPIC -DPIC\r\n",
        "checking if gcc PIC flag -fPIC -DPIC works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc static flag -static works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc supports -c -o file.o... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc supports -c -o file.o... (cached) yes\r\n",
        "checking whether the gcc linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes\r\n",
        "checking whether -lc should be explicitly linked in... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking dynamic linker characteristics... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "GNU/Linux ld.so\r\n",
        "checking how to hardcode library paths into programs... immediate\r\n",
        "checking whether stripping libraries is possible... yes\r\n",
        "checking if libtool supports shared libraries... yes\r\n",
        "checking whether to build shared libraries... yes\r\n",
        "checking whether to build static libraries... yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for ld used by g++... /usr/bin/ld -m elf_x86_64\r\n",
        "checking if the linker (/usr/bin/ld -m elf_x86_64) is GNU ld... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for g++ option to produce PIC... -fPIC -DPIC\r\n",
        "checking if g++ PIC flag -fPIC -DPIC works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ static flag -static works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ supports -c -o file.o... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ supports -c -o file.o... (cached) yes\r\n",
        "checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes\r\n",
        "checking dynamic linker characteristics... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "GNU/Linux ld.so\r\n",
        "checking how to hardcode library paths into programs... immediate\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking that generated files are newer than configure... done\r\n",
        "configure: creating ./config.status\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating doc/Makefile\r\n",
        "config.status: creating m4/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/gtextutils/Makefile\r\n",
        "config.status: creating gtextutils.pc\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating tests/Makefile\r\n",
        "config.status: creating config.h\r\n",
        "config.status: config.h is unchanged\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: executing depfiles commands\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: executing libtool commands\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make  all-recursive\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "Making all in m4\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "Making all in src\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "Making all in gtextutils\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[3]: Nothing to be done for `all-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Making all in doc\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "Making all in tests\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "Making install in m4\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        " /bin/mkdir -p '/usr/local/share/aclocal'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/m4'\r\n",
        "Making install in src\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "Making install in gtextutils\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        " /bin/mkdir -p '/usr/local/lib'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        " /bin/bash ../../libtool   --mode=install /usr/bin/install -c   libgtextutils.la '/usr/local/lib'\r\n",
        "libtool: install: /usr/bin/install -c .libs/libgtextutils-0.7.so.0.0.0 /usr/local/lib/libgtextutils-0.7.so.0.0.0\r\n",
        "libtool: install: (cd /usr/local/lib && { ln -s -f libgtextutils-0.7.so.0.0.0 libgtextutils-0.7.so.0 || { rm -f libgtextutils-0.7.so.0 && ln -s libgtextutils-0.7.so.0.0.0 libgtextutils-0.7.so.0; }; })\r\n",
        "libtool: install: (cd /usr/local/lib && { ln -s -f libgtextutils-0.7.so.0.0.0 libgtextutils.so || { rm -f libgtextutils.so && ln -s libgtextutils-0.7.so.0.0.0 libgtextutils.so; }; })\r\n",
        "libtool: install: /usr/bin/install -c .libs/libgtextutils.lai /usr/local/lib/libgtextutils.la\r\n",
        "libtool: install: /usr/bin/install -c .libs/libgtextutils.a /usr/local/lib/libgtextutils.a\r\n",
        "libtool: install: chmod 644 /usr/local/lib/libgtextutils.a\r\n",
        "libtool: install: ranlib /usr/local/lib/libgtextutils.a\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: finish: PATH=\"/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/sbin\" ldconfig -n /usr/local/lib\r\n",
        "----------------------------------------------------------------------\r\n",
        "Libraries have been installed in:\r\n",
        "   /usr/local/lib\r\n",
        "\r\n",
        "If you ever happen to want to link against installed libraries\r\n",
        "in a given directory, LIBDIR, you must either use libtool, and\r\n",
        "specify the full pathname of the library, or use the `-LLIBDIR'\r\n",
        "flag during linking and do at least one of the following:\r\n",
        "   - add LIBDIR to the `LD_LIBRARY_PATH' environment variable\r\n",
        "     during execution\r\n",
        "   - add LIBDIR to the `LD_RUN_PATH' environment variable\r\n",
        "     during linking\r\n",
        "   - use the `-Wl,-rpath -Wl,LIBDIR' linker flag\r\n",
        "   - have your system administrator add LIBDIR to `/etc/ld.so.conf'\r\n",
        "\r\n",
        "See any operating system documentation about shared libraries for\r\n",
        "more information, such as the ld(1) and ld.so(8) manual pages.\r\n",
        "----------------------------------------------------------------------\r\n",
        " /bin/mkdir -p '/usr/local/include/gtextutils/gtextutils'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        " /usr/bin/install -c -m 644 container_join.h text_line_reader.h stream_wrapper.h natsort.h strnatcmp.h outbuf3.hpp inbuf1.hpp tuple_parser.h exit_manip.h string_tokenize.h pipe_fitter.h '/usr/local/include/gtextutils/gtextutils'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src/gtextutils'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/src'\r\n",
        "Making install in doc\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/doc'\r\n",
        "Making install in tests\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7/tests'\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        " /bin/mkdir -p '/usr/local/lib/pkgconfig'\r\n",
        " /usr/bin/install -c -m 644 gtextutils.pc '/usr/local/lib/pkgconfig'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/libgtextutils-0.7'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for a BSD-compatible install... /usr/bin/install -c\r\n",
        "checking whether build environment is sane... yes\r\n",
        "checking for a thread-safe mkdir -p... /bin/mkdir -p\r\n",
        "checking for gawk... gawk\r\n",
        "checking whether make sets $(MAKE)... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether make supports nested variables... yes\r\n",
        "checking for gcc... gcc\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking whether the C compiler works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for C compiler default output file name... a.out\r\n",
        "checking for suffix of executables... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "checking whether we are cross compiling... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking for suffix of object files... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "o\r\n",
        "checking whether we are using the GNU C compiler... yes\r\n",
        "checking whether gcc accepts -g... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for gcc option to accept ISO C89... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "none needed\r\n",
        "checking whether gcc understands -c and -o together... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for style of include used by make... GNU\r\n",
        "checking dependency style of gcc... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc3\r\n",
        "checking for g++... g++\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking whether we are using the GNU C++ compiler... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether g++ accepts -g... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking dependency style of g++... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc3\r\n",
        "checking build system type... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-unknown-linux-gnu\r\n",
        "checking host system type... x86_64-unknown-linux-gnu\r\n",
        "checking for a sed that does not truncate output... /bin/sed\r\n",
        "checking for grep that handles long lines and -e... /bin/grep\r\n",
        "checking for egrep... /bin/grep -E\r\n",
        "checking for fgrep... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "/bin/grep -F\r\n",
        "checking for ld used by gcc... /usr/bin/ld\r\n",
        "checking if the linker (/usr/bin/ld) is GNU ld... yes\r\n",
        "checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B\r\n",
        "checking the name lister (/usr/bin/nm -B) interface... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "BSD nm\r\n",
        "checking whether ln -s works... yes\r\n",
        "checking the maximum length of command line arguments... 1572864\r\n",
        "checking whether the shell understands some XSI constructs... yes\r\n",
        "checking whether the shell understands \"+=\"... yes\r\n",
        "checking for /usr/bin/ld option to reload object files... -r\r\n",
        "checking for objdump... objdump\r\n",
        "checking how to recognize dependent libraries... pass_all\r\n",
        "checking for ar... ar\r\n",
        "checking for strip... strip\r\n",
        "checking for ranlib... ranlib\r\n",
        "checking command to parse /usr/bin/nm -B output from gcc object... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ok\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking how to run the C preprocessor... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -E\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for ANSI C header files... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for sys/types.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for sys/stat.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for stdlib.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for string.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for memory.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for strings.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for inttypes.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for stdint.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for unistd.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for dlfcn.h... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether we are using the GNU C++ compiler... (cached) yes\r\n",
        "checking whether g++ accepts -g... (cached) yes\r\n",
        "checking dependency style of g++... (cached) gcc3\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking how to run the C++ preprocessor... g++ -E\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for objdir... .libs\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking if gcc supports -fno-rtti -fno-exceptions... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking for gcc option to produce PIC... -fPIC -DPIC\r\n",
        "checking if gcc PIC flag -fPIC -DPIC works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc static flag -static works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc supports -c -o file.o... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if gcc supports -c -o file.o... (cached) yes\r\n",
        "checking whether the gcc linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether -lc should be explicitly linked in... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking dynamic linker characteristics... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "GNU/Linux ld.so\r\n",
        "checking how to hardcode library paths into programs... immediate\r\n",
        "checking whether stripping libraries is possible... yes\r\n",
        "checking if libtool supports shared libraries... yes\r\n",
        "checking whether to build shared libraries... yes\r\n",
        "checking whether to build static libraries... yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for ld used by g++... /usr/bin/ld -m elf_x86_64\r\n",
        "checking if the linker (/usr/bin/ld -m elf_x86_64) is GNU ld... yes\r\n",
        "checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking for g++ option to produce PIC... -fPIC -DPIC\r\n",
        "checking if g++ PIC flag -fPIC -DPIC works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ static flag -static works... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ supports -c -o file.o... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking if g++ supports -c -o file.o... (cached) yes\r\n",
        "checking whether the g++ linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes\r\n",
        "checking dynamic linker characteristics... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "GNU/Linux ld.so\r\n",
        "checking how to hardcode library paths into programs... immediate\r\n",
        "checking for long long int... yes\r\n",
        "checking for ISO C++ TR1 include files... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking whether g++ supports C++11 features by default... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no\r\n",
        "checking whether g++ supports C++11 features with -std=c++11... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "yes\r\n",
        "checking for pkg-config... /usr/bin/pkg-config\r\n",
        "checking pkg-config is at least version 0.9.0... yes\r\n",
        "checking for GTEXTUTILS... yes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "checking that generated files are newer than configure... done\r\n",
        "configure: creating ./config.status\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating Makefile\r\n",
        "config.status: creating doc/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating m4/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/Makefile\r\n",
        "config.status: creating src/libfastx/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastx_clipper/Makefile\r\n",
        "config.status: creating src/fastq_to_fasta/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastx_quality_stats/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastq_quality_converter/Makefile\r\n",
        "config.status: creating src/fastx_trimmer/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastq_quality_filter/Makefile\r\n",
        "config.status: creating src/fastq_quality_trimmer/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastx_artifacts_filter/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastx_reverse_complement/Makefile\r\n",
        "config.status: creating src/fastx_collapser/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastx_uncollapser/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/seqalign_test/Makefile\r\n",
        "config.status: creating src/fasta_formatter/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fasta_nucleotide_changer/Makefile\r\n",
        "config.status: creating src/fastx_renamer/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating src/fastq_masker/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating galaxy/Makefile\r\n",
        "config.status: creating galaxy/tools/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating galaxy/tools/fastx_toolkit/Makefile\r\n",
        "config.status: creating galaxy/test-data/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating galaxy/static/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating galaxy/static/fastx_icons/Makefile\r\n",
        "config.status: creating galaxy/tool-data/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating scripts/Makefile\r\n",
        "config.status: creating build_scripts/Makefile\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: creating config.h\r\n",
        "config.status: config.h is unchanged\r\n",
        "config.status: executing depfiles commands\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "config.status: executing libtool commands\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make  all-recursive\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "Making all in m4\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "Making all in src\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "Making all in libfastx\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "Making all in fastx_clipper\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n",
        "Making all in fastx_trimmer\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Making all in fastx_quality_stats\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        "Making all in fastq_quality_converter\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        "Making all in fastq_to_fasta\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        "Making all in fastq_quality_filter\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        "Making all in fastq_quality_trimmer\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        "Making all in fastx_artifacts_filter\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n",
        "Making all in fastx_reverse_complement\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n",
        "Making all in fastx_collapser\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        "Making all in fastx_uncollapser\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        "g++ -DHAVE_CONFIG_H -I. -I../..   -I/usr/local/include/gtextutils   -I../../src/libfastx   -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -MT fastx_uncollapser.o -MD -MP -MF .deps/fastx_uncollapser.Tpo -c -o fastx_uncollapser.o fastx_uncollapser.cpp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "mv -f .deps/fastx_uncollapser.Tpo .deps/fastx_uncollapser.Po\r\n",
        "/bin/bash ../../libtool  --tag=CXX   --mode=link g++  -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1   -o fastx_uncollapser fastx_uncollapser.o -L/usr/local/lib -lgtextutils   ../libfastx/libfastx.a  \r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: link: g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fastx_uncollapser fastx_uncollapser.o  -L/usr/local/lib /usr/local/lib/libgtextutils.so ../libfastx/libfastx.a\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        "Making all in seqalign_test\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "Making all in fasta_formatter\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n",
        "g++ -DHAVE_CONFIG_H -I. -I../..   -I/usr/local/include/gtextutils   -I../../src/libfastx   -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -MT fasta_formatter.o -MD -MP -MF .deps/fasta_formatter.Tpo -c -o fasta_formatter.o fasta_formatter.cpp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "mv -f .deps/fasta_formatter.Tpo .deps/fasta_formatter.Po\r\n",
        "/bin/bash ../../libtool  --tag=CXX   --mode=link g++  -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1   -o fasta_formatter fasta_formatter.o -L/usr/local/lib -lgtextutils   ../libfastx/libfastx.a  \r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: link: g++ -g -O2 -std=c++11 -Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror -DDEBUG -g -O1 -o fasta_formatter fasta_formatter.o  -L/usr/local/lib /usr/local/lib/libgtextutils.so ../libfastx/libfastx.a\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n",
        "Making all in fasta_nucleotide_changer\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        "Making all in fastx_renamer\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        "Making all in fastq_masker\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[3]: Nothing to be done for `all-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "Making all in doc\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "Making all in galaxy\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "Making all in tools\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Making all in fastx_toolkit\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[4]: Nothing to be done for `all'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[4]: Nothing to be done for `all-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "Making all in test-data\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "Making all in static\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "Making all in fastx_icons\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[4]: Nothing to be done for `all'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "make[4]: Nothing to be done for `all-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "Making all in tool-data\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[3]: Nothing to be done for `all'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[3]: Nothing to be done for `all-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "Making all in scripts\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        "Making all in build_scripts\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n",
        "make[2]: Nothing to be done for `all'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "Making install in m4\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        " /bin/mkdir -p '/usr/local/share/aclocal'\r\n",
        " /usr/bin/install -c -m 644 ax_c_long_long.m4 ax_cxx_compile_stdcxx_11.m4 ax_cxx_header_stdcxx_tr1.m4 '/usr/local/share/aclocal'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/m4'\r\n",
        "Making install in src\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "Making install in libfastx\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/libfastx'\r\n",
        "Making install in fastx_clipper\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_clipper '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fastx_clipper /usr/local/bin/fastx_clipper\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_clipper'\r\n",
        "Making install in fastx_trimmer\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_trimmer '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastx_trimmer /usr/local/bin/fastx_trimmer\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_trimmer'\r\n",
        "Making install in fastx_quality_stats\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_quality_stats '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastx_quality_stats /usr/local/bin/fastx_quality_stats\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_quality_stats'\r\n",
        "Making install in fastq_quality_converter\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastq_quality_converter '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastq_quality_converter /usr/local/bin/fastq_quality_converter\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_converter'\r\n",
        "Making install in fastq_to_fasta\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastq_to_fasta '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastq_to_fasta /usr/local/bin/fastq_to_fasta\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_to_fasta'\r\n",
        "Making install in fastq_quality_filter\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastq_quality_filter '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastq_quality_filter /usr/local/bin/fastq_quality_filter\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_filter'\r\n",
        "Making install in fastq_quality_trimmer\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastq_quality_trimmer '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fastq_quality_trimmer /usr/local/bin/fastq_quality_trimmer\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_quality_trimmer'\r\n",
        "Making install in fastx_artifacts_filter\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_artifacts_filter '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fastx_artifacts_filter /usr/local/bin/fastx_artifacts_filter\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_artifacts_filter'\r\n",
        "Making install in fastx_reverse_complement\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_reverse_complement '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fastx_reverse_complement /usr/local/bin/fastx_reverse_complement\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_reverse_complement'\r\n",
        "Making install in fastx_collapser\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_collapser '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastx_collapser /usr/local/bin/fastx_collapser\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_collapser'\r\n",
        "Making install in fastx_uncollapser\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_uncollapser '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastx_uncollapser /usr/local/bin/fastx_uncollapser\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_uncollapser'\r\n",
        "Making install in seqalign_test\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/seqalign_test'\r\n",
        "Making install in fasta_formatter\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fasta_formatter '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fasta_formatter /usr/local/bin/fasta_formatter\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_formatter'\r\n",
        "Making install in fasta_nucleotide_changer\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fasta_nucleotide_changer '/usr/local/bin'\r\n",
        "libtool: install: /usr/bin/install -c fasta_nucleotide_changer /usr/local/bin/fasta_nucleotide_changer\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fasta_nucleotide_changer'\r\n",
        "Making install in fastx_renamer\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastx_renamer '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastx_renamer /usr/local/bin/fastx_renamer\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastx_renamer'\r\n",
        "Making install in fastq_masker\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        "  /bin/bash ../../libtool   --mode=install /usr/bin/install -c fastq_masker '/usr/local/bin'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "libtool: install: /usr/bin/install -c fastq_masker /usr/local/bin/fastq_masker\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src/fastq_masker'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/src'\r\n",
        "Making install in doc\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/doc'\r\n",
        "Making install in galaxy\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "Making install in tools\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Making install in fastx_toolkit\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[4]: Nothing to be done for `install-exec-am'.\r\n",
        "make[4]: Nothing to be done for `install-data-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools/fastx_toolkit'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[4]: Nothing to be done for `install-exec-am'.\r\n",
        "make[4]: Nothing to be done for `install-data-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tools'\r\n",
        "Making install in test-data\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/test-data'\r\n",
        "Making install in static\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "Making install in fastx_icons\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[4]: Nothing to be done for `install-exec-am'.\r\n",
        "make[4]: Nothing to be done for `install-data-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static/fastx_icons'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[4]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "make[4]: Nothing to be done for `install-exec-am'.\r\n",
        "make[4]: Nothing to be done for `install-data-am'.\r\n",
        "make[4]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/static'\r\n",
        "Making install in tool-data\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy/tool-data'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[3]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[3]: Nothing to be done for `install-exec-am'.\r\n",
        "make[3]: Nothing to be done for `install-data-am'.\r\n",
        "make[3]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/galaxy'\r\n",
        "Making install in scripts\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        " /bin/mkdir -p '/usr/local/bin'\r\n",
        " /usr/bin/install -c fastx_barcode_splitter.pl fastx_nucleotide_distribution_graph.sh fastx_nucleotide_distribution_line_graph.sh fastq_quality_boxplot_graph.sh fasta_clipping_histogram.pl '/usr/local/bin'\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/scripts'\r\n",
        "Making install in build_scripts\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14/build_scripts'\r\n",
        "make[1]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "make[2]: Entering directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "make[2]: Nothing to be done for `install-exec-am'.\r\n",
        "make[2]: Nothing to be done for `install-data-am'.\r\n",
        "make[2]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n",
        "make[1]: Leaving directory `/mnt/frontiers-review-2015/fastx_toolkit-0.0.14'\r\n"
       ]
      }
     ],
     "prompt_number": 16
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Now, we will perform the quality filtering saving the quality-filtered file as SRR172903.qc.fastq:\n",
      "\n",
      "FASTQ Quality Filter\n",
      "\n",
      "$ fastq_quality_filter -h\n",
      "\tusage: fastq_quality_filter [-h] [-v] [-q N] [-p N] [-z] [-i INFILE] [-o OUTFILE]\n",
      "\n",
      "\tversion 0.0.6\n",
      "\t   [-h]         = This helpful help screen.\n",
      "\t   [-q N]       = Minimum quality score to keep.\n",
      "\t   [-p N]       = Minimum percent of bases that must have [-q] quality.\n",
      "\t   [-z]         = Compress output with GZIP.\n",
      "\t   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n",
      "\t   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n",
      "\t   [-v]         = Verbose - report number of sequences.\n",
      "\t\t\t  If [-o] is specified,  report will be printed to STDOUT.\n",
      "\t\t\t  If [-o] is not specified (and output goes to STDOUT),\n",
      "\t\t\t  report will be printed to STDERR."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!fastq_quality_filter -q 33 -p 50 -i SRR172903.fastq > SRR172903.qc.fastq"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [],
     "prompt_number": 17
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 4. Checking the diversity - What is the distribution of \"Who is There?\"\n",
      "\n",
      "An advantage of metagenomic sequencing is the ability to quantify microbial diversity in an environment without the need to first cultivate cells.  Typically, most studies access taxonomic diversity (especially with the usage of targeted sequencing of the 16S rRNA gene*).  Diversity can also be measured in the representation of specific sequence patterns in a metagenome.  For example, one can quantify the abundance of unique nucleotide \"words\" of length K, or k-mers, in a metagenome.  These k-mers can also be used in the assembly of metagenomes where overlapping k-mers are indicative of reads that should be connected together.  The diversity of these k-mers can give you insight into the the diversity of your sample.  Further, since assembly compares each k-mer against all k-mers, larger numbers of k-mers present will require more computational memory. A nice review on k-mers and assembly is Miller et al.\n",
      "\n",
      "(*Note that 16S rRNA amplicon sequencing is a targeted approach and not considered metagenomics in this review.  Shotgun metagenomic sequencing uses DNA extracted from all cells in a community and sequenced.  Targeted sequencing amplifies a specific genomic locus and independently sequenced.  A great review on metagenome analysis is Sharpton et al.)\n",
      "\n",
      "The first thing we will do is install khmer (www.github.com/ged-lab/khmer) -- it contains a suite of khmer and pre-assembly tools.  We will use it for k-mer counting here.  Once you run the script below, you can use khmer's many tools."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!ls"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "assemstats3.py\t\t      kmer-count-plot.py\r\n",
        "bowtie.sh\t\t      libgtextutils-0.7\r\n",
        "fastx_install.sh\t      libgtextutils-0.7.tar.gz\r\n",
        "fastx_toolkit-0.0.14\t      LICENSE.md\r\n",
        "fastx_toolkit-0.0.14.tar.bz2  ncbi_acc.txt\r\n",
        "fetch-genomes-fasta.py\t      README.md\r\n",
        "fraggenescan-install.sh       remove_output.py\r\n",
        "frontiers-nb-2015.bu.ipynb    sratoolkit.2.4.5-2-ubuntu64\r\n",
        "frontiers-nb-2015.ipynb       sratoolkit.2.4.5-2-ubuntu64.tar.gz\r\n",
        "install-megahit.sh\t      SRR172903.fastq\r\n",
        "ipython_notebook_config.py    SRR172903.qc.fastq\r\n",
        "khmer\t\t\t      unique-kmers.py\r\n",
        "khmer-install.sh\r\n"
       ]
      }
     ],
     "prompt_number": 18
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash khmer-install.sh"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Cloning into 'khmer'...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "remote: Counting objects: 33672, done.\u001b[K\r\n",
        "remote: Compressing objects:   0% (1/153)   \u001b[K\r",
        "remote: Compressing objects:   1% (2/153)   \u001b[K\r",
        "remote: Compressing objects:   2% (4/153)   \u001b[K\r",
        "remote: Compressing objects:   3% (5/153)   \u001b[K\r",
        "remote: Compressing objects:   4% (7/153)   \u001b[K\r",
        "remote: Compressing objects:   5% (8/153)   \u001b[K\r",
        "remote: Compressing objects:   6% (10/153)   \u001b[K\r",
        "remote: Compressing objects:   7% (11/153)   \u001b[K\r",
        "remote: Compressing objects:   8% (13/153)   \u001b[K\r",
        "remote: Compressing objects:   9% (14/153)   \u001b[K\r",
        "remote: Compressing objects:  10% (16/153)   \u001b[K\r",
        "remote: Compressing objects:  11% (17/153)   \u001b[K\r",
        "remote: Compressing objects:  12% (19/153)   \u001b[K\r",
        "remote: Compressing objects:  13% (20/153)   \u001b[K\r",
        "remote: Compressing objects:  14% (22/153)   \u001b[K\r",
        "remote: Compressing objects:  15% (23/153)   \u001b[K\r",
        "remote: Compressing objects:  16% (25/153)   \u001b[K\r",
        "remote: Compressing objects:  17% (27/153)   \u001b[K\r",
        "remote: Compressing objects:  18% (28/153)   \u001b[K\r",
        "remote: Compressing objects:  19% (30/153)   \u001b[K\r",
        "remote: Compressing objects:  20% (31/153)   \u001b[K\r",
        "remote: Compressing objects:  21% (33/153)   \u001b[K\r",
        "remote: Compressing objects:  22% (34/153)   \u001b[K\r",
        "remote: Compressing objects:  23% (36/153)   \u001b[K\r",
        "remote: Compressing objects:  24% (37/153)   \u001b[K\r",
        "remote: Compressing objects:  25% (39/153)   \u001b[K\r",
        "remote: Compressing objects:  26% (40/153)   \u001b[K\r",
        "remote: Compressing objects:  27% (42/153)   \u001b[K\r",
        "remote: Compressing objects:  28% (43/153)   \u001b[K\r",
        "remote: Compressing objects:  29% (45/153)   \u001b[K\r",
        "remote: Compressing objects:  30% (46/153)   \u001b[K\r",
        "remote: Compressing objects:  31% (48/153)   \u001b[K\r",
        "remote: Compressing objects:  32% (49/153)   \u001b[K\r",
        "remote: Compressing objects:  33% (51/153)   \u001b[K\r",
        "remote: Compressing objects:  34% (53/153)   \u001b[K\r",
        "remote: Compressing objects:  35% (54/153)   \u001b[K\r",
        "remote: Compressing objects:  36% (56/153)   \u001b[K\r",
        "remote: Compressing objects:  37% (57/153)   \u001b[K\r",
        "remote: Compressing objects:  38% (59/153)   \u001b[K\r",
        "remote: Compressing objects:  39% (60/153)   \u001b[K\r",
        "remote: Compressing objects:  40% (62/153)   \u001b[K\r",
        "remote: Compressing objects:  41% (63/153)   \u001b[K\r",
        "remote: Compressing objects:  42% (65/153)   \u001b[K\r",
        "remote: Compressing objects:  43% (66/153)   \u001b[K\r",
        "remote: Compressing objects:  44% (68/153)   \u001b[K\r",
        "remote: Compressing objects:  45% (69/153)   \u001b[K\r",
        "remote: Compressing objects:  46% (71/153)   \u001b[K\r",
        "remote: Compressing objects:  47% (72/153)   \u001b[K\r",
        "remote: Compressing objects:  48% (74/153)   \u001b[K\r",
        "remote: Compressing objects:  49% (75/153)   \u001b[K\r",
        "remote: Compressing objects:  50% (77/153)   \u001b[K\r",
        "remote: Compressing objects:  51% (79/153)   \u001b[K\r",
        "remote: Compressing objects:  52% (80/153)   \u001b[K\r",
        "remote: Compressing objects:  53% (82/153)   \u001b[K\r",
        "remote: Compressing objects:  54% (83/153)   \u001b[K\r",
        "remote: Compressing objects:  55% (85/153)   \u001b[K\r",
        "remote: Compressing objects:  56% (86/153)   \u001b[K\r",
        "remote: Compressing objects:  57% (88/153)   \u001b[K\r",
        "remote: Compressing objects:  58% (89/153)   \u001b[K\r",
        "remote: Compressing objects:  59% (91/153)   \u001b[K\r",
        "remote: Compressing objects:  60% (92/153)   \u001b[K\r",
        "remote: Compressing objects:  61% (94/153)   \u001b[K\r",
        "remote: Compressing objects:  62% (95/153)   \u001b[K\r",
        "remote: Compressing objects:  63% (97/153)   \u001b[K\r",
        "remote: Compressing objects:  64% (98/153)   \u001b[K\r",
        "remote: Compressing objects:  65% (100/153)   \u001b[K\r",
        "remote: Compressing objects:  66% (101/153)   \u001b[K\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "remote: Compressing objects:  67% (103/153)   \u001b[K\r",
        "remote: Compressing objects:  68% (105/153)   \u001b[K\r",
        "remote: Compressing objects:  69% (106/153)   \u001b[K\r",
        "remote: Compressing objects:  70% (108/153)   \u001b[K\r",
        "remote: Compressing objects:  71% (109/153)   \u001b[K\r",
        "remote: Compressing objects:  72% (111/153)   \u001b[K\r",
        "remote: Compressing objects:  73% (112/153)   \u001b[K\r",
        "remote: Compressing objects:  74% (114/153)   \u001b[K\r",
        "remote: Compressing objects:  75% (115/153)   \u001b[K\r",
        "remote: Compressing objects:  76% (117/153)   \u001b[K\r",
        "remote: Compressing objects:  77% (118/153)   \u001b[K\r",
        "remote: Compressing objects:  78% (120/153)   \u001b[K\r",
        "remote: Compressing objects:  79% (121/153)   \u001b[K\r",
        "remote: Compressing objects:  80% (123/153)   \u001b[K\r",
        "remote: Compressing objects:  81% (124/153)   \u001b[K\r",
        "remote: Compressing objects:  82% (126/153)   \u001b[K\r",
        "remote: Compressing objects:  83% (127/153)   \u001b[K\r",
        "remote: Compressing objects:  84% (129/153)   \u001b[K\r",
        "remote: Compressing objects:  85% (131/153)   \u001b[K\r",
        "remote: Compressing objects:  86% (132/153)   \u001b[K\r",
        "remote: Compressing objects:  87% (134/153)   \u001b[K\r",
        "remote: Compressing objects:  88% (135/153)   \u001b[K\r",
        "remote: Compressing objects:  89% (137/153)   \u001b[K\r",
        "remote: Compressing objects:  90% (138/153)   \u001b[K\r",
        "remote: Compressing objects:  91% (140/153)   \u001b[K\r",
        "remote: Compressing objects:  92% (141/153)   \u001b[K\r",
        "remote: Compressing objects:  93% (143/153)   \u001b[K\r",
        "remote: Compressing objects:  94% (144/153)   \u001b[K\r",
        "remote: Compressing objects:  95% (146/153)   \u001b[K\r",
        "remote: Compressing objects:  96% (147/153)   \u001b[K\r",
        "remote: Compressing objects:  97% (149/153)   \u001b[K\r",
        "remote: Compressing objects:  98% (150/153)   \u001b[K\r",
        "remote: Compressing objects:  99% (152/153)   \u001b[K\r",
        "remote: Compressing objects: 100% (153/153)   \u001b[K\r",
        "remote: Compressing objects: 100% (153/153), done.\u001b[K\r\n",
        "Receiving objects:   0% (1/33672)   \r",
        "Receiving objects:   1% (337/33672)   \r",
        "Receiving objects:   2% (674/33672)   \r",
        "Receiving objects:   3% (1011/33672)   \r",
        "Receiving objects:   4% (1347/33672)   \r",
        "Receiving objects:   5% (1684/33672)   \r",
        "Receiving objects:   6% (2021/33672)   \r",
        "Receiving objects:   7% (2358/33672)   \r",
        "Receiving objects:   8% (2694/33672)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:   9% (3031/33672)   \r",
        "Receiving objects:  10% (3368/33672)   \r",
        "Receiving objects:  11% (3704/33672)   \r",
        "Receiving objects:  12% (4041/33672)   \r",
        "Receiving objects:  13% (4378/33672)   \r",
        "Receiving objects:  14% (4715/33672)   \r",
        "Receiving objects:  15% (5051/33672)   \r",
        "Receiving objects:  16% (5388/33672)   \r",
        "Receiving objects:  17% (5725/33672)   \r",
        "Receiving objects:  18% (6061/33672)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  19% (6398/33672)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  20% (6735/33672), 8.86 MiB | 17.67 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  21% (7072/33672), 8.86 MiB | 17.67 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  21% (7121/33672), 17.14 MiB | 17.01 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  22% (7408/33672), 17.14 MiB | 17.01 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  23% (7745/33672), 17.14 MiB | 17.01 MiB/s   \r",
        "Receiving objects:  24% (8082/33672), 17.14 MiB | 17.01 MiB/s   \r",
        "Receiving objects:  25% (8418/33672), 17.14 MiB | 17.01 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  26% (8755/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  27% (9092/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  28% (9429/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  29% (9765/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  30% (10102/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  31% (10439/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  32% (10776/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  33% (11112/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  34% (11449/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  35% (11786/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  36% (12122/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  37% (12459/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  38% (12796/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  39% (13133/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  40% (13469/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  41% (13806/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  42% (14143/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  43% (14479/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  44% (14816/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  45% (15153/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  46% (15490/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  47% (15826/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  48% (16163/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  49% (16500/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  50% (16836/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  51% (17173/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  52% (17510/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  53% (17847/33672), 25.70 MiB | 17.03 MiB/s   \r",
        "Receiving objects:  54% (18183/33672), 25.70 MiB | 17.03 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  54% (18468/33672), 38.64 MiB | 19.22 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  55% (18520/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  56% (18857/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  57% (19194/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  58% (19530/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  59% (19867/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  60% (20204/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  61% (20540/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  61% (20640/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  62% (20877/33672), 49.98 MiB | 19.90 MiB/s   \r",
        "Receiving objects:  63% (21214/33672), 49.98 MiB | 19.90 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  64% (21551/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  65% (21887/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  66% (22224/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  67% (22561/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  68% (22897/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  69% (23234/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  70% (23571/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  71% (23908/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  72% (24244/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  73% (24581/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  74% (24918/33672), 61.46 MiB | 20.40 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  75% (25254/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  76% (25591/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  77% (25928/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  78% (26265/33672), 61.46 MiB | 20.40 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  79% (26601/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  80% (26938/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  81% (27275/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  82% (27612/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  83% (27948/33672), 61.46 MiB | 20.40 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  84% (28285/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  85% (28622/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  86% (28958/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  87% (29295/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  88% (29632/33672), 61.46 MiB | 20.40 MiB/s   \r",
        "Receiving objects:  89% (29969/33672), 61.46 MiB | 20.40 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  90% (30305/33672), 72.18 MiB | 20.55 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  91% (30642/33672), 72.18 MiB | 20.55 MiB/s   \r",
        "Receiving objects:  92% (30979/33672), 72.18 MiB | 20.55 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 77.62 MiB | 19.34 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 78.43 MiB | 14.20 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 79.72 MiB | 11.04 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 81.01 MiB | 6.34 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 82.30 MiB | 2.07 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  92% (31041/33672), 83.59 MiB | 1.09 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  93% (31315/33672), 83.59 MiB | 1.09 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  93% (31539/33672), 96.78 MiB | 3.92 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  94% (31652/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "Receiving objects:  95% (31989/33672), 96.78 MiB | 3.92 MiB/s   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  96% (32326/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "Receiving objects:  97% (32662/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "Receiving objects:  98% (32999/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "Receiving objects:  99% (33336/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "remote: Total 33672 (delta 82), reused 0 (delta 0), pack-reused 33519\u001b[K\r\n",
        "Receiving objects: 100% (33672/33672), 96.78 MiB | 3.92 MiB/s   \r",
        "Receiving objects: 100% (33672/33672), 107.68 MiB | 4.25 MiB/s, done.\r\n",
        "Resolving deltas:   0% (0/22993)   \r",
        "Resolving deltas:   1% (240/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:   2% (491/22993)   \r",
        "Resolving deltas:   3% (693/22993)   \r",
        "Resolving deltas:   4% (979/22993)   \r",
        "Resolving deltas:   5% (1160/22993)   \r",
        "Resolving deltas:   6% (1397/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:   7% (1611/22993)   \r",
        "Resolving deltas:   8% (1842/22993)   \r",
        "Resolving deltas:   9% (2071/22993)   \r",
        "Resolving deltas:  10% (2315/22993)   \r",
        "Resolving deltas:  11% (2538/22993)   \r",
        "Resolving deltas:  12% (2794/22993)   \r",
        "Resolving deltas:  13% (2991/22993)   \r",
        "Resolving deltas:  14% (3223/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  15% (3496/22993)   \r",
        "Resolving deltas:  16% (3685/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  17% (3909/22993)   \r",
        "Resolving deltas:  18% (4140/22993)   \r",
        "Resolving deltas:  19% (4372/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  20% (4601/22993)   \r",
        "Resolving deltas:  22% (5062/22993)   \r",
        "Resolving deltas:  23% (5289/22993)   \r",
        "Resolving deltas:  24% (5532/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  25% (5838/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  27% (6354/22993)   \r",
        "Resolving deltas:  28% (6445/22993)   \r",
        "Resolving deltas:  29% (6669/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  30% (6972/22993)   \r",
        "Resolving deltas:  31% (7137/22993)   \r",
        "Resolving deltas:  32% (7391/22993)   \r",
        "Resolving deltas:  33% (7590/22993)   \r",
        "Resolving deltas:  34% (7818/22993)   \r",
        "Resolving deltas:  35% (8049/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  36% (8289/22993)   \r",
        "Resolving deltas:  37% (8585/22993)   \r",
        "Resolving deltas:  39% (9019/22993)   \r",
        "Resolving deltas:  40% (9233/22993)   \r",
        "Resolving deltas:  41% (9463/22993)   \r",
        "Resolving deltas:  42% (9659/22993)   \r",
        "Resolving deltas:  43% (9887/22993)   \r",
        "Resolving deltas:  44% (10230/22993)   \r",
        "Resolving deltas:  45% (10413/22993)   \r",
        "Resolving deltas:  46% (10583/22993)   \r",
        "Resolving deltas:  47% (11014/22993)   \r",
        "Resolving deltas:  48% (11050/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  49% (11292/22993)   \r",
        "Resolving deltas:  50% (11535/22993)   \r",
        "Resolving deltas:  51% (11737/22993)   \r",
        "Resolving deltas:  52% (11957/22993)   \r",
        "Resolving deltas:  53% (12187/22993)   \r",
        "Resolving deltas:  54% (12430/22993)   \r",
        "Resolving deltas:  55% (12658/22993)   \r",
        "Resolving deltas:  56% (12897/22993)   \r",
        "Resolving deltas:  57% (13115/22993)   \r",
        "Resolving deltas:  58% (13391/22993)   \r",
        "Resolving deltas:  59% (13573/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  60% (13805/22993)   \r",
        "Resolving deltas:  61% (14030/22993)   \r",
        "Resolving deltas:  62% (14256/22993)   \r",
        "Resolving deltas:  63% (14497/22993)   \r",
        "Resolving deltas:  64% (14811/22993)   \r",
        "Resolving deltas:  65% (15130/22993)   \r",
        "Resolving deltas:  66% (15222/22993)   \r",
        "Resolving deltas:  67% (15409/22993)   \r",
        "Resolving deltas:  68% (15760/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  69% (15966/22993)   \r",
        "Resolving deltas:  70% (16201/22993)   \r",
        "Resolving deltas:  71% (16330/22993)   \r",
        "Resolving deltas:  72% (16557/22993)   \r",
        "Resolving deltas:  73% (16913/22993)   \r",
        "Resolving deltas:  74% (17017/22993)   \r",
        "Resolving deltas:  75% (17256/22993)   \r",
        "Resolving deltas:  76% (17492/22993)   \r",
        "Resolving deltas:  77% (17711/22993)   \r",
        "Resolving deltas:  78% (17939/22993)   \r",
        "Resolving deltas:  79% (18176/22993)   \r",
        "Resolving deltas:  80% (18427/22993)   \r",
        "Resolving deltas:  81% (18643/22993)   \r",
        "Resolving deltas:  82% (18867/22993)   \r",
        "Resolving deltas:  83% (19087/22993)   \r",
        "Resolving deltas:  84% (19315/22993)   \r",
        "Resolving deltas:  85% (19556/22993)   \r",
        "Resolving deltas:  86% (19794/22993)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Resolving deltas:  87% (20032/22993)   \r",
        "Resolving deltas:  88% (20250/22993)   \r",
        "Resolving deltas:  89% (20469/22993)   \r",
        "Resolving deltas:  90% (20702/22993)   \r",
        "Resolving deltas:  91% (20925/22993)   \r",
        "Resolving deltas:  92% (21171/22993)   \r",
        "Resolving deltas:  93% (21399/22993)   \r",
        "Resolving deltas:  94% (21656/22993)   \r",
        "Resolving deltas:  95% (21933/22993)   \r",
        "Resolving deltas:  96% (22083/22993)   \r",
        "Resolving deltas:  97% (22465/22993)   \r",
        "Resolving deltas:  98% (22557/22993)   \r",
        "Resolving deltas:  99% (22764/22993)   \r",
        "Resolving deltas: 100% (22993/22993)   \r",
        "Resolving deltas: 100% (22993/22993), done.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking connectivity... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "running install\r\n",
        "Checking .pth file support in /usr/local/lib/python2.7/dist-packages/\r\n",
        "/usr/bin/python -E -c pass\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "TEST PASSED: /usr/local/lib/python2.7/dist-packages/ appears to support .pth files\r\n",
        "running bdist_egg\r\n",
        "running egg_info\r\n",
        "creating khmer.egg-info\r\n",
        "writing requirements to khmer.egg-info/requires.txt\r\n",
        "writing khmer.egg-info/PKG-INFO\r\n",
        "writing top-level names to khmer.egg-info/top_level.txt\r\n",
        "writing dependency_links to khmer.egg-info/dependency_links.txt\r\n",
        "writing entry points to khmer.egg-info/entry_points.txt\r\n",
        "writing manifest file 'khmer.egg-info/SOURCES.txt'\r\n",
        "reading manifest file 'khmer.egg-info/SOURCES.txt'\r\n",
        "reading manifest template 'MANIFEST.in'\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "warning: no previously-included files found matching 'third-party/zlib/Makefile'\r\n",
        "warning: no previously-included files found matching 'third-party/zlib/zconf.h'\r\n",
        "warning: no previously-included files matching '*.orig' found anywhere in distribution\r\n",
        "warning: no previously-included files matching '*.pyc' found anywhere in distribution\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "writing manifest file 'khmer.egg-info/SOURCES.txt'\r\n",
        "installing library code to build/bdist.linux-x86_64/egg\r\n",
        "running install_lib\r\n",
        "running build_py\r\n",
        "creating build\r\n",
        "creating build/lib.linux-x86_64-2.7\r\n",
        "creating build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/kfile.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/khmer_args.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/thread_utils.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/utils.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/__init__.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying khmer/_version.py -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "creating build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_scripts.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_threaded_sequence_processor.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_functions.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_hll.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_counting_single.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_read_aligner.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_labelhash.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_normalize_by_median.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_subset_graph.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/__init__.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_counting_hash.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_hashbits.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_hashbits_obj.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_version.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_graph.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_filter.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/khmer_tst_utils.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_script_arguments.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_sandbox_scripts.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_read_parsers.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "copying tests/test_lump.py -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "creating build/lib.linux-x86_64-2.7/oxli\r\n",
        "copying oxli/functions.py -> build/lib.linux-x86_64-2.7/oxli\r\n",
        "copying oxli/build_graph.py -> build/lib.linux-x86_64-2.7/oxli\r\n",
        "copying oxli/__init__.py -> build/lib.linux-x86_64-2.7/oxli\r\n",
        "copying khmer/_khmer.cc -> build/lib.linux-x86_64-2.7/khmer\r\n",
        "copying tests/.gitignore -> build/lib.linux-x86_64-2.7/khmer/tests\r\n",
        "creating build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/100-reads.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/100-reads.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/100-reads.fq.truncated.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/100-reads.fq.truncated.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/all-A.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/badversion-k12.ct -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/badversion-k12.ht -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/badversion-k32.stoptags -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/badversion-k32.tagset -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/biglump-random-20-a.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/casava_18-pe.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/combine_parts_1.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/dn-test-all-paired-all-keep.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/dn-test-none-paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/dn-test-some-paired-all-keep.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/empty-file -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/fakelump.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/fakelump.fa.stoptags.txt -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/filter-test-A.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/filter-test-B.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/goodversion-k12.ht -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/goodversion-k12.ht.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/goodversion-k32.stoptags -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/goodversion-k32.tagset -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/normC20k20.ct -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/old-style-format-w-comments.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/overlap.out -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken2.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken2.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken3.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-broken3.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed-2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed-broken.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fa.pe -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fa.se -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fq.pe -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired-mixed.fq.se -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fa.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fa.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fq.1 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired.fq.2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/paired_one.base.dif.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-X2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.even.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fa.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fa.part -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-a.odd.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-20-b.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/random-31-c.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/real-partition-small.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/real-partition-tiny.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/single-read.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.fa.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-2.paired2.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-3.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-impaired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-paired.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read-paired.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-abund-read.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-empty.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-empty.fa.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-error-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-fastq-n-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-fastq-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-filter-abund-Ns.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-graph.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-graph2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-graph5.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-labels.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-large.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "copying tests/test-data/test-output-partitions.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-overlap1.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-overlap2.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-reads.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-reads.fq.bz2 -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-reads.fq.gz -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-short.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-sweep-contigs.fp -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-sweep-reads.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-sweep-reads.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/test-transcript.fa -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "copying tests/test-data/truncated.fq -> build/lib.linux-x86_64-2.7/khmer/tests/test-data\r\n",
        "running build_ext\r\n",
        "bash -c cd third-party/zlib && ( test Makefile -nt configure || bash ./configure --static ) && make -f Makefile.pic PIC\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking for gcc...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Building static library libz.a version 1.2.8 with gcc.\r\n",
        "Checking for off64_t... Yes.\r\n",
        "Checking for fseeko... Yes.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking for strerror... Yes.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking for unistd.h... Yes.\r\n",
        "Checking for stdarg.h... Yes.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking whether to use vs[n]printf() or s[n]printf()... using vs[n]printf().\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking for vsnprintf() in stdio.h... Yes.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking for return value of vsnprintf()... Yes.\r\n",
        "Checking for attribute(visibility) support... Yes.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/adler32.o adler32.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/crc32.o crc32.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/deflate.o deflate.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/infback.o infback.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inffast.o inffast.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inflate.o inflate.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inftrees.o inftrees.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/trees.o trees.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/zutil.o zutil.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/compress.o compress.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/uncompr.o uncompr.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzclose.o gzclose.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzlib.o gzlib.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzread.o gzread.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -O3  -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzwrite.o gzwrite.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "bash -c cd third-party/bzip2 && make -f Makefile-libbz2_so all\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c blocksort.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "In function \u2018mainSort\u2019:\r\n",
        "blocksort.c:347:6: warning: inlining failed in call to \u2018mainGtU.part.0\u2019: call is unlikely and code size would grow [-Winline]\r\n",
        " Bool mainGtU ( UInt32  i1, \r\n",
        "      ^\r\n",
        "cc1: warning: called from here [-Winline]\r\n",
        "blocksort.c:347:6: warning: inlining failed in call to \u2018mainGtU.part.0\u2019: call is unlikely and code size would grow [-Winline]\r\n",
        " Bool mainGtU ( UInt32  i1, \r\n",
        "      ^\r\n",
        "cc1: warning: called from here [-Winline]\r\n",
        "blocksort.c:347:6: warning: inlining failed in call to \u2018mainGtU.part.0\u2019: call is unlikely and code size would grow [-Winline]\r\n",
        " Bool mainGtU ( UInt32  i1, \r\n",
        "      ^\r\n",
        "cc1: warning: called from here [-Winline]\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c huffman.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c crctable.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c randtable.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c compress.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c decompress.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -c bzlib.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "#gcc -shared -Wl,-soname -Wl,libbz2.so.1.0 -o libbz2.so.1.0.6 blocksort.o huffman.o crctable.o randtable.o compress.o decompress.o bzlib.o\r\n",
        "#gcc -fpic -fPIC -Wall -Winline -O2 -g -D_FILE_OFFSET_BITS=64 -o bzip2-shared bzip2.c libbz2.so.1.0.6\r\n",
        "#rm -f libbz2.so.1.0\r\n",
        "#ln -s libbz2.so.1.0.6 libbz2.so.1.0\r\n",
        "building 'khmer._khmer' extension\r\n",
        "creating build/temp.linux-x86_64-2.7\r\n",
        "creating build/temp.linux-x86_64-2.7/khmer\r\n",
        "creating build/temp.linux-x86_64-2.7/lib\r\n",
        "creating build/temp.linux-x86_64-2.7/third-party\r\n",
        "creating build/temp.linux-x86_64-2.7/third-party/smhasher\r\n",
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c khmer/_khmer.cc -o build/temp.linux-x86_64-2.7/khmer/_khmer.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/trace_logger.cc -o build/temp.linux-x86_64-2.7/lib/trace_logger.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/perf_metrics.cc -o build/temp.linux-x86_64-2.7/lib/perf_metrics.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/read_parsers.cc -o build/temp.linux-x86_64-2.7/lib/read_parsers.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/kmer_hash.cc -o build/temp.linux-x86_64-2.7/lib/kmer_hash.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hashtable.cc -o build/temp.linux-x86_64-2.7/lib/hashtable.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hashbits.cc -o build/temp.linux-x86_64-2.7/lib/hashbits.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/labelhash.cc -o build/temp.linux-x86_64-2.7/lib/labelhash.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/counting.cc -o build/temp.linux-x86_64-2.7/lib/counting.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/subset.cc -o build/temp.linux-x86_64-2.7/lib/subset.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/read_aligner.cc -o build/temp.linux-x86_64-2.7/lib/read_aligner.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c lib/hllcounter.cc -o build/temp.linux-x86_64-2.7/lib/hllcounter.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "x86_64-linux-gnu-gcc -pthread -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -fPIC -DVERSION=1.4+261.g75f6fbf -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -UNO_UNIQUE_RC -Ilib -Ithird-party/zlib -Ithird-party/bzip2 -Ithird-party/seqan/core/include -Ithird-party/smhasher -I/usr/include/python2.7 -c third-party/smhasher/MurmurHash3.cc -o build/temp.linux-x86_64-2.7/third-party/smhasher/MurmurHash3.o -O3 -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "c++ -pthread -shared -Wl,-O1 -Wl,-Bsymbolic-functions -Wl,-Bsymbolic-functions -Wl,-z,relro -fno-strict-aliasing -DNDEBUG -g -fwrapv -O2 -Wall -Wstrict-prototypes -D_FORTIFY_SOURCE=2 -g -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security build/temp.linux-x86_64-2.7/khmer/_khmer.o build/temp.linux-x86_64-2.7/lib/trace_logger.o build/temp.linux-x86_64-2.7/lib/perf_metrics.o build/temp.linux-x86_64-2.7/lib/read_parsers.o build/temp.linux-x86_64-2.7/lib/kmer_hash.o build/temp.linux-x86_64-2.7/lib/hashtable.o build/temp.linux-x86_64-2.7/lib/hashbits.o build/temp.linux-x86_64-2.7/lib/labelhash.o build/temp.linux-x86_64-2.7/lib/counting.o build/temp.linux-x86_64-2.7/lib/subset.o build/temp.linux-x86_64-2.7/lib/read_aligner.o build/temp.linux-x86_64-2.7/lib/hllcounter.o build/temp.linux-x86_64-2.7/third-party/smhasher/MurmurHash3.o third-party/zlib/adler32.lo third-party/zlib/compress.lo third-party/zlib/crc32.lo third-party/zlib/deflate.lo third-party/zlib/gzclose.lo third-party/zlib/gzlib.lo third-party/zlib/gzread.lo third-party/zlib/gzwrite.lo third-party/zlib/infback.lo third-party/zlib/inffast.lo third-party/zlib/inflate.lo third-party/zlib/inftrees.lo third-party/zlib/trees.lo third-party/zlib/uncompr.lo third-party/zlib/zutil.lo third-party/bzip2/blocksort.o third-party/bzip2/huffman.o third-party/bzip2/crctable.o third-party/bzip2/randtable.o third-party/bzip2/compress.o third-party/bzip2/decompress.o third-party/bzip2/bzlib.o -o build/lib.linux-x86_64-2.7/khmer/_khmer.so -fopenmp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "creating build/bdist.linux-x86_64\r\n",
        "creating build/bdist.linux-x86_64/egg\r\n",
        "creating build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/_khmer.cc -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/kfile.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/khmer_args.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/thread_utils.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/utils.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/__init__.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "creating build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_scripts.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_threaded_sequence_processor.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/.gitignore -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_functions.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_hll.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_counting_single.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_read_aligner.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_labelhash.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_normalize_by_median.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_subset_graph.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/__init__.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_counting_hash.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_hashbits.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_hashbits_obj.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_version.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_graph.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_filter.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/khmer_tst_utils.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_script_arguments.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_sandbox_scripts.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "creating build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k32.tagset -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k32.tagset -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.truncated.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k32.stoptags -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-all-paired-all-keep.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/biglump-random-20-a.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-3.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k12.ht -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/fakelump.fa.stoptags.txt -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa.se -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/overlap.out -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k12.ht.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken3.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.odd.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph5.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-fastq-n-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-contigs.fp -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-output-partitions.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq.se -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-some-paired-all-keep.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/combine_parts_1.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed-broken.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/filter-test-A.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-sweep-reads.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-X2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-overlap2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/normC20k20.ct -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k12.ht -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/old-style-format-w-comments.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.paired.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-empty.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-fastq-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-filter-abund-Ns.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/dn-test-none-paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.part -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken2.fq.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/single-read.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-labels.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-empty.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq.pe -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/empty-file -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.truncated.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/real-partition-tiny.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-large.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/real-partition-small.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-transcript.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-overlap1.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa.2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-impaired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fa.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/casava_18-pe.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph2.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken3.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-graph.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/fakelump.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired_one.base.dif.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed-2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.paired2.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-short.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/100-reads.fq.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-reads.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa.gz -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-b.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-error-reads.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/badversion-k12.ct -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/test-abund-read-2.fa.bz2 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/all-A.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/filter-test-B.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/goodversion-k32.stoptags -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-20-a.even.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/truncated.fq -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-mixed.fa.pe -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/paired-broken2.fq.1 -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test-data/random-31-c.fa -> build/bdist.linux-x86_64/egg/khmer/tests/test-data\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_read_parsers.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/tests/test_lump.py -> build/bdist.linux-x86_64/egg/khmer/tests\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/_khmer.so -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "copying build/lib.linux-x86_64-2.7/khmer/_version.py -> build/bdist.linux-x86_64/egg/khmer\r\n",
        "creating build/bdist.linux-x86_64/egg/oxli\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "copying build/lib.linux-x86_64-2.7/oxli/functions.py -> build/bdist.linux-x86_64/egg/oxli\r\n",
        "copying build/lib.linux-x86_64-2.7/oxli/build_graph.py -> build/bdist.linux-x86_64/egg/oxli\r\n",
        "copying build/lib.linux-x86_64-2.7/oxli/__init__.py -> build/bdist.linux-x86_64/egg/oxli\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/kfile.py to kfile.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/khmer_args.py to khmer_args.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/thread_utils.py to thread_utils.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/utils.py to utils.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/__init__.py to __init__.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_scripts.py to test_scripts.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_threaded_sequence_processor.py to test_threaded_sequence_processor.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_functions.py to test_functions.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hll.py to test_hll.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_counting_single.py to test_counting_single.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_read_aligner.py to test_read_aligner.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_labelhash.py to test_labelhash.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_normalize_by_median.py to test_normalize_by_median.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_subset_graph.py to test_subset_graph.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/__init__.py to __init__.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_counting_hash.py to test_counting_hash.pyc\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hashbits.py to test_hashbits.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_hashbits_obj.py to test_hashbits_obj.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_version.py to test_version.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_graph.py to test_graph.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_filter.py to test_filter.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/khmer_tst_utils.py to khmer_tst_utils.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_script_arguments.py to test_script_arguments.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_sandbox_scripts.py to test_sandbox_scripts.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_read_parsers.py to test_read_parsers.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/tests/test_lump.py to test_lump.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/_version.py to _version.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/oxli/functions.py to functions.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/oxli/build_graph.py to build_graph.pyc\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/oxli/__init__.py to __init__.pyc\r\n",
        "creating stub loader for khmer/_khmer.so\r\n",
        "byte-compiling build/bdist.linux-x86_64/egg/khmer/_khmer.py to _khmer.pyc\r\n",
        "creating build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "installing scripts to build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "running install_scripts\r\n",
        "running build_scripts\r\n",
        "creating build/scripts-2.7\r\n",
        "copying and adjusting scripts/normalize-by-median.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/load-graph.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/abundance-dist.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/annotate-partitions.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/abundance-dist-single.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/extract-long-sequences.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/count-overlap.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/partition-graph.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/merge-partitions.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/trim-low-abund.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/readstats.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/do-partition.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/load-into-counting.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/fastq-to-fasta.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/sample-reads-randomly.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/find-knots.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/filter-stoptags.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/count-median.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/extract-paired-reads.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/interleave-reads.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/extract-partitions.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/split-paired-reads.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/filter-abund.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/make-initial-stoptags.py -> build/scripts-2.7\r\n",
        "copying and adjusting scripts/filter-abund-single.py -> build/scripts-2.7\r\n",
        "changing mode of build/scripts-2.7/normalize-by-median.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/load-graph.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/abundance-dist.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/annotate-partitions.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/abundance-dist-single.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/extract-long-sequences.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/count-overlap.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/partition-graph.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/merge-partitions.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/trim-low-abund.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/readstats.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/do-partition.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/load-into-counting.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/fastq-to-fasta.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/sample-reads-randomly.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/find-knots.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/filter-stoptags.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/count-median.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/extract-paired-reads.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/interleave-reads.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/extract-partitions.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/split-paired-reads.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/filter-abund.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/make-initial-stoptags.py from 644 to 755\r\n",
        "changing mode of build/scripts-2.7/filter-abund-single.py from 644 to 755\r\n",
        "creating build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/normalize-by-median.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/load-graph.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/abundance-dist.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/annotate-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/abundance-dist-single.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/extract-long-sequences.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/count-overlap.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/partition-graph.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/merge-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/trim-low-abund.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/readstats.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/do-partition.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/load-into-counting.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/fastq-to-fasta.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/sample-reads-randomly.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/find-knots.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/filter-stoptags.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/count-median.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/extract-paired-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/interleave-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/extract-partitions.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/split-paired-reads.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/filter-abund.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/make-initial-stoptags.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "copying build/scripts-2.7/filter-abund-single.py -> build/bdist.linux-x86_64/egg/EGG-INFO/scripts\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/normalize-by-median.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/load-graph.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/abundance-dist.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/annotate-partitions.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/abundance-dist-single.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-long-sequences.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/count-overlap.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/partition-graph.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/merge-partitions.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/trim-low-abund.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/readstats.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/do-partition.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/load-into-counting.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/fastq-to-fasta.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/sample-reads-randomly.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/find-knots.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-stoptags.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/count-median.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-paired-reads.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/interleave-reads.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/extract-partitions.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/split-paired-reads.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-abund.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/make-initial-stoptags.py to 755\r\n",
        "changing mode of build/bdist.linux-x86_64/egg/EGG-INFO/scripts/filter-abund-single.py to 755\r\n",
        "copying khmer.egg-info/PKG-INFO -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/SOURCES.txt -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/dependency_links.txt -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/entry_points.txt -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/not-zip-safe -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/requires.txt -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "copying khmer.egg-info/top_level.txt -> build/bdist.linux-x86_64/egg/EGG-INFO\r\n",
        "writing build/bdist.linux-x86_64/egg/EGG-INFO/native_libs.txt\r\n",
        "creating dist\r\n",
        "creating 'dist/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg' and adding 'build/bdist.linux-x86_64/egg' to it\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "removing 'build/bdist.linux-x86_64/egg' (and everything under it)\r\n",
        "Processing khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg\r\n",
        "creating /usr/local/lib/python2.7/dist-packages/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg\r\n",
        "Extracting khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg to /usr/local/lib/python2.7/dist-packages\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Adding khmer 1.4-261.g75f6fbf to easy-install.pth file\r\n",
        "Installing count-median.py script to /usr/local/bin\r\n",
        "Installing split-paired-reads.py script to /usr/local/bin\r\n",
        "Installing filter-abund-single.py script to /usr/local/bin\r\n",
        "Installing filter-abund.py script to /usr/local/bin\r\n",
        "Installing abundance-dist.py script to /usr/local/bin\r\n",
        "Installing partition-graph.py script to /usr/local/bin\r\n",
        "Installing filter-stoptags.py script to /usr/local/bin\r\n",
        "Installing merge-partitions.py script to /usr/local/bin\r\n",
        "Installing sample-reads-randomly.py script to /usr/local/bin\r\n",
        "Installing normalize-by-median.py script to /usr/local/bin\r\n",
        "Installing extract-partitions.py script to /usr/local/bin\r\n",
        "Installing fastq-to-fasta.py script to /usr/local/bin\r\n",
        "Installing make-initial-stoptags.py script to /usr/local/bin\r\n",
        "Installing count-overlap.py script to /usr/local/bin\r\n",
        "Installing abundance-dist-single.py script to /usr/local/bin\r\n",
        "Installing load-into-counting.py script to /usr/local/bin\r\n",
        "Installing interleave-reads.py script to /usr/local/bin\r\n",
        "Installing load-graph.py script to /usr/local/bin\r\n",
        "Installing trim-low-abund.py script to /usr/local/bin\r\n",
        "Installing readstats.py script to /usr/local/bin\r\n",
        "Installing find-knots.py script to /usr/local/bin\r\n",
        "Installing annotate-partitions.py script to /usr/local/bin\r\n",
        "Installing extract-paired-reads.py script to /usr/local/bin\r\n",
        "Installing extract-long-sequences.py script to /usr/local/bin\r\n",
        "Installing do-partition.py script to /usr/local/bin\r\n",
        "Installing oxli script to /usr/local/bin\r\n",
        "\r\n",
        "Installed /usr/local/lib/python2.7/dist-packages/khmer-1.4_261.g75f6fbf-py2.7-linux-x86_64.egg\r\n",
        "Processing dependencies for khmer==1.4-261.g75f6fbf\r\n",
        "Searching for screed>=0.9\r\n",
        "Reading http://pypi.python.org/simple/screed/\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Best match: screed 0.9\r\n",
        "Downloading https://pypi.python.org/packages/source/s/screed/screed-0.9.tar.gz#md5=611dd11105489e4153265e055f13debd\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Processing screed-0.9.tar.gz\r\n",
        "Writing /tmp/easy_install-PGZAO3/screed-0.9/setup.cfg\r\n",
        "Running screed-0.9/setup.py -q bdist_egg --dist-dir /tmp/easy_install-PGZAO3/screed-0.9/egg-dist-tmp-pop6SP\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "zip_safe flag not set; analyzing archive contents...\r\n",
        "screed.tests.test_open_cm: module references __file__\r\n",
        "screed.tests.test_pygr_api: module references __file__\r\n",
        "screed.tests.screed_tst_utils: module references __file__\r\n",
        "screed.tests.test_shell: module references __file__\r\n",
        "screed.tests.test_open: module references __file__\r\n",
        "screed.tests.__main__: module references __file__\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Adding screed 0.9 to easy-install.pth file\r\n",
        "\r\n",
        "Installed /usr/local/lib/python2.7/dist-packages/screed-0.9-py2.7.egg\r\n",
        "Searching for bz2file\r\n",
        "Reading http://pypi.python.org/simple/bz2file/\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Best match: bz2file 0.98\r\n",
        "Downloading https://pypi.python.org/packages/source/b/bz2file/bz2file-0.98.tar.gz#md5=27d6f711ae0db6cfd1eb37f95621dfb5\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Processing bz2file-0.98.tar.gz\r\n",
        "Writing /tmp/easy_install-tyYdeg/bz2file-0.98/setup.cfg\r\n",
        "Running bz2file-0.98/setup.py -q bdist_egg --dist-dir /tmp/easy_install-tyYdeg/bz2file-0.98/egg-dist-tmp-poavWk\r\n",
        "zip_safe flag not set; analyzing archive contents...\r\n",
        "Adding bz2file 0.98 to easy-install.pth file\r\n",
        "\r\n",
        "Installed /usr/local/lib/python2.7/dist-packages/bz2file-0.98-py2.7.egg\r\n",
        "Finished processing dependencies for khmer==1.4-261.g75f6fbf\r\n"
       ]
      }
     ],
     "prompt_number": 19
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "The following script is contained within the *khmer* package and can estimate the total unique number of k-mers in your dataset.  Use cases for this might be a) determining how diverse a metagenome is compared to e.g., a bacterial genome for assembly, b) to compare k-mer diversity among multiple metagenomes, c) exploring the impacts of choice of length k for assembly.\n",
      "\n",
      "Next, to estimate the number unique k-mers in the datasets for multiple k's (17, 21, 25, 29, 33, 37), execute the scripts below.  The script output will identify the unique k-mers but will also save in a report named unique_count. (This takes about 15 minutes on a large instance and 8-10 minutes on an extra large.)"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!python unique-kmers.py -R unique_count -k 17 SRR172903.qc.fastq\n",
      "!python unique-kmers.py -R unique_count -k 21 SRR172903.qc.fastq\n",
      "!python unique-kmers.py -R unique_count -k 25 SRR172903.qc.fastq\n",
      "!python unique-kmers.py -R unique_count -k 29 SRR172903.qc.fastq\n",
      "!python unique-kmers.py -R unique_count -k 33 SRR172903.qc.fastq\n",
      "!python unique-kmers.py -R unique_count -k 37 SRR172903.qc.fastq"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 14330058\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 15287036\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 15446874\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 15427477\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 15147325\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "|| This is the script 'unique-kmers.py' in khmer.\r\n",
        "|| You are running khmer version 0+unknown\r\n",
        "|| You are also using screed version 0.9\r\n",
        "||\r\n",
        "|| If you use this script in a publication, please cite EACH of the following:\r\n",
        "||\r\n",
        "||   * MR Crusoe et al., 2014. http://dx.doi.org/10.6084/m9.figshare.979190\r\n",
        "||   * A. D\u00f6ring et al. http://dx.doi.org:80/10.1186/1471-2105-9-11\r\n",
        "||   * Irber and Brown, unpublished\r\n",
        "||\r\n",
        "|| Please see http://khmer.readthedocs.org/en/latest/citations.html for details.\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Estimated number of unique k-mers: 14910222\r\n"
       ]
      }
     ],
     "prompt_number": 20
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "You can see that this file now has in the first column the k-mer length and in the second column the estimated number of words of length k in the metagenomes. If you had multiple genomes, you could compare diversity of e.g., the total number of k-mers across datasets.  To view the results of the file, you can use the concatentate program/command \"cat\"."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat unique_count"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "17 14330058\r\n",
        "21 15287036\r\n",
        "25 15446874\r\n",
        "29 15427477\r\n",
        "33 15147325\r\n",
        "37 14910222"
       ]
      }
     ],
     "prompt_number": 21
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 5. Getting a sequence coverage profile:  What genes are present in my metagenome?\n",
      "\n",
      "\n",
      "Most metagenomic analysis require one to estimate the abundance of reference genes (e.g., orginating from genomes or one's own metagenomic assembly).  This tutorial will cover both cases where references are available or unavailable (requiring de novo assembly).  \n",
      "\n",
      "\n",
      "### 6. Case I - Reference genomes available.  \n",
      "\n",
      "For the mock HMP metagenome, the HMP has sequenced the genomes of the isolates used for this simulated dataset.  The list of these genomes can be obtained on the HMP website, and we provide it here in a Github repository, a tool used for collaboratively sharing data and code.  The command below will download data for this tutorial."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat ncbi_acc.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "NC_005008.1\r\n",
        "NC_005007.1\r\n",
        "NC_005003.1\r\n",
        "NC_005006.1\r\n",
        "NC_005004.1\r\n",
        "NC_009084.1\r\n",
        "NC_005005.1\r\n",
        "NC_000958.1\r\n",
        "NC_000959.1\r\n",
        "NC_009083.1\r\n",
        "NC_001264.1\r\n",
        "NC_001263.1\r\n",
        "NC_004461.1\r\n",
        "NC_009008.1\r\n",
        "NC_010079.1\r\n",
        "NC_007490.1\r\n",
        "NC_009007.1\r\n",
        "NC_007489.1\r\n",
        "NC_004350.1\r\n",
        "NC_007488.1\r\n",
        "NC_007493.1\r\n",
        "NC_007494.1\r\n",
        "NC_009085.1\r\n",
        "NC_009515.1\r\n",
        "NC_009614.1\r\n",
        "NC_000915.1\r\n",
        "NC_003028.3\r\n",
        "NC_000913.2\r\n",
        "NC_006085.1\r\n",
        "NC_003112.2\r\n"
       ]
      }
     ],
     "prompt_number": 22
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "The following command downloads all the genomes for each ID in the above list into a directory called \"genomes\".  "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!python fetch-genomes-fasta.py ncbi_acc.txt genomes"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005008.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005007.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005003.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005006.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005004.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009084.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_005005.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_000958.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_000959.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009083.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_001264.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_001263.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_004461.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009008.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_010079.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_007490.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009007.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_007489.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_004350.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_007488.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_007493.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_007494.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009085.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009515.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_009614.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_000915.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_003028.3..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_000913.2..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_006085.1..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Fetching NC_003112.2..."
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Done\r\n"
       ]
      }
     ],
     "prompt_number": 23
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 7. Estimating abundance of assembled contigs\n",
      "\n",
      "To estimate the representation of reference genes or genomes in your metagenome, you can align reads to references using read mapping software (e.g., Bowtie2, BWA, etc.).  In this tutorial, we will use Bowtie2 which we will install on this server.  We will then be  mapping the metagenome to a single reference genome (that we downloaded above). "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip\n",
      "!unzip bowtie2-2.2.5-linux-x86_64.zip"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 14:07:44--  http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip\r\n",
        "Resolving sourceforge.net (sourceforge.net)... 216.34.181.60\r\n",
        "Connecting to sourceforge.net (sourceforge.net)|216.34.181.60|:80... connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "302 Found\r\n",
        "Location: http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip/download [following]\r\n",
        "--2015-06-26 14:07:44--  http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip/download\r\n",
        "Connecting to sourceforge.net (sourceforge.net)|216.34.181.60|:80... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "302 Found\r\n",
        "Location: http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip?r=&ts=1435327664&use_mirror=iweb [following]\r\n",
        "--2015-06-26 14:07:44--  http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip?r=&ts=1435327664&use_mirror=iweb\r\n",
        "Resolving downloads.sourceforge.net (downloads.sourceforge.net)... 216.34.181.59\r\n",
        "Connecting to downloads.sourceforge.net (downloads.sourceforge.net)|216.34.181.59|:80... connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "302 Found\r\n",
        "Location: http://iweb.dl.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip [following]\r\n",
        "--2015-06-26 14:07:44--  http://iweb.dl.sourceforge.net/project/bowtie-bio/bowtie2/2.2.5/bowtie2-2.2.5-linux-x86_64.zip\r\n",
        "Resolving iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "70.38.0.134, 2607:f748:10:12::5f:2\r\n",
        "Connecting to iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)|70.38.0.134|:80... connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "200 OK\r\n",
        "Length: 26413746 (25M) [application/octet-stream]\r\n",
        "Saving to: \u2018bowtie2-2.2.5-linux-x86_64.zip\u2019\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 0% [                                       ] 1,448       2.25KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 0% [                                       ] 9,640       10.9KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 0% [                                       ] 85,432      78.3KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 0% [                                       ] 207,064      127KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 1% [                                       ] 369,240      201KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 1% [                                       ] 473,000      215KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 2% [>                                      ] 700,832      291KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 2% [>                                      ] 777,576      227KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 3% [>                                      ] 1,009,256    219KB/s  eta 1m 53s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 3% [>                                      ] 1,009,256    181KB/s  eta 1m 53s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 4% [>                                      ] 1,245,280    215KB/s  eta 1m 54s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 4% [>                                      ] 1,310,968    203KB/s  eta 1m 54s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 5% [>                                      ] 1,341,376    199KB/s  eta 1m 54s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 5% [=>                                     ] 1,532,896    221KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 6% [=>                                     ] 1,719,192    240KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 7% [=>                                     ] 1,903,584    259KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 8% [==>                                    ] 2,128,024    281KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 8% [==>                                    ] 2,202,448    277KB/s  eta 1m 50s "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 9% [==>                                    ] 2,474,672    304KB/s  eta 77s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "10% [==>                                    ] 2,644,088    346KB/s  eta 77s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "10% [===>                                   ] 2,726,984    347KB/s  eta 77s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "10% [===>                                   ] 2,852,264    342KB/s  eta 77s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "11% [===>                                   ] 3,093,584    375KB/s  eta 69s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "12% [===>                                   ] 3,360,512    391KB/s  eta 69s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "13% [====>                                  ] 3,596,536    390KB/s  eta 69s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "14% [====>                                  ] 3,839,800    456KB/s  eta 69s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "14% [====>                                  ] 3,892,648    426KB/s  eta 59s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [=====>                                 ] 4,146,048    624KB/s  eta 59s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [=====>                                 ] 4,173,824    526KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [=====>                                 ] 4,173,824    452KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "16% [=====>                                 ] 4,451,152    447KB/s  eta 65s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "17% [=====>                                 ] 4,690,072    413KB/s  eta 65s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "18% [======>                                ] 4,987,976    391KB/s  eta 65s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 5,183,456    367KB/s  eta 66s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 5,183,456    332KB/s  eta 66s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 5,183,456    303KB/s  eta 74s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 5,187,800    285KB/s  eta 74s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 5,280,472    274KB/s  eta 74s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "20% [=======>                               ] 5,452,024    271KB/s  eta 75s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "21% [=======>                               ] 5,569,312    260KB/s  eta 75s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "22% [=======>                               ] 5,928,416    269KB/s  eta 75s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "23% [========>                              ] 6,293,312    299KB/s  eta 75s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "25% [========>                              ] 6,642,760    317KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "26% [=========>                             ] 7,094,536    338KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "28% [==========>                            ] 7,602,784    360KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "29% [==========>                            ] 7,687,720    347KB/s  eta 61s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "29% [==========>                            ] 7,901,072    352KB/s  eta 51s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "30% [==========>                            ] 8,115,824    353KB/s  eta 51s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 8,194,016    352KB/s  eta 51s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 8,385,208    351KB/s  eta 51s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "32% [===========>                           ] 8,628,472    425KB/s  eta 51s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "33% [============>                          ] 8,915,176    429KB/s  eta 45s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "34% [============>                          ] 9,016,744    476KB/s  eta 45s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "34% [============>                          ] 9,154,560    494KB/s  eta 45s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "35% [============>                          ] 9,389,632    804KB/s  eta 45s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "35% [============>                          ] 9,433,088    772KB/s  eta 43s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "36% [=============>                         ] 9,696,680    882KB/s  eta 43s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "37% [=============>                         ] 9,809,128    816KB/s  eta 43s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "37% [=============>                         ] 9,906,640    735KB/s  eta 42s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "37% [=============>                         ] 10,000,760   671KB/s  eta 42s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "38% [==============>                        ] 10,235,336   687KB/s  eta 42s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "39% [==============>                        ] 10,442,400   653KB/s  eta 42s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "40% [==============>                        ] 10,692,904   607KB/s  eta 42s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "41% [===============>                       ] 10,996,984   648KB/s  eta 37s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "42% [===============>                       ] 11,345,952   681KB/s  eta 37s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "43% [===============>                       ] 11,358,208   667KB/s  eta 37s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "43% [================>                      ] 11,557,080   648KB/s  eta 37s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "44% [================>                      ] 11,628,792   582KB/s  eta 35s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "45% [================>                      ] 11,888,040   511KB/s  eta 35s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "46% [================>                      ] 12,160,072   541KB/s  eta 35s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "46% [=================>                     ] 12,264,328   517KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "47% [=================>                     ] 12,465,368   564KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "47% [=================>                     ] 12,663,744   516KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "48% [==================>                    ] 12,872,256   552KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "49% [==================>                    ] 13,054,648   584KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "50% [==================>                    ] 13,279,088   584KB/s  eta 33s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "50% [==================>                    ] 13,287,280   549KB/s  eta 31s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "51% [===================>                   ] 13,565,296   485KB/s  eta 31s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "51% [===================>                   ] 13,653,784   457KB/s  eta 30s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "52% [===================>                   ] 13,846,368   439KB/s  eta 30s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "53% [===================>                   ] 14,091,080   462KB/s  eta 30s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "53% [===================>                   ] 14,099,768   462KB/s  eta 30s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "53% [====================>                  ] 14,228,304   415KB/s  eta 29s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "54% [====================>                  ] 14,493,096   479KB/s  eta 29s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "55% [====================>                  ] 14,653,824   438KB/s  eta 29s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "56% [=====================>                 ] 14,952,112   494KB/s  eta 29s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "56% [=====================>                 ] 15,044,784   465KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "57% [=====================>                 ] 15,205,512   444KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "58% [=====================>                 ] 15,366,240   509KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "58% [=====================>                 ] 15,470,840   424KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 15,666,320   457KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 15,728,640   400KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 15,732,984   343KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 15,802,488   324KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "60% [======================>                ] 15,996,576   340KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "60% [======================>                ] 16,040,016   308KB/s  eta 26s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "61% [======================>                ] 16,203,640   319KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "61% [=======================>               ] 16,374,504   333KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "62% [=======================>               ] 16,465,728   305KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "62% [=======================>               ] 16,468,624   290KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "63% [=======================>               ] 16,699,808   296KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "64% [========================>              ] 16,944,768   306KB/s  eta 25s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "65% [========================>              ] 17,184,200   306KB/s  eta 23s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "66% [========================>              ] 17,471,400   314KB/s  eta 23s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "66% [========================>              ] 17,578,912   297KB/s  eta 23s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "66% [=========================>             ] 17,670,136   294KB/s  eta 23s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "67% [=========================>             ] 17,846,792   300KB/s  eta 21s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "68% [=========================>             ] 18,014,760   304KB/s  eta 21s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "69% [=========================>             ] 18,258,024   348KB/s  eta 21s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "70% [==========================>            ] 18,541,832   465KB/s  eta 21s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "71% [==========================>            ] 18,889,352   523KB/s  eta 21s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "71% [==========================>            ] 18,945,696   466KB/s  eta 18s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "73% [===========================>           ] 19,287,424   522KB/s  eta 18s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "74% [===========================>           ] 19,637,704   615KB/s  eta 18s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "75% [============================>          ] 19,828,840   754KB/s  eta 18s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "76% [============================>          ] 20,225,096   795KB/s  eta 18s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "77% [=============================>         ] 20,393,560   779KB/s  eta 14s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "77% [=============================>         ] 20,602,072   820KB/s  eta 14s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "78% [=============================>         ] 20,815,240   855KB/s  eta 14s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "79% [==============================>        ] 21,121,280   859KB/s  eta 14s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "80% [==============================>        ] 21,180,416   843KB/s  eta 14s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "81% [==============================>        ] 21,400,648   822KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "81% [==============================>        ] 21,489,928   824KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "82% [==============================>        ] 21,663,992   732KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "83% [===============================>       ] 21,926,080   751KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "84% [===============================>       ] 22,193,960   766KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "84% [================================>      ] 22,447,360   768KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "86% [================================>      ] 22,745,648   751KB/s  eta 11s    "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "86% [================================>      ] 22,844,112   797KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "87% [=================================>     ] 23,127,712   733KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "88% [=================================>     ] 23,326,088   699KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "89% [=================================>     ] 23,556,320   747KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "89% [=================================>     ] 23,593,968   674KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "90% [==================================>    ] 23,783,072   672KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "90% [==================================>    ] 23,993,984   644KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "91% [==================================>    ] 24,266,704   652KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "92% [==================================>    ] 24,313,856   554KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "92% [==================================>    ] 24,316,752   484KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "92% [==================================>    ] 24,362,592   469KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "93% [===================================>   ] 24,641,104   507KB/s  eta 4s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "94% [===================================>   ] 24,858,304   535KB/s  eta 4s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "94% [===================================>   ] 24,969,216   503KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "94% [===================================>   ] 24,969,216   438KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "95% [====================================>  ] 25,100,288   380KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "95% [====================================>  ] 25,101,736   337KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "96% [====================================>  ] 25,366,776   325KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "96% [====================================>  ] 25,543,432   317KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "97% [====================================>  ] 25,634,216   302KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "98% [=====================================> ] 25,900,704   301KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "99% [=====================================> ] 26,168,392   292KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "100%[======================================>] 26,413,746   313KB/s   in 60s    \r\n",
        "\r\n",
        "2015-06-26 14:08:44 (428 KB/s) - \u2018bowtie2-2.2.5-linux-x86_64.zip\u2019 saved [26413746/26413746]\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Archive:  bowtie2-2.2.5-linux-x86_64.zip\r\n",
        "   creating: bowtie2-2.2.5/\r\n",
        "  inflating: bowtie2-2.2.5/AUTHORS   \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2   \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-align-l  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-align-l-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-align-s  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-align-s-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-build  \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-build-l  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-build-l-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-build-s  \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-build-s-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-inspect  \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-inspect-l  \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-inspect-l-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-inspect-s  \r\n",
        "  inflating: bowtie2-2.2.5/bowtie2-inspect-s-debug  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "   creating: bowtie2-2.2.5/doc/\r\n",
        "  inflating: bowtie2-2.2.5/doc/manual.html  \r\n",
        "  inflating: bowtie2-2.2.5/doc/README  \r\n",
        "  inflating: bowtie2-2.2.5/doc/style.css  \r\n",
        "   creating: bowtie2-2.2.5/example/\r\n",
        "   creating: bowtie2-2.2.5/example/index/\r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.1.bt2  \r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.2.bt2  \r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.3.bt2  \r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.4.bt2  \r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.rev.1.bt2  \r\n",
        "  inflating: bowtie2-2.2.5/example/index/lambda_virus.rev.2.bt2  \r\n",
        "   creating: bowtie2-2.2.5/example/reads/\r\n",
        "  inflating: bowtie2-2.2.5/example/reads/longreads.fq  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/example/reads/reads_1.fq  "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "  inflating: bowtie2-2.2.5/example/reads/reads_2.fq  \r\n",
        "  inflating: bowtie2-2.2.5/example/reads/simulate.pl  \r\n",
        "   creating: bowtie2-2.2.5/example/reference/\r\n",
        "  inflating: bowtie2-2.2.5/example/reference/lambda_virus.fa  \r\n",
        "  inflating: bowtie2-2.2.5/LICENSE   \r\n",
        "  inflating: bowtie2-2.2.5/MANUAL    \r\n",
        "  inflating: bowtie2-2.2.5/MANUAL.markdown  \r\n",
        "  inflating: bowtie2-2.2.5/NEWS      \r\n",
        "   creating: bowtie2-2.2.5/scripts/\r\n",
        "  inflating: bowtie2-2.2.5/scripts/convert_quals.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/debug_wrapper.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/gen_2b_occ_lookup.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/gen_occ_lookup.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/gen_solqual_lookup.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/infer_fraglen.pl  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_a_thaliana_tair.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_b_taurus_UMD3.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_canFam2.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_c_elegans.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_d_melanogaster.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_e_coli.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_hg18.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_hg19.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_h_sapiens_ncbi36.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_h_sapiens_ncbi37.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_mm10.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_mm9.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_m_musculus_ncbi37.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_rn4.sh  \r\n",
        "  inflating: bowtie2-2.2.5/scripts/make_s_cerevisiae.sh  \r\n",
        "  inflating: bowtie2-2.2.5/TUTORIAL  \r\n",
        " extracting: bowtie2-2.2.5/VERSION   \r\n"
       ]
      }
     ],
     "prompt_number": 24
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "I've written a script that will automatically map a set of reads to a given reference and output a file containing the number of reads that are mapped to a given reference.  To use this script, we'll also need to install samtools.  A samfile is a super compressed file that efficiently stores mapped information from mappers.  Samtools helps us interact with this file."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!apt-get install samtools"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Reading package lists... 0%\r",
        "\r",
        "Reading package lists... 100%\r",
        "\r",
        "Reading package lists... Done\r",
        "\r\n",
        "\r",
        "Building dependency tree... 0%\r",
        "\r",
        "Building dependency tree... 0%\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Building dependency tree... 50%\r",
        "\r",
        "Building dependency tree... 50%\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "Building dependency tree       \r",
        "\r\n",
        "\r",
        "Reading state information... 0%\r",
        "\r",
        "Reading state information... 0%\r",
        "\r",
        "Reading state information... Done\r",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "The following NEW packages will be installed:\r\n",
        "  samtools\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "0 upgraded, 1 newly installed, 0 to remove and 14 not upgraded.\r\n",
        "Need to get 560 kB of archives.\r\n",
        "After this operation, 1,336 kB of additional disk space will be used.\r\n",
        "\r",
        "\r",
        "0% [Working]\r",
        "            \r",
        "Get:1 http://us-east-1.ec2.archive.ubuntu.com/ubuntu/ saucy/universe samtools amd64 0.1.19-1 [560 kB]\r\n",
        "\r",
        "            \r",
        "3% [1 samtools 14.0 kB/560 kB 3%]\r",
        "                                 \r",
        "100% [Working]\r",
        "              \r",
        "Fetched 560 kB in 0s (22.3 MB/s)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Selecting previously unselected package samtools.\r\n",
        "(Reading database ... \r",
        "(Reading database ... 5%\r",
        "(Reading database ... 10%\r",
        "(Reading database ... 15%\r",
        "(Reading database ... 20%\r",
        "(Reading database ... 25%\r",
        "(Reading database ... 30%\r",
        "(Reading database ... 35%\r",
        "(Reading database ... 40%\r",
        "(Reading database ... 45%\r",
        "(Reading database ... 50%\r",
        "(Reading database ... 55%\r",
        "(Reading database ... 60%\r",
        "(Reading database ... 65%\r",
        "(Reading database ... 70%\r",
        "(Reading database ... 75%\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "(Reading database ... 80%\r",
        "(Reading database ... 85%\r",
        "(Reading database ... 90%\r",
        "(Reading database ... 95%\r",
        "(Reading database ... 100%\r",
        "(Reading database ... 112754 files and directories currently installed.)\r\n",
        "Unpacking samtools (from .../samtools_0.1.19-1_amd64.deb) ...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Processing triggers for man-db ...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Setting up samtools (0.1.19-1) ...\r\n"
       ]
      }
     ],
     "prompt_number": 25
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "To map reads to a reference, we have provided an easy to use program.  The steps the program performs are as follows:\n",
      "\n",
      "* Index your reference genome,\n",
      "* Map reads to your index genome (with default bowtie parameters),\n",
      "* Use Samtools to estimate the number of reads mapped, number of reads unmapped, and provide a tab delimited file with each line consisting of reference sequence name, sequence length, # mapped reads and # unmapped reads.\n",
      "\n",
      "This takes about 8-10 minutes."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash bowtie.sh genomes/NC_000913.2.fa SRR172903.qc.fastq"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Reference is genomes/NC_000913.2.fa\r\n",
        "Reads are SRR172903.qc.fastq\r\n",
        "Settings:\r\n",
        "  Output files: \"genomes/NC_000913.2.fa-bowtie-index.*.bt2\"\r\n",
        "  Line rate: 6 (line is 64 bytes)\r\n",
        "  Lines per side: 1 (side is 64 bytes)\r\n",
        "  Offset rate: 4 (one in 16)\r\n",
        "  FTable chars: 10\r\n",
        "  Strings: unpacked\r\n",
        "  Max bucket size: default\r\n",
        "  Max bucket size, sqrt multiplier: default\r\n",
        "  Max bucket size, len divisor: 4\r\n",
        "  Difference-cover sample period: 1024\r\n",
        "  Endianness: little\r\n",
        "  Actual local endianness: little\r\n",
        "  Sanity checking: disabled\r\n",
        "  Assertions: disabled\r\n",
        "  Random seed: 0\r\n",
        "  Sizeofs: void*:8, int:4, long:8, size_t:8\r\n",
        "Input files DNA, FASTA:\r\n",
        "  genomes/NC_000913.2.fa\r\n",
        "Building a SMALL index\r\n",
        "Reading reference sizes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time reading reference sizes: 00:00:00\r\n",
        "Calculating joined length\r\n",
        "Writing header\r\n",
        "Reserving space for joined string\r\n",
        "Joining reference sequences\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time to join reference sequences: 00:00:00\r\n",
        "bmax according to bmaxDivN setting: 1159918\r\n",
        "Using parameters --bmax 869939 --dcv 1024\r\n",
        "  Doing ahead-of-time memory usage test\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Passed!  Constructing with these parameters: --bmax 869939 --dcv 1024\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Constructing suffix-array element generator\r\n",
        "Building DifferenceCoverSample\r\n",
        "  Building sPrime\r\n",
        "  Building sPrimeOrder\r\n",
        "  V-Sorting samples\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  V-Sorting samples time: 00:00:00\r\n",
        "  Allocating rank array\r\n",
        "  Ranking v-sort output\r\n",
        "  Ranking v-sort output time: 00:00:00\r\n",
        "  Invoking Larsson-Sadakane on ranks\r\n",
        "  Invoking Larsson-Sadakane on ranks time: 00:00:00\r\n",
        "  Sanity-checking and returning\r\n",
        "Building samples\r\n",
        "Reserving space for 12 sample suffixes\r\n",
        "Generating random suffixes\r\n",
        "QSorting 12 sample offsets, eliminating duplicates\r\n",
        "QSorting sample offsets, eliminating duplicates time: 00:00:00\r\n",
        "Multikey QSorting 12 samples\r\n",
        "  (Using difference cover)\r\n",
        "  Multikey QSorting samples time: 00:00:00\r\n",
        "Calculating bucket sizes\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:00\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Split 2, merged 6; iterating...\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:00\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Split 1, merged 1; iterating...\r\n",
        "  Binary sorting into buckets\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:01\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Avg bucket size: 579958 (target: 869938)\r\n",
        "Converting suffix-array elements to index image\r\n",
        "Allocating ftab, absorbFtab\r\n",
        "Entering Ebwt loop\r\n",
        "Getting block 1 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 566788\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 566789\r\n",
        "Getting block 2 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 564637\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 564638\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 3 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 645098\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 645099\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 4 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 234151\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 234152\r\n",
        "Getting block 5 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 643592\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 643593\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 6 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 711613\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 711614\r\n",
        "Getting block 7 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 574603\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 574604\r\n",
        "Getting block 8 of 8\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 699186\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 699187\r\n",
        "Exited Ebwt loop\r\n",
        "fchr[A]: 0\r\n",
        "fchr[C]: 1142228\r\n",
        "fchr[G]: 2321782\r\n",
        "fchr[T]: 3498705\r\n",
        "fchr[$]: 4639675\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Exiting Ebwt::buildToDisk()\r\n",
        "Returning from initFromVector\r\n",
        "Wrote 5741113 bytes to primary EBWT file: genomes/NC_000913.2.fa-bowtie-index.1.bt2\r\n",
        "Wrote 1159924 bytes to secondary EBWT file: genomes/NC_000913.2.fa-bowtie-index.2.bt2\r\n",
        "Re-opening _in1 and _in2 as input streams\r\n",
        "Returning from Ebwt constructor\r\n",
        "Headers:\r\n",
        "    len: 4639675\r\n",
        "    bwtLen: 4639676\r\n",
        "    sz: 1159919\r\n",
        "    bwtSz: 1159919\r\n",
        "    lineRate: 6\r\n",
        "    offRate: 4\r\n",
        "    offMask: 0xfffffff0\r\n",
        "    ftabChars: 10\r\n",
        "    eftabLen: 20\r\n",
        "    eftabSz: 80\r\n",
        "    ftabLen: 1048577\r\n",
        "    ftabSz: 4194308\r\n",
        "    offsLen: 289980\r\n",
        "    offsSz: 1159920\r\n",
        "    lineSz: 64\r\n",
        "    sideSz: 64\r\n",
        "    sideBwtSz: 48\r\n",
        "    sideBwtLen: 192\r\n",
        "    numSides: 24165\r\n",
        "    numLines: 24165\r\n",
        "    ebwtTotLen: 1546560\r\n",
        "    ebwtTotSz: 1546560\r\n",
        "    color: 0\r\n",
        "    reverse: 0\r\n",
        "Total time for call to driver() for forward index: 00:00:02\r\n",
        "Reading reference sizes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time reading reference sizes: 00:00:00\r\n",
        "Calculating joined length\r\n",
        "Writing header\r\n",
        "Reserving space for joined string\r\n",
        "Joining reference sequences\r\n",
        "  Time to join reference sequences: 00:00:00\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time to reverse reference sequence: 00:00:00\r\n",
        "bmax according to bmaxDivN setting: 1159918\r\n",
        "Using parameters --bmax 869939 --dcv 1024\r\n",
        "  Doing ahead-of-time memory usage test\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Passed!  Constructing with these parameters: --bmax 869939 --dcv 1024\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Constructing suffix-array element generator\r\n",
        "Building DifferenceCoverSample\r\n",
        "  Building sPrime\r\n",
        "  Building sPrimeOrder\r\n",
        "  V-Sorting samples\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  V-Sorting samples time: 00:00:00\r\n",
        "  Allocating rank array\r\n",
        "  Ranking v-sort output\r\n",
        "  Ranking v-sort output time: 00:00:00\r\n",
        "  Invoking Larsson-Sadakane on ranks\r\n",
        "  Invoking Larsson-Sadakane on ranks time: 00:00:00\r\n",
        "  Sanity-checking and returning\r\n",
        "Building samples\r\n",
        "Reserving space for 12 sample suffixes\r\n",
        "Generating random suffixes\r\n",
        "QSorting 12 sample offsets, eliminating duplicates\r\n",
        "QSorting sample offsets, eliminating duplicates time: 00:00:00\r\n",
        "Multikey QSorting 12 samples\r\n",
        "  (Using difference cover)\r\n",
        "  Multikey QSorting samples time: 00:00:00\r\n",
        "Calculating bucket sizes\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:01\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Split 2, merged 6; iterating...\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:00\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Avg bucket size: 662810 (target: 869938)\r\n",
        "Converting suffix-array elements to index image\r\n",
        "Allocating ftab, absorbFtab\r\n",
        "Entering Ebwt loop\r\n",
        "Getting block 1 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 504667\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 504668\r\n",
        "Getting block 2 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 574835\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 574836\r\n",
        "Getting block 3 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 367744\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 367745\r\n",
        "Getting block 4 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 868288\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:01\r\n",
        "Returning block of 868289\r\n",
        "Getting block 5 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 852473\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 852474\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 6 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 759657\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 759658\r\n",
        "Getting block 7 of 7\r\n",
        "  Reserving size (869939) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 712005\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 712006\r\n",
        "Exited Ebwt loop\r\n",
        "fchr[A]: 0\r\n",
        "fchr[C]: 1142228\r\n",
        "fchr[G]: 2321782\r\n",
        "fchr[T]: 3498705\r\n",
        "fchr[$]: 4639675\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Exiting Ebwt::buildToDisk()\r\n",
        "Returning from initFromVector\r\n",
        "Wrote 5741113 bytes to primary EBWT file: genomes/NC_000913.2.fa-bowtie-index.rev.1.bt2\r\n",
        "Wrote 1159924 bytes to secondary EBWT file: genomes/NC_000913.2.fa-bowtie-index.rev.2.bt2\r\n",
        "Re-opening _in1 and _in2 as input streams\r\n",
        "Returning from Ebwt constructor\r\n",
        "Headers:\r\n",
        "    len: 4639675\r\n",
        "    bwtLen: 4639676\r\n",
        "    sz: 1159919\r\n",
        "    bwtSz: 1159919\r\n",
        "    lineRate: 6\r\n",
        "    offRate: 4\r\n",
        "    offMask: 0xfffffff0\r\n",
        "    ftabChars: 10\r\n",
        "    eftabLen: 20\r\n",
        "    eftabSz: 80\r\n",
        "    ftabLen: 1048577\r\n",
        "    ftabSz: 4194308\r\n",
        "    offsLen: 289980\r\n",
        "    offsSz: 1159920\r\n",
        "    lineSz: 64\r\n",
        "    sideSz: 64\r\n",
        "    sideBwtSz: 48\r\n",
        "    sideBwtLen: 192\r\n",
        "    numSides: 24165\r\n",
        "    numLines: 24165\r\n",
        "    ebwtTotLen: 1546560\r\n",
        "    ebwtTotSz: 1546560\r\n",
        "    color: 0\r\n",
        "    reverse: 1\r\n",
        "Total time for backward call to driver() for mirror index: 00:00:02\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "820417 reads; of these:\r\n",
        "  820417 (100.00%) were unpaired; of these:\r\n",
        "    793072 (96.67%) aligned 0 times\r\n",
        "    26531 (3.23%) aligned exactly 1 time\r\n",
        "    814 (0.10%) aligned >1 times\r\n",
        "3.33% overall alignment rate\r\n",
        "[samopen] SAM header is present: 1 sequences.\r\n"
       ]
      }
     ],
     "prompt_number": 26
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "We can look at the total number of reads mapped and unmapped from our metagenome to the genome NC_000913.2.  We can also get a file that shows the reference sequence name (first column), reference sequence length (second column), # mapped reads (third column) and # unmapped reads (last column).  The other columns contain information that samtools can use for other queries, you can read about samtools here, http://samtools.sourceforge.net/samtools.shtml."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads-mapped.count.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "27345\r\n"
       ]
      }
     ],
     "prompt_number": 27
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads-unmapped.count.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "793072\r\n"
       ]
      }
     ],
     "prompt_number": 28
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads.by.contigs.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gi|49175990|ref|NC_000913.2|\t4639675\t27345\t0\r\n",
        "*\t0\t0\t793072\r\n"
       ]
      }
     ],
     "prompt_number": 29
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "If you want a challenge, you can try mapping the metagenome to all reference genomes provided in the genome folder.  To do so, try concatentating all genomes into one file (using this command:  \"cat genomes/*fa >> all-genomes.fa\") and running the program on all-genomes.fa instead of NC_000913.2.fa."
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "\n",
      "### 8. Case II - *De novo* assembly of reference genes.\n",
      "\n",
      "\n",
      "###  Assembly of the HMP mock metagenome\n",
      "\n",
      "Assembly is the process of merging overlapping metagenomic reads from *hopefully* the same genome into a longer, continguous sequence (most commonly called a contig).  It is advantageous in that it provides longer lengths for sequences that can later be used as references (that may be previously unknown), reduces the dataset size for analysis, and provides references that are not dependent on previous knowledge.  \n",
      "\n",
      "The choice of what assembler to use is not an easy one and is a subject of debate (see http://assemblathon.org).  It is most important to remember that an assembly is a *hypothesized* consensus representation of your dataset.  The assembly itself is an initial step that needs to be followed by an evaluation of its accuracy and usefulness.  For most assemblers, the inputs are sequencing reads and paramters for the assembly software. For this tutorial, we will be completing the assembly with an assembler published in 2014 called Megahit (Li et al., 2015, https://github.com/voutcn/megahit).  Sharpton's review (Sharpton, 2014) also reviews quite nicely some of the many assembly programs and approaches for metagenomic assembly.  \n",
      "\n",
      "To reduce the memory that is needed, it is often advantageous to normalize the distribution of k-mers in a metagenome.  Removing extraneous information not needed for assembly also removes reads that may contain errors and may improve assembly (http://arxiv.org/abs/1203.4802).  These scripts and tutorials are available at http://ged.msu.edu/angus/diginorm-2012/tutorial.html.\n",
      "\n",
      "For this tutorial, we will assemble our metagenome with the Megathit assembler so first we have to install it.  "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash install-megahit.sh"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Cloning into 'megahit'...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "remote: Counting objects: 1505, done.\u001b[K\r\n",
        "remote: Compressing objects:   3% (1/27)   \u001b[K\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "remote: Compressing objects:   7% (2/27)   \u001b[K\r",
        "remote: Compressing objects:  11% (3/27)   \u001b[K\r",
        "remote: Compressing objects:  14% (4/27)   \u001b[K\r",
        "remote: Compressing objects:  18% (5/27)   \u001b[K\r",
        "remote: Compressing objects:  22% (6/27)   \u001b[K\r",
        "remote: Compressing objects:  25% (7/27)   \u001b[K\r",
        "remote: Compressing objects:  29% (8/27)   \u001b[K\r",
        "remote: Compressing objects:  33% (9/27)   \u001b[K\r",
        "remote: Compressing objects:  37% (10/27)   \u001b[K\r",
        "remote: Compressing objects:  40% (11/27)   \u001b[K\r",
        "remote: Compressing objects:  44% (12/27)   \u001b[K\r",
        "remote: Compressing objects:  48% (13/27)   \u001b[K\r",
        "remote: Compressing objects:  51% (14/27)   \u001b[K\r",
        "remote: Compressing objects:  55% (15/27)   \u001b[K\r",
        "remote: Compressing objects:  59% (16/27)   \u001b[K\r",
        "remote: Compressing objects:  62% (17/27)   \u001b[K\r",
        "remote: Compressing objects:  66% (18/27)   \u001b[K\r",
        "remote: Compressing objects:  70% (19/27)   \u001b[K\r",
        "remote: Compressing objects:  74% (20/27)   \u001b[K\r",
        "remote: Compressing objects:  77% (21/27)   \u001b[K\r",
        "remote: Compressing objects:  81% (22/27)   \u001b[K\r",
        "remote: Compressing objects:  85% (23/27)   \u001b[K\r",
        "remote: Compressing objects:  88% (24/27)   \u001b[K\r",
        "remote: Compressing objects:  92% (25/27)   \u001b[K\r",
        "remote: Compressing objects:  96% (26/27)   \u001b[K\r",
        "remote: Compressing objects: 100% (27/27)   \u001b[K\r",
        "remote: Compressing objects: 100% (27/27), done.\u001b[K\r\n",
        "Receiving objects:   0% (1/1505)   \r",
        "Receiving objects:   1% (16/1505)   \r",
        "Receiving objects:   2% (31/1505)   \r",
        "Receiving objects:   3% (46/1505)   \r",
        "Receiving objects:   4% (61/1505)   \r",
        "Receiving objects:   5% (76/1505)   \r",
        "Receiving objects:   6% (91/1505)   \r",
        "Receiving objects:   7% (106/1505)   \r",
        "Receiving objects:   8% (121/1505)   \r",
        "Receiving objects:   9% (136/1505)   \r",
        "Receiving objects:  10% (151/1505)   \r",
        "Receiving objects:  11% (166/1505)   \r",
        "Receiving objects:  12% (181/1505)   \r",
        "Receiving objects:  13% (196/1505)   \r",
        "Receiving objects:  14% (211/1505)   \r",
        "Receiving objects:  15% (226/1505)   \r",
        "Receiving objects:  16% (241/1505)   \r",
        "Receiving objects:  17% (256/1505)   \r",
        "Receiving objects:  18% (271/1505)   \r",
        "Receiving objects:  19% (286/1505)   \r",
        "Receiving objects:  20% (301/1505)   \r",
        "Receiving objects:  21% (317/1505)   \r",
        "Receiving objects:  22% (332/1505)   \r",
        "Receiving objects:  23% (347/1505)   \r",
        "Receiving objects:  24% (362/1505)   \r",
        "Receiving objects:  25% (377/1505)   \r",
        "Receiving objects:  26% (392/1505)   \r",
        "Receiving objects:  27% (407/1505)   \r",
        "Receiving objects:  28% (422/1505)   \r",
        "Receiving objects:  29% (437/1505)   \r",
        "Receiving objects:  30% (452/1505)   \r",
        "Receiving objects:  31% (467/1505)   \r",
        "Receiving objects:  32% (482/1505)   \r",
        "Receiving objects:  33% (497/1505)   \r",
        "Receiving objects:  34% (512/1505)   \r",
        "Receiving objects:  35% (527/1505)   \r",
        "Receiving objects:  36% (542/1505)   \r",
        "Receiving objects:  37% (557/1505)   \r",
        "Receiving objects:  38% (572/1505)   \r",
        "Receiving objects:  39% (587/1505)   \r",
        "Receiving objects:  40% (602/1505)   \r",
        "Receiving objects:  41% (618/1505)   \r",
        "Receiving objects:  42% (633/1505)   \r",
        "Receiving objects:  43% (648/1505)   \r",
        "Receiving objects:  44% (663/1505)   \r",
        "Receiving objects:  45% (678/1505)   \r",
        "Receiving objects:  46% (693/1505)   \r",
        "Receiving objects:  47% (708/1505)   \r",
        "Receiving objects:  48% (723/1505)   \r",
        "Receiving objects:  49% (738/1505)   \r",
        "Receiving objects:  50% (753/1505)   \r",
        "Receiving objects:  51% (768/1505)   \r",
        "Receiving objects:  52% (783/1505)   \r",
        "Receiving objects:  53% (798/1505)   \r",
        "Receiving objects:  54% (813/1505)   \r",
        "Receiving objects:  55% (828/1505)   \r",
        "Receiving objects:  56% (843/1505)   \r",
        "Receiving objects:  57% (858/1505)   \r",
        "Receiving objects:  58% (873/1505)   \r",
        "Receiving objects:  59% (888/1505)   \r",
        "Receiving objects:  60% (903/1505)   \r",
        "Receiving objects:  61% (919/1505)   \r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Receiving objects:  62% (934/1505)   \r",
        "Receiving objects:  63% (949/1505)   \r",
        "Receiving objects:  64% (964/1505)   \r",
        "Receiving objects:  65% (979/1505)   \r",
        "Receiving objects:  66% (994/1505)   \r",
        "Receiving objects:  67% (1009/1505)   \r",
        "Receiving objects:  68% (1024/1505)   \r",
        "Receiving objects:  69% (1039/1505)   \r",
        "Receiving objects:  70% (1054/1505)   \r",
        "Receiving objects:  71% (1069/1505)   \r",
        "Receiving objects:  72% (1084/1505)   \r",
        "Receiving objects:  73% (1099/1505)   \r",
        "Receiving objects:  74% (1114/1505)   \r",
        "Receiving objects:  75% (1129/1505)   \r",
        "Receiving objects:  76% (1144/1505)   \r",
        "Receiving objects:  77% (1159/1505)   \r",
        "Receiving objects:  78% (1174/1505)   \r",
        "Receiving objects:  79% (1189/1505)   \r",
        "Receiving objects:  80% (1204/1505)   \r",
        "Receiving objects:  81% (1220/1505)   \r",
        "Receiving objects:  82% (1235/1505)   \r",
        "Receiving objects:  83% (1250/1505)   \r",
        "Receiving objects:  84% (1265/1505)   \r",
        "Receiving objects:  85% (1280/1505)   \r",
        "Receiving objects:  86% (1295/1505)   \r",
        "Receiving objects:  87% (1310/1505)   \r",
        "Receiving objects:  88% (1325/1505)   \r",
        "Receiving objects:  89% (1340/1505)   \r",
        "Receiving objects:  90% (1355/1505)   \r",
        "Receiving objects:  91% (1370/1505)   \r",
        "Receiving objects:  92% (1385/1505)   \r",
        "Receiving objects:  93% (1400/1505)   \r",
        "Receiving objects:  94% (1415/1505)   \r",
        "Receiving objects:  95% (1430/1505)   \r",
        "Receiving objects:  96% (1445/1505)   \r",
        "Receiving objects:  97% (1460/1505)   \r",
        "Receiving objects:  98% (1475/1505)   \r",
        "Receiving objects:  99% (1490/1505)   \r",
        "remote: Total 1505 (delta 9), reused 0 (delta 0), pack-reused 1478\u001b[K\r\n",
        "Receiving objects: 100% (1505/1505)   \r",
        "Receiving objects: 100% (1505/1505), 1.06 MiB | 0 bytes/s, done.\r\n",
        "Resolving deltas:   0% (0/1033)   \r",
        "Resolving deltas:   4% (47/1033)   \r",
        "Resolving deltas:   8% (84/1033)   \r",
        "Resolving deltas:   9% (101/1033)   \r",
        "Resolving deltas:  11% (116/1033)   \r",
        "Resolving deltas:  12% (132/1033)   \r",
        "Resolving deltas:  13% (139/1033)   \r",
        "Resolving deltas:  14% (147/1033)   \r",
        "Resolving deltas:  15% (157/1033)   \r",
        "Resolving deltas:  16% (166/1033)   \r",
        "Resolving deltas:  17% (181/1033)   \r",
        "Resolving deltas:  18% (190/1033)   \r",
        "Resolving deltas:  19% (203/1033)   \r",
        "Resolving deltas:  20% (207/1033)   \r",
        "Resolving deltas:  22% (232/1033)   \r",
        "Resolving deltas:  23% (244/1033)   \r",
        "Resolving deltas:  24% (254/1033)   \r",
        "Resolving deltas:  25% (262/1033)   \r",
        "Resolving deltas:  26% (270/1033)   \r",
        "Resolving deltas:  27% (280/1033)   \r",
        "Resolving deltas:  28% (291/1033)   \r",
        "Resolving deltas:  29% (304/1033)   \r",
        "Resolving deltas:  31% (326/1033)   \r",
        "Resolving deltas:  32% (331/1033)   \r",
        "Resolving deltas:  33% (343/1033)   \r",
        "Resolving deltas:  34% (353/1033)   \r",
        "Resolving deltas:  35% (371/1033)   \r",
        "Resolving deltas:  36% (372/1033)   \r",
        "Resolving deltas:  37% (387/1033)   \r",
        "Resolving deltas:  38% (393/1033)   \r",
        "Resolving deltas:  39% (404/1033)   \r",
        "Resolving deltas:  40% (419/1033)   \r",
        "Resolving deltas:  42% (434/1033)   \r",
        "Resolving deltas:  43% (445/1033)   \r",
        "Resolving deltas:  44% (455/1033)   \r",
        "Resolving deltas:  45% (468/1033)   \r",
        "Resolving deltas:  46% (476/1033)   \r",
        "Resolving deltas:  49% (508/1033)   \r",
        "Resolving deltas:  50% (519/1033)   \r",
        "Resolving deltas:  52% (541/1033)   \r",
        "Resolving deltas:  53% (556/1033)   \r",
        "Resolving deltas:  54% (561/1033)   \r",
        "Resolving deltas:  55% (570/1033)   \r",
        "Resolving deltas:  57% (589/1033)   \r",
        "Resolving deltas:  58% (602/1033)   \r",
        "Resolving deltas:  59% (618/1033)   \r",
        "Resolving deltas:  60% (620/1033)   \r",
        "Resolving deltas:  61% (635/1033)   \r",
        "Resolving deltas:  62% (645/1033)   \r",
        "Resolving deltas:  63% (653/1033)   \r",
        "Resolving deltas:  64% (665/1033)   \r",
        "Resolving deltas:  67% (702/1033)   \r",
        "Resolving deltas:  68% (705/1033)   \r",
        "Resolving deltas:  72% (744/1033)   \r",
        "Resolving deltas:  73% (755/1033)   \r",
        "Resolving deltas:  74% (765/1033)   \r",
        "Resolving deltas:  78% (806/1033)   \r",
        "Resolving deltas:  80% (831/1033)   \r",
        "Resolving deltas:  81% (843/1033)   \r",
        "Resolving deltas:  85% (880/1033)   \r",
        "Resolving deltas:  89% (923/1033)   \r",
        "Resolving deltas:  90% (930/1033)   \r",
        "Resolving deltas:  91% (945/1033)   \r",
        "Resolving deltas:  93% (969/1033)   \r",
        "Resolving deltas:  94% (973/1033)   \r",
        "Resolving deltas:  95% (990/1033)   \r",
        "Resolving deltas:  96% (1002/1033)   \r",
        "Resolving deltas:  97% (1009/1033)   \r",
        "Resolving deltas:  99% (1027/1033)   \r",
        "Resolving deltas: 100% (1033/1033)   \r",
        "Resolving deltas: 100% (1033/1033), done.\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Checking connectivity... done\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c succinct_dbg.cpp -o succinct_dbg.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "succinct_dbg.cpp: In member function \u2018void SuccinctDBG::LoadFromFile(const char*)\u2019:\r\n",
        "succinct_dbg.cpp:369:34: warning: ignoring return value of \u2018int fscanf(FILE*, const char*, ...)\u2019, declared with attribute warn_unused_result [-Wunused-result]\r\n",
        "     fscanf(f_file, \"%d\", &kmer_k);\r\n",
        "                                  ^\r\n",
        "succinct_dbg.cpp:370:45: warning: ignoring return value of \u2018int fscanf(FILE*, const char*, ...)\u2019, declared with attribute warn_unused_result [-Wunused-result]\r\n",
        "     fscanf(f_file, \"%u\", &num_dollar_nodes_);\r\n",
        "                                             ^\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c assembly_algorithms.cpp -o assembly_algorithms.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "In file included from hash_map.h:17:0,\r\n",
        "                 from unitig_graph.h:30,\r\n",
        "                 from assembly_algorithms.cpp:34:\r\n",
        "hash_table.h: In instantiation of \u2018struct HashTableNode<std::pair<long int, unsigned int> >\u2019:\r\n",
        "hash_table.h:599:39:   required from \u2018void HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::clear() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]\u2019\r\n",
        "hash_table.h:277:15:   required from \u2018HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::~HashTable() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]\u2019\r\n",
        "hash_map.h:32:7:   required from here\r\n",
        "hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field \u2018std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value\u2019 [enabled by default]\r\n",
        "     T value;\r\n",
        "       ^\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c branch_group.cpp -o branch_group.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c options_description.cpp -o options_description.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c unitig_graph.cpp -o unitig_graph.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "In file included from hash_map.h:17:0,\r\n",
        "                 from unitig_graph.h:30,\r\n",
        "                 from unitig_graph.cpp:21:\r\n",
        "hash_table.h: In instantiation of \u2018struct HashTableNode<std::pair<long int, unsigned int> >\u2019:\r\n",
        "hash_table.h:102:16:   required from \u2018HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::value_type* HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::operator->() const [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>; HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::pointer = std::pair<long int, unsigned int>*; HashTableIterator<Value, Key, HashFunc, ExtractKey, EqualKey>::value_type = std::pair<long int, unsigned int>]\u2019\r\n",
        "unitig_graph.cpp:363:76:   required from here\r\n",
        "hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field \u2018std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value\u2019 [enabled by default]\r\n",
        "     T value;\r\n",
        "       ^\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c sequence_manager.cpp -o sequence_manager.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c local_assembler.cpp -o local_assembler.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c city.cpp -o city.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_graph.cpp -o lib_idba/contig_graph.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_graph_branch_group.cpp -o lib_idba/contig_graph_branch_group.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/contig_info.cpp -o lib_idba/contig_info.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/hash_graph.cpp -o lib_idba/hash_graph.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c lib_idba/sequence.cpp -o lib_idba/sequence.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt asm_core.cpp assembler.cpp local_assemble.cpp iterate_edges.cpp lib_idba/contig_graph.o lib_idba/contig_graph_branch_group.o lib_idba/contig_info.o lib_idba/hash_graph.o lib_idba/sequence.o succinct_dbg.o assembly_algorithms.o branch_group.o options_description.o unitig_graph.o sequence_manager.o local_assembler.o city.o -lm -lz -lpthread -o megahit_asm_core\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "In file included from hash_map.h:17:0,\r\n",
        "                 from unitig_graph.h:30,\r\n",
        "                 from assembler.cpp:34:\r\n",
        "hash_table.h: In instantiation of \u2018struct HashTableNode<std::pair<long int, unsigned int> >\u2019:\r\n",
        "hash_table.h:599:39:   required from \u2018void HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::clear() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]\u2019\r\n",
        "hash_table.h:277:15:   required from \u2018HashTable<Value, Key, HashFunc, ExtractKey, EqualKey>::~HashTable() [with Value = std::pair<long int, unsigned int>; Key = long int; HashFunc = Hash<long int>; ExtractKey = Select1st<std::pair<long int, unsigned int> >; EqualKey = std::equal_to<long int>]\u2019\r\n",
        "hash_map.h:32:7:   required from here\r\n",
        "hash_table.h:50:7: warning: ignoring packed attribute because of unpacked non-POD field \u2018std::pair<long int, unsigned int> HashTableNode<std::pair<long int, unsigned int> >::value\u2019 [enabled by default]\r\n",
        "     T value;\r\n",
        "       ^\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_kmer_count.cpp -o cx1_kmer_count.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_read2sdbg_s1.cpp -o cx1_read2sdbg_s1.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_read2sdbg_s2.cpp -o cx1_read2sdbg_s2.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt -c cx1_seq2sdbg.cpp -o cx1_seq2sdbg.o\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt sdbg_builder.cpp cx1_kmer_count.o options_description.o cx1_read2sdbg_s1.o cx1_read2sdbg_s2.o cx1_seq2sdbg.o sequence_manager.o -lm -lz -lpthread -o megahit_sdbg_build\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "g++ -O2 -Wall -Wno-unused-function -Wno-array-bounds -D__STDC_FORMAT_MACROS -funroll-loops -fprefetch-loop-arrays -fopenmp -I. -std=c++0x -static-libgcc -static-libstdc++ -mpopcnt tools/toolkit.cpp tools/contigs_to_fastg.cpp tools/read_stat.cpp tools/trim_low_qual_tail.cpp tools/filter_by_len.cpp -lm -lz -lpthread -o megahit_toolkit\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "chmod +x ./megahit\r\n"
       ]
      }
     ],
     "prompt_number": 30
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "This assembly will take about 15 minutes and will save the assembly to a folder names \"megahit_assembly\".  You can read about the parameters to this program, such as --memory that specifies the maximum memory that can be used on the megahit software repo, https://github.com/voutcn/megahit."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!megahit/megahit --memory 10e9 -l 250 --k-max 81 -r SRR172903.qc.fastq --cpu-only -o megahit_assembly"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "MEGAHIT 0.3.0-beta3\r\n",
        "--- [Fri Jun 26 14:13:38 2015] Start assembly. Number of CPU threads 4 ---\r\n",
        "--- [Fri Jun 26 14:13:38 2015] k list: 21,41,61,81 ---\r\n",
        "--- [LIB INFO] Single-end reads: SRR172903.qc.fastq\r\n",
        "--- [Fri Jun 26 14:13:38 2015] Extracting solid (k+1)-mers for k = 21 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:13:46 2015] Building graph for k = 21 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:13:56 2015] Assembling contigs from SdBG for k = 21 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:12 2015] Local assembling k = 21 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:14 2015] Extracting iterative edges from k = 21 to 41 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:17 2015] Building graph for k = 41 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:23 2015] Assembling contigs from SdBG for k = 41 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:38 2015] Local assembling k = 41 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:39 2015] Extracting iterative edges from k = 41 to 61 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:41 2015] Building graph for k = 61 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:45 2015] Assembling contigs from SdBG for k = 61 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:56 2015] Local assembling k = 61 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:57 2015] Extracting iterative edges from k = 61 to 81 ---\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:57 2015] Merging to output final contigs ---\r\n",
        "--- [STAT] 11345 contigs, total 5254736 bp, min 200 bp, max 8884 bp, avg 463.18 bp, N50 525 bp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--- [Fri Jun 26 14:14:57 2015] ALL DONE. Time elapsed: 79.401388 seconds ---\r\n"
       ]
      }
     ],
     "prompt_number": 31
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "To take a look at the assembly, let's run the khmer assembly summary program on it, the final contigs are in megahit_assembly/final.contigs.fa.  Let's get statistics on all contigs greater than or equal to 200 bp."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!python khmer/sandbox/assemstats3.py 200 megahit_assembly/final.contigs.fa"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "** cutoff: 200\r\n",
        "N\tsum\tmax\tfilename\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "11345\t5254736\t8884\tmegahit_assembly/final.contigs.fa\r\n"
       ]
      }
     ],
     "prompt_number": 32
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 9. Estimating abundances of contigs\n",
      "\n",
      "Once the assembly is finished, you have a set of reference contigs which you can now estimate the abundance of the metagenome.  The approach for doing so is identical to that shown above where you use reference genomes.\n",
      "\n",
      "This will take about 20 minutes. "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash bowtie.sh megahit_assembly/final.contigs.fa SRR172903.qc.fastq"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Reference is megahit_assembly/final.contigs.fa\r\n",
        "Reads are SRR172903.qc.fastq\r\n",
        "Settings:\r\n",
        "  Output files: \"megahit_assembly/final.contigs.fa-bowtie-index.*.bt2\"\r\n",
        "  Line rate: 6 (line is 64 bytes)\r\n",
        "  Lines per side: 1 (side is 64 bytes)\r\n",
        "  Offset rate: 4 (one in 16)\r\n",
        "  FTable chars: 10\r\n",
        "  Strings: unpacked\r\n",
        "  Max bucket size: default\r\n",
        "  Max bucket size, sqrt multiplier: default\r\n",
        "  Max bucket size, len divisor: 4\r\n",
        "  Difference-cover sample period: 1024\r\n",
        "  Endianness: little\r\n",
        "  Actual local endianness: little\r\n",
        "  Sanity checking: disabled\r\n",
        "  Assertions: disabled\r\n",
        "  Random seed: 0\r\n",
        "  Sizeofs: void*:8, int:4, long:8, size_t:8\r\n",
        "Input files DNA, FASTA:\r\n",
        "  megahit_assembly/final.contigs.fa\r\n",
        "Building a SMALL index\r\n",
        "Reading reference sizes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time reading reference sizes: 00:00:00\r\n",
        "Calculating joined length\r\n",
        "Writing header\r\n",
        "Reserving space for joined string\r\n",
        "Joining reference sequences\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time to join reference sequences: 00:00:00\r\n",
        "bmax according to bmaxDivN setting: 1313684\r\n",
        "Using parameters --bmax 985263 --dcv 1024\r\n",
        "  Doing ahead-of-time memory usage test\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Passed!  Constructing with these parameters: --bmax 985263 --dcv 1024\r\n",
        "Constructing suffix-array element generator\r\n",
        "Building DifferenceCoverSample\r\n",
        "  Building sPrime\r\n",
        "  Building sPrimeOrder\r\n",
        "  V-Sorting samples\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  V-Sorting samples time: 00:00:00\r\n",
        "  Allocating rank array\r\n",
        "  Ranking v-sort output\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Ranking v-sort output time: 00:00:00\r\n",
        "  Invoking Larsson-Sadakane on ranks\r\n",
        "  Invoking Larsson-Sadakane on ranks time: 00:00:00\r\n",
        "  Sanity-checking and returning\r\n",
        "Building samples\r\n",
        "Reserving space for 12 sample suffixes\r\n",
        "Generating random suffixes\r\n",
        "QSorting 12 sample offsets, eliminating duplicates\r\n",
        "QSorting sample offsets, eliminating duplicates time: 00:00:00\r\n",
        "Multikey QSorting 12 samples\r\n",
        "  (Using difference cover)\r\n",
        "  Multikey QSorting samples time: 00:00:00\r\n",
        "Calculating bucket sizes\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:00\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Split 2, merged 5; iterating...\r\n",
        "  Binary sorting into buckets\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:01\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Avg bucket size: 583859 (target: 985262)\r\n",
        "Converting suffix-array elements to index image\r\n",
        "Allocating ftab, absorbFtab\r\n",
        "Entering Ebwt loop\r\n",
        "Getting block 1 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 409513\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 409514\r\n",
        "Getting block 2 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 717594\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 717595\r\n",
        "Getting block 3 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 275862\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 275863\r\n",
        "Getting block 4 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 933544\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 933545\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 5 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 456717\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 456718\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 6 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:01\r\n",
        "  Sorting block of length 650578\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 650579\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 7 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 551983\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 551984\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 8 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 736987\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 736988\r\n",
        "Getting block 9 of 9\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 521950\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 521951\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Exited Ebwt loop\r\n",
        "fchr[A]: 0\r\n",
        "fchr[C]: 1811471\r\n",
        "fchr[G]: 2639376\r\n",
        "fchr[T]: 3476168\r\n",
        "fchr[$]: 5254736\r\n",
        "Exiting Ebwt::buildToDisk()\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Returning from initFromVector\r\n",
        "Wrote 6549449 bytes to primary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.1.bt2\r\n",
        "Wrote 1313692 bytes to secondary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.2.bt2\r\n",
        "Re-opening _in1 and _in2 as input streams\r\n",
        "Returning from Ebwt constructor\r\n",
        "Headers:\r\n",
        "    len: 5254736\r\n",
        "    bwtLen: 5254737\r\n",
        "    sz: 1313684\r\n",
        "    bwtSz: 1313685\r\n",
        "    lineRate: 6\r\n",
        "    offRate: 4\r\n",
        "    offMask: 0xfffffff0\r\n",
        "    ftabChars: 10\r\n",
        "    eftabLen: 20\r\n",
        "    eftabSz: 80\r\n",
        "    ftabLen: 1048577\r\n",
        "    ftabSz: 4194308\r\n",
        "    offsLen: 328422\r\n",
        "    offsSz: 1313688\r\n",
        "    lineSz: 64\r\n",
        "    sideSz: 64\r\n",
        "    sideBwtSz: 48\r\n",
        "    sideBwtLen: 192\r\n",
        "    numSides: 27369\r\n",
        "    numLines: 27369\r\n",
        "    ebwtTotLen: 1751616\r\n",
        "    ebwtTotSz: 1751616\r\n",
        "    color: 0\r\n",
        "    reverse: 0\r\n",
        "Total time for call to driver() for forward index: 00:00:02\r\n",
        "Reading reference sizes\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time reading reference sizes: 00:00:00\r\n",
        "Calculating joined length\r\n",
        "Writing header\r\n",
        "Reserving space for joined string\r\n",
        "Joining reference sequences\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Time to join reference sequences: 00:00:00\r\n",
        "  Time to reverse reference sequence: 00:00:00\r\n",
        "bmax according to bmaxDivN setting: 1313684\r\n",
        "Using parameters --bmax 985263 --dcv 1024\r\n",
        "  Doing ahead-of-time memory usage test\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Passed!  Constructing with these parameters: --bmax 985263 --dcv 1024\r\n",
        "Constructing suffix-array element generator\r\n",
        "Building DifferenceCoverSample\r\n",
        "  Building sPrime\r\n",
        "  Building sPrimeOrder\r\n",
        "  V-Sorting samples\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  V-Sorting samples time: 00:00:00\r\n",
        "  Allocating rank array\r\n",
        "  Ranking v-sort output\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Ranking v-sort output time: 00:00:00\r\n",
        "  Invoking Larsson-Sadakane on ranks\r\n",
        "  Invoking Larsson-Sadakane on ranks time: 00:00:00\r\n",
        "  Sanity-checking and returning\r\n",
        "Building samples\r\n",
        "Reserving space for 12 sample suffixes\r\n",
        "Generating random suffixes\r\n",
        "QSorting 12 sample offsets, eliminating duplicates\r\n",
        "QSorting sample offsets, eliminating duplicates time: 00:00:00\r\n",
        "Multikey QSorting 12 samples\r\n",
        "  (Using difference cover)\r\n",
        "  Multikey QSorting samples time: 00:00:00\r\n",
        "Calculating bucket sizes\r\n",
        "  Binary sorting into buckets\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  100%\r\n",
        "  Binary sorting into buckets time: 00:00:00\r\n",
        "Splitting and merging\r\n",
        "  Splitting and merging time: 00:00:00\r\n",
        "Avg bucket size: 656841 (target: 985262)\r\n",
        "Converting suffix-array elements to index image\r\n",
        "Allocating ftab, absorbFtab\r\n",
        "Entering Ebwt loop\r\n",
        "Getting block 1 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 537964\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 537965\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 2 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 965284\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 965285\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 3 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 368748\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 368749\r\n",
        "Getting block 4 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n",
        "  60%\r\n",
        "  70%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:01\r\n",
        "  Sorting block of length 970675\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 970676\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 5 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 562616\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 562617\r\n",
        "Getting block 6 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 804480\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 804481\r\n",
        "Getting block 7 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:00\r\n",
        "  Sorting block of length 952899\r\n",
        "  (Using difference cover)\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 952900\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Getting block 8 of 8\r\n",
        "  Reserving size (985263) for bucket\r\n",
        "  Calculating Z arrays\r\n",
        "  Calculating Z arrays time: 00:00:00\r\n",
        "  Entering block accumulator loop:\r\n",
        "  10%\r\n",
        "  20%\r\n",
        "  30%\r\n",
        "  40%\r\n",
        "  50%\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "  60%\r\n",
        "  70%\r\n",
        "  80%\r\n",
        "  90%\r\n",
        "  100%\r\n",
        "  Block accumulator loop time: 00:00:01\r\n",
        "  Sorting block of length 92063\r\n",
        "  (Using difference cover)\r\n",
        "  Sorting block time: 00:00:00\r\n",
        "Returning block of 92064\r\n",
        "Exited Ebwt loop\r\n",
        "fchr[A]: 0\r\n",
        "fchr[C]: 1811471\r\n",
        "fchr[G]: 2639376\r\n",
        "fchr[T]: 3476168\r\n",
        "fchr[$]: 5254736\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Exiting Ebwt::buildToDisk()\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Returning from initFromVector\r\n",
        "Wrote 6549449 bytes to primary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.rev.1.bt2\r\n",
        "Wrote 1313692 bytes to secondary EBWT file: megahit_assembly/final.contigs.fa-bowtie-index.rev.2.bt2\r\n",
        "Re-opening _in1 and _in2 as input streams\r\n",
        "Returning from Ebwt constructor\r\n",
        "Headers:\r\n",
        "    len: 5254736\r\n",
        "    bwtLen: 5254737\r\n",
        "    sz: 1313684\r\n",
        "    bwtSz: 1313685\r\n",
        "    lineRate: 6\r\n",
        "    offRate: 4\r\n",
        "    offMask: 0xfffffff0\r\n",
        "    ftabChars: 10\r\n",
        "    eftabLen: 20\r\n",
        "    eftabSz: 80\r\n",
        "    ftabLen: 1048577\r\n",
        "    ftabSz: 4194308\r\n",
        "    offsLen: 328422\r\n",
        "    offsSz: 1313688\r\n",
        "    lineSz: 64\r\n",
        "    sideSz: 64\r\n",
        "    sideBwtSz: 48\r\n",
        "    sideBwtLen: 192\r\n",
        "    numSides: 27369\r\n",
        "    numLines: 27369\r\n",
        "    ebwtTotLen: 1751616\r\n",
        "    ebwtTotSz: 1751616\r\n",
        "    color: 0\r\n",
        "    reverse: 1\r\n",
        "Total time for backward call to driver() for mirror index: 00:00:03\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "820417 reads; of these:\r\n",
        "  820417 (100.00%) were unpaired; of these:\r\n",
        "    298465 (36.38%) aligned 0 times\r\n",
        "    513783 (62.62%) aligned exactly 1 time\r\n",
        "    8169 (1.00%) aligned >1 times\r\n",
        "63.62% overall alignment rate\r\n",
        "[samopen] SAM header is present: 11345 sequences.\r\n"
       ]
      }
     ],
     "prompt_number": 33
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "You can take a look at the results of the mapping much like you did above when we were mapping reads to the NCBI genome."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads-mapped.count.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "521952\r\n"
       ]
      }
     ],
     "prompt_number": 34
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads-unmapped.count.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "298465\r\n"
       ]
      }
     ],
     "prompt_number": 35
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat reads.by.contigs.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "k61_2\t218\t15\t0\r\n",
        "k61_3\t206\t6\t0\r\n",
        "k61_4\t256\t104\t0\r\n",
        "k61_5\t258\t14\t0\r\n",
        "k61_6\t305\t21\t0\r\n",
        "k61_7\t284\t13\t0\r\n",
        "k61_8\t256\t63\t0\r\n",
        "k61_9\t593\t51\t0\r\n",
        "k61_10\t400\t36\t0\r\n",
        "k61_11\t463\t26\t0\r\n",
        "k61_12\t270\t12\t0\r\n",
        "k61_13\t344\t26\t0\r\n",
        "k61_14\t335\t31\t0\r\n",
        "k61_15\t243\t14\t0\r\n",
        "k61_16\t481\t42\t0\r\n",
        "k61_17\t456\t17\t0\r\n",
        "k61_18\t283\t15\t0\r\n",
        "k61_19\t428\t27\t0\r\n",
        "k61_20\t763\t78\t0\r\n",
        "k61_21\t240\t20\t0\r\n",
        "k61_22\t361\t25\t0\r\n",
        "k61_23\t1476\t157\t0\r\n",
        "k61_24\t441\t24\t0\r\n",
        "k61_25\t1197\t102\t0\r\n",
        "k61_27\t354\t23\t0\r\n",
        "k61_28\t567\t34\t0\r\n",
        "k61_29\t353\t17\t0\r\n",
        "k61_30\t988\t69\t0\r\n",
        "k61_31\t294\t11\t0\r\n",
        "k61_32\t334\t24\t0\r\n",
        "k61_33\t419\t26\t0\r\n",
        "k61_34\t644\t54\t0\r\n",
        "k61_36\t767\t88\t0\r\n",
        "k61_37\t318\t23\t0\r\n",
        "k61_38\t398\t22\t0\r\n",
        "k61_39\t469\t58\t0\r\n",
        "k61_40\t229\t7\t0\r\n",
        "k61_41\t279\t12\t0\r\n",
        "k61_42\t577\t47\t0\r\n",
        "k61_44\t606\t54\t0\r\n",
        "k61_45\t455\t45\t0\r\n",
        "k61_46\t248\t24\t0\r\n",
        "k61_47\t206\t10\t0\r\n",
        "k61_48\t615\t59\t0\r\n",
        "k61_49\t976\t93\t0\r\n",
        "k61_50\t570\t67\t0\r\n",
        "k61_52\t218\t6\t0\r\n",
        "k61_53\t1128\t128\t0\r\n",
        "k61_54\t210\t8\t0\r\n",
        "k61_55\t225\t18\t0\r\n",
        "k61_56\t262\t20\t0\r\n",
        "k61_58\t220\t24\t0\r\n",
        "k61_59\t400\t19\t0\r\n",
        "k61_60\t519\t46\t0\r\n",
        "k61_61\t203\t9\t0\r\n",
        "k61_62\t873\t120\t0\r\n",
        "k61_63\t368\t16\t0\r\n",
        "k61_65\t208\t18\t0\r\n",
        "k61_66\t410\t39\t0\r\n",
        "k61_67\t1100\t169\t0\r\n",
        "k61_68\t365\t13\t0\r\n",
        "k61_69\t277\t23\t0\r\n",
        "k61_70\t472\t42\t0\r\n",
        "k61_71\t475\t39\t0\r\n",
        "k61_72\t328\t16\t0\r\n",
        "k61_73\t225\t23\t0\r\n",
        "k61_74\t682\t65\t0\r\n",
        "k61_75\t440\t41\t0\r\n",
        "k61_76\t268\t17\t0\r\n",
        "k61_77\t280\t31\t0\r\n",
        "k61_78\t225\t7\t0\r\n",
        "k61_79\t295\t20\t0\r\n",
        "k61_80\t384\t41\t0\r\n",
        "k61_81\t209\t5\t0\r\n",
        "k61_82\t247\t12\t0\r\n",
        "k61_83\t1478\t158\t0\r\n",
        "k61_84\t256\t12\t0\r\n",
        "k61_85\t372\t40\t0\r\n",
        "k61_86\t370\t25\t0\r\n",
        "k61_87\t368\t48\t0\r\n",
        "k61_88\t370\t20\t0\r\n",
        "k61_89\t277\t13\t0\r\n",
        "k61_90\t673\t50\t0\r\n",
        "k61_91\t633\t47\t0\r\n",
        "k61_92\t327\t16\t0\r\n",
        "k61_93\t225\t9\t0\r\n",
        "k61_94\t403\t35\t0\r\n",
        "k61_95\t237\t12\t0\r\n",
        "k61_96\t337\t20\t0\r\n",
        "k61_97\t206\t5\t0\r\n",
        "k61_98\t254\t9\t0\r\n",
        "k61_99\t310\t16\t0\r\n",
        "k61_101\t715\t65\t0\r\n",
        "k61_102\t288\t21\t0\r\n",
        "k61_103\t590\t54\t0\r\n",
        "k61_104\t573\t32\t0\r\n",
        "k61_105\t2060\t222\t0\r\n",
        "k61_106\t454\t21\t0\r\n",
        "k61_107\t297\t27\t0\r\n",
        "k61_108\t755\t63\t0\r\n",
        "k61_110\t352\t27\t0\r\n",
        "k61_111\t294\t23\t0\r\n",
        "k61_112\t288\t27\t0\r\n",
        "k61_113\t230\t16\t0\r\n",
        "k61_114\t257\t15\t0\r\n",
        "k61_115\t748\t58\t0\r\n",
        "k61_117\t420\t16\t0\r\n",
        "k61_118\t370\t26\t0\r\n",
        "k61_119\t309\t16\t0\r\n",
        "k61_120\t858\t88\t0\r\n",
        "k61_122\t273\t12\t0\r\n",
        "k61_123\t278\t15\t0\r\n",
        "k61_124\t281\t25\t0\r\n",
        "k61_125\t353\t18\t0\r\n",
        "k61_126\t329\t28\t0\r\n",
        "k61_127\t247\t14\t0\r\n",
        "k61_128\t217\t18\t0\r\n",
        "k61_129\t543\t57\t0\r\n",
        "k61_130\t486\t62\t0\r\n",
        "k61_131\t299\t23\t0\r\n",
        "k61_132\t279\t6\t0\r\n",
        "k61_133\t687\t69\t0\r\n",
        "k61_135\t208\t15\t0\r\n",
        "k61_139\t212\t7\t0\r\n",
        "k61_141\t216\t15\t0\r\n",
        "k61_142\t318\t15\t0\r\n",
        "k61_143\t815\t68\t0\r\n",
        "k61_144\t286\t19\t0\r\n",
        "k61_145\t537\t54\t0\r\n",
        "k61_146\t462\t36\t0\r\n",
        "k61_147\t276\t18\t0\r\n",
        "k61_148\t479\t168\t0\r\n",
        "k61_149\t232\t11\t0\r\n",
        "k61_150\t895\t95\t0\r\n",
        "k61_151\t332\t14\t0\r\n",
        "k61_152\t236\t9\t0\r\n",
        "k61_153\t303\t13\t0\r\n",
        "k61_154\t494\t51\t0\r\n",
        "k61_155\t486\t44\t0\r\n",
        "k61_156\t807\t72\t0\r\n",
        "k61_157\t848\t67\t0\r\n",
        "k61_158\t1031\t94\t0\r\n",
        "k61_159\t509\t52\t0\r\n",
        "k61_160\t336\t13\t0\r\n",
        "k61_161\t292\t22\t0\r\n",
        "k61_162\t297\t10\t0\r\n",
        "k61_163\t302\t24\t0\r\n",
        "k61_165\t390\t34\t0\r\n",
        "k61_166\t338\t34\t0\r\n",
        "k61_167\t310\t24\t0\r\n",
        "k61_168\t225\t18\t0\r\n",
        "k61_169\t289\t17\t0\r\n",
        "k61_170\t335\t106\t0\r\n",
        "k61_171\t297\t21\t0\r\n",
        "k61_173\t250\t21\t0\r\n",
        "k61_174\t205\t10\t0\r\n",
        "k61_175\t250\t24\t0\r\n",
        "k61_176\t299\t21\t0\r\n",
        "k61_177\t514\t40\t0\r\n",
        "k61_178\t208\t10\t0\r\n",
        "k61_179\t232\t20\t0\r\n",
        "k61_180\t1294\t129\t0\r\n",
        "k61_181\t500\t50\t0\r\n",
        "k61_182\t867\t84\t0\r\n",
        "k61_183\t507\t35\t0\r\n",
        "k61_184\t230\t16\t0\r\n",
        "k61_185\t369\t26\t0\r\n",
        "k61_186\t263\t17\t0\r\n",
        "k61_187\t705\t59\t0\r\n",
        "k61_189\t1306\t103\t0\r\n",
        "k61_190\t201\t10\t0\r\n",
        "k61_191\t323\t26\t0\r\n",
        "k61_192\t221\t9\t0\r\n",
        "k61_193\t245\t20\t0\r\n",
        "k61_194\t436\t24\t0\r\n",
        "k61_195\t312\t12\t0\r\n",
        "k61_196\t1003\t84\t0\r\n",
        "k61_197\t268\t12\t0\r\n",
        "k61_198\t230\t10\t0\r\n",
        "k61_199\t334\t18\t0\r\n",
        "k61_200\t325\t20\t0\r\n",
        "k61_201\t488\t49\t0\r\n",
        "k61_202\t1165\t89\t0\r\n",
        "k61_203\t570\t43\t0\r\n",
        "k61_204\t237\t12\t0\r\n",
        "k61_205\t272\t15\t0\r\n",
        "k61_206\t1158\t83\t0\r\n",
        "k61_207\t606\t48\t0\r\n",
        "k61_208\t474\t26\t0\r\n",
        "k61_209\t227\t9\t0\r\n",
        "k61_210\t322\t28\t0\r\n",
        "k61_211\t244\t12\t0\r\n",
        "k61_212\t234\t9\t0\r\n",
        "k61_214\t569\t41\t0\r\n",
        "k61_215\t596\t23\t0\r\n",
        "k61_216\t421\t31\t0\r\n",
        "k61_217\t514\t42\t0\r\n",
        "k61_219\t483\t34\t0\r\n",
        "k61_220\t563\t64\t0\r\n",
        "k61_222\t514\t51\t0\r\n",
        "k61_223\t919\t88\t0\r\n",
        "k61_224\t649\t59\t0\r\n",
        "k61_225\t212\t17\t0\r\n",
        "k61_226\t452\t48\t0\r\n",
        "k61_227\t321\t21\t0\r\n",
        "k61_228\t390\t42\t0\r\n",
        "k61_229\t729\t92\t0\r\n",
        "k61_230\t283\t16\t0\r\n",
        "k61_231\t407\t49\t0\r\n",
        "k61_232\t432\t27\t0\r\n",
        "k61_233\t231\t13\t0\r\n",
        "k61_235\t201\t11\t0\r\n",
        "k61_236\t311\t17\t0\r\n",
        "k61_238\t841\t89\t0\r\n",
        "k61_239\t257\t11\t0\r\n",
        "k61_240\t436\t37\t0\r\n",
        "k61_241\t216\t15\t0\r\n",
        "k61_242\t407\t37\t0\r\n",
        "k61_243\t492\t48\t0\r\n",
        "k61_244\t205\t12\t0\r\n",
        "k61_246\t302\t23\t0\r\n",
        "k61_247\t477\t44\t0\r\n",
        "k61_248\t226\t8\t0\r\n",
        "k61_249\t524\t37\t0\r\n",
        "k61_251\t217\t5\t0\r\n",
        "k61_252\t1270\t120\t0\r\n",
        "k61_254\t240\t11\t0\r\n",
        "k61_255\t289\t23\t0\r\n",
        "k61_256\t352\t18\t0\r\n",
        "k61_257\t377\t37\t0\r\n",
        "k61_258\t219\t18\t0\r\n",
        "k61_259\t202\t10\t0\r\n",
        "k61_260\t318\t17\t0\r\n",
        "k61_261\t306\t16\t0\r\n",
        "k61_262\t252\t19\t0\r\n",
        "k61_263\t317\t14\t0\r\n",
        "k61_264\t253\t22\t0\r\n",
        "k61_265\t1289\t116\t0\r\n",
        "k61_266\t439\t33\t0\r\n",
        "k61_267\t439\t27\t0\r\n",
        "k61_268\t419\t29\t0\r\n",
        "k61_269\t328\t15\t0\r\n",
        "k61_270\t392\t33\t0\r\n",
        "k61_271\t361\t28\t0\r\n",
        "k61_272\t242\t22\t0\r\n",
        "k61_273\t419\t18\t0\r\n",
        "k61_274\t594\t56\t0\r\n",
        "k61_277\t480\t30\t0\r\n",
        "k61_279\t253\t18\t0\r\n",
        "k61_280\t780\t71\t0\r\n",
        "k61_281\t776\t68\t0\r\n",
        "k61_282\t305\t14\t0\r\n",
        "k61_283\t327\t37\t0\r\n",
        "k61_284\t619\t53\t0\r\n",
        "k61_285\t442\t33\t0\r\n",
        "k61_286\t558\t32\t0\r\n",
        "k61_287\t233\t16\t0\r\n",
        "k61_289\t292\t20\t0\r\n",
        "k61_290\t250\t9\t0\r\n",
        "k61_292\t280\t21\t0\r\n",
        "k61_293\t271\t15\t0\r\n",
        "k61_294\t372\t32\t0\r\n",
        "k61_295\t475\t33\t0\r\n",
        "k61_296\t330\t36\t0\r\n",
        "k61_297\t291\t12\t0\r\n",
        "k61_299\t632\t48\t0\r\n",
        "k61_300\t207\t7\t0\r\n",
        "k61_301\t278\t13\t0\r\n",
        "k61_302\t481\t31\t0\r\n",
        "k61_303\t849\t77\t0\r\n",
        "k61_304\t386\t19\t0\r\n",
        "k61_305\t413\t32\t0\r\n",
        "k61_306\t252\t9\t0\r\n",
        "k61_307\t879\t66\t0\r\n",
        "k61_308\t236\t10\t0\r\n",
        "k61_309\t307\t14\t0\r\n",
        "k61_310\t642\t48\t0\r\n",
        "k61_311\t233\t63\t0\r\n",
        "k61_312\t233\t10\t0\r\n",
        "k61_313\t250\t24\t0\r\n",
        "k61_315\t256\t24\t0\r\n",
        "k61_316\t299\t28\t0\r\n",
        "k61_317\t209\t7\t0\r\n",
        "k61_318\t407\t30\t0\r\n",
        "k61_320\t226\t8\t0\r\n",
        "k61_321\t291\t12\t0\r\n",
        "k61_322\t235\t15\t0\r\n",
        "k61_323\t272\t24\t0\r\n",
        "k61_324\t528\t47\t0\r\n",
        "k61_325\t303\t12\t0\r\n",
        "k61_327\t703\t72\t0\r\n",
        "k61_328\t240\t9\t0\r\n",
        "k61_329\t255\t18\t0\r\n",
        "k61_330\t514\t50\t0\r\n",
        "k61_331\t579\t33\t0\r\n",
        "k61_332\t335\t18\t0\r\n",
        "k61_333\t464\t48\t0\r\n",
        "k61_334\t243\t9\t0\r\n",
        "k61_336\t1631\t151\t0\r\n",
        "k61_337\t281\t10\t0\r\n",
        "k61_338\t1266\t134\t0\r\n",
        "k61_339\t456\t40\t0\r\n",
        "k61_340\t213\t12\t0\r\n",
        "k61_341\t319\t24\t0\r\n",
        "k61_342\t347\t28\t0\r\n",
        "k61_343\t256\t21\t0\r\n",
        "k61_344\t313\t24\t0\r\n",
        "k61_346\t246\t14\t0\r\n",
        "k61_347\t208\t21\t0\r\n",
        "k61_349\t732\t44\t0\r\n",
        "k61_350\t305\t26\t0\r\n",
        "k61_351\t437\t27\t0\r\n",
        "k61_352\t306\t20\t0\r\n",
        "k61_353\t481\t39\t0\r\n",
        "k61_354\t775\t39\t0\r\n",
        "k61_355\t961\t88\t0\r\n",
        "k61_356\t1363\t168\t0\r\n",
        "k61_358\t308\t21\t0\r\n",
        "k61_359\t329\t12\t0\r\n",
        "k61_361\t200\t10\t0\r\n",
        "k61_362\t2581\t277\t0\r\n",
        "k61_363\t495\t43\t0\r\n",
        "k61_364\t515\t33\t0\r\n",
        "k61_365\t479\t60\t0\r\n",
        "k61_366\t230\t15\t0\r\n",
        "k61_367\t336\t40\t0\r\n",
        "k61_368\t487\t41\t0\r\n",
        "k61_369\t591\t48\t0\r\n",
        "k61_370\t446\t39\t0\r\n",
        "k61_371\t276\t22\t0\r\n",
        "k61_372\t386\t33\t0\r\n",
        "k61_373\t229\t21\t0\r\n",
        "k61_374\t695\t53\t0\r\n",
        "k61_375\t229\t13\t0\r\n",
        "k61_376\t400\t43\t0\r\n",
        "k61_377\t476\t35\t0\r\n",
        "k61_379\t330\t14\t0\r\n",
        "k61_380\t278\t20\t0\r\n",
        "k61_381\t823\t59\t0\r\n",
        "k61_382\t235\t10\t0\r\n",
        "k61_383\t1309\t111\t0\r\n",
        "k61_384\t920\t99\t0\r\n",
        "k61_385\t236\t18\t0\r\n",
        "k61_386\t291\t29\t0\r\n",
        "k61_387\t230\t17\t0\r\n",
        "k61_388\t224\t11\t0\r\n",
        "k61_389\t316\t26\t0\r\n",
        "k61_390\t454\t32\t0\r\n",
        "k61_391\t219\t6\t0\r\n",
        "k61_392\t391\t31\t0\r\n",
        "k61_393\t255\t12\t0\r\n",
        "k61_394\t368\t21\t0\r\n",
        "k61_396\t295\t12\t0\r\n",
        "k61_397\t246\t13\t0\r\n",
        "k61_398\t718\t68\t0\r\n",
        "k61_399\t353\t32\t0\r\n",
        "k61_400\t597\t44\t0\r\n",
        "k61_401\t392\t28\t0\r\n",
        "k61_402\t889\t75\t0\r\n",
        "k61_403\t315\t19\t0\r\n",
        "k61_404\t597\t53\t0\r\n",
        "k61_405\t332\t19\t0\r\n",
        "k61_406\t209\t20\t0\r\n",
        "k61_407\t227\t22\t0\r\n",
        "k61_408\t1426\t123\t0\r\n",
        "k61_409\t443\t29\t0\r\n",
        "k61_410\t200\t7\t0\r\n",
        "k61_411\t250\t16\t0\r\n",
        "k61_412\t275\t20\t0\r\n",
        "k61_413\t623\t55\t0\r\n",
        "k61_414\t201\t13\t0\r\n",
        "k61_415\t347\t33\t0\r\n",
        "k61_416\t353\t31\t0\r\n",
        "k61_417\t225\t13\t0\r\n",
        "k61_418\t524\t40\t0\r\n",
        "k61_419\t530\t61\t0\r\n",
        "k61_421\t606\t50\t0\r\n",
        "k61_422\t451\t32\t0\r\n",
        "k61_423\t223\t11\t0\r\n",
        "k61_424\t214\t9\t0\r\n",
        "k61_425\t202\t10\t0\r\n",
        "k61_426\t407\t35\t0\r\n",
        "k61_427\t342\t17\t0\r\n",
        "k61_428\t206\t22\t0\r\n",
        "k61_430\t597\t46\t0\r\n",
        "k61_431\t300\t15\t0\r\n",
        "k61_432\t552\t47\t0\r\n",
        "k61_433\t436\t38\t0\r\n",
        "k61_434\t235\t14\t0\r\n",
        "k61_435\t273\t12\t0\r\n",
        "k61_436\t208\t17\t0\r\n",
        "k61_437\t253\t11\t0\r\n",
        "k61_438\t356\t27\t0\r\n",
        "k61_439\t431\t39\t0\r\n",
        "k61_440\t272\t17\t0\r\n",
        "k61_441\t536\t53\t0\r\n",
        "k61_442\t344\t23\t0\r\n",
        "k61_443\t1312\t148\t0\r\n",
        "k61_444\t354\t25\t0\r\n",
        "k61_445\t254\t11\t0\r\n",
        "k61_446\t223\t8\t0\r\n",
        "k61_447\t218\t5\t0\r\n",
        "k61_448\t669\t51\t0\r\n",
        "k61_449\t271\t27\t0\r\n",
        "k61_450\t872\t77\t0\r\n",
        "k61_451\t407\t34\t0\r\n",
        "k61_452\t449\t41\t0\r\n",
        "k61_453\t235\t9\t0\r\n",
        "k61_455\t257\t11\t0\r\n",
        "k61_456\t422\t30\t0\r\n",
        "k61_457\t262\t19\t0\r\n",
        "k61_458\t537\t43\t0\r\n",
        "k61_459\t685\t73\t0\r\n",
        "k61_460\t277\t23\t0\r\n",
        "k61_461\t229\t19\t0\r\n",
        "k61_462\t665\t61\t0\r\n",
        "k61_463\t298\t26\t0\r\n",
        "k61_464\t309\t23\t0\r\n",
        "k61_465\t667\t56\t0\r\n",
        "k61_466\t292\t17\t0\r\n",
        "k61_467\t359\t25\t0\r\n",
        "k61_468\t227\t6\t0\r\n",
        "k61_469\t8884\t2671\t0\r\n",
        "k61_470\t300\t23\t0\r\n",
        "k61_471\t290\t10\t0\r\n",
        "k61_472\t284\t12\t0\r\n",
        "k61_473\t666\t71\t0\r\n",
        "k61_474\t971\t95\t0\r\n",
        "k61_475\t371\t16\t0\r\n",
        "k61_476\t305\t20\t0\r\n",
        "k61_477\t410\t17\t0\r\n",
        "k61_478\t208\t8\t0\r\n",
        "k61_479\t222\t27\t0\r\n",
        "k61_480\t412\t27\t0\r\n",
        "k61_481\t505\t31\t0\r\n",
        "k61_482\t288\t14\t0\r\n",
        "k61_484\t630\t50\t0\r\n",
        "k61_485\t204\t8\t0\r\n",
        "k61_486\t213\t13\t0\r\n",
        "k61_487\t490\t45\t0\r\n",
        "k61_488\t225\t17\t0\r\n",
        "k61_491\t321\t20\t0\r\n",
        "k61_492\t273\t20\t0\r\n",
        "k61_493\t812\t55\t0\r\n",
        "k61_495\t1004\t103\t0\r\n",
        "k61_496\t1106\t109\t0\r\n",
        "k61_497\t334\t17\t0\r\n",
        "k61_498\t359\t28\t0\r\n",
        "k61_499\t270\t27\t0\r\n",
        "k61_500\t239\t18\t0\r\n",
        "k61_501\t2311\t229\t0\r\n",
        "k61_503\t1710\t147\t0\r\n",
        "k61_504\t746\t96\t0\r\n",
        "k61_505\t245\t8\t0\r\n",
        "k61_506\t357\t39\t0\r\n",
        "k61_507\t319\t28\t0\r\n",
        "k61_508\t214\t10\t0\r\n",
        "k61_509\t205\t12\t0\r\n",
        "k61_510\t548\t50\t0\r\n",
        "k61_511\t238\t17\t0\r\n",
        "k61_512\t465\t61\t0\r\n",
        "k61_513\t339\t29\t0\r\n",
        "k61_514\t267\t17\t0\r\n",
        "k61_515\t209\t8\t0\r\n",
        "k61_516\t731\t55\t0\r\n",
        "k61_517\t1285\t101\t0\r\n",
        "k61_518\t241\t14\t0\r\n",
        "k61_519\t221\t16\t0\r\n",
        "k61_520\t972\t111\t0\r\n",
        "k61_521\t405\t19\t0\r\n",
        "k61_522\t260\t19\t0\r\n",
        "k61_523\t548\t57\t0\r\n",
        "k61_524\t217\t7\t0\r\n",
        "k61_525\t426\t27\t0\r\n",
        "k61_526\t543\t45\t0\r\n",
        "k61_527\t299\t12\t0\r\n",
        "k61_528\t919\t93\t0\r\n",
        "k61_529\t512\t38\t0\r\n",
        "k61_530\t236\t14\t0\r\n",
        "k61_531\t471\t38\t0\r\n",
        "k61_532\t200\t7\t0\r\n",
        "k61_533\t1461\t142\t0\r\n",
        "k61_534\t257\t15\t0\r\n",
        "k61_535\t218\t17\t0\r\n",
        "k61_536\t1044\t118\t0\r\n",
        "k61_537\t205\t11\t0\r\n",
        "k61_538\t275\t17\t0\r\n",
        "k61_539\t443\t41\t0\r\n",
        "k61_540\t254\t7\t0\r\n",
        "k61_541\t420\t42\t0\r\n",
        "k61_542\t274\t16\t0\r\n",
        "k61_543\t274\t18\t0\r\n",
        "k61_544\t273\t21\t0\r\n",
        "k61_545\t512\t32\t0\r\n",
        "k61_546\t591\t54\t0\r\n",
        "k61_547\t233\t22\t0\r\n",
        "k61_548\t342\t20\t0\r\n",
        "k61_549\t210\t18\t0\r\n",
        "k61_550\t374\t28\t0\r\n",
        "k61_551\t226\t18\t0\r\n",
        "k61_552\t420\t23\t0\r\n",
        "k61_553\t324\t14\t0\r\n",
        "k61_554\t374\t30\t0\r\n",
        "k61_555\t233\t26\t0\r\n",
        "k61_556\t481\t49\t0\r\n",
        "k61_557\t227\t10\t0\r\n",
        "k61_558\t287\t24\t0\r\n",
        "k61_559\t400\t27\t0\r\n",
        "k61_560\t607\t49\t0\r\n",
        "k61_561\t352\t33\t0\r\n",
        "k61_562\t1210\t112\t0\r\n",
        "k61_564\t331\t16\t0\r\n",
        "k61_565\t208\t17\t0\r\n",
        "k61_566\t283\t10\t0\r\n",
        "k61_567\t293\t10\t0\r\n",
        "k61_568\t215\t11\t0\r\n",
        "k61_569\t1238\t114\t0\r\n",
        "k61_570\t215\t9\t0\r\n",
        "k61_571\t282\t16\t0\r\n",
        "k61_572\t204\t12\t0\r\n",
        "k61_573\t521\t45\t0\r\n",
        "k61_574\t736\t55\t0\r\n",
        "k61_575\t398\t27\t0\r\n",
        "k61_576\t937\t78\t0\r\n",
        "k61_577\t238\t11\t0\r\n",
        "k61_578\t251\t14\t0\r\n",
        "k61_579\t394\t32\t0\r\n",
        "k61_580\t207\t10\t0\r\n",
        "k61_581\t351\t29\t0\r\n",
        "k61_582\t234\t13\t0\r\n",
        "k61_583\t247\t10\t0\r\n",
        "k61_584\t246\t10\t0\r\n",
        "k61_585\t1318\t131\t0\r\n",
        "k61_586\t468\t41\t0\r\n",
        "k61_588\t1025\t373\t0\r\n",
        "k61_589\t244\t8\t0\r\n",
        "k61_590\t214\t9\t0\r\n",
        "k61_592\t225\t7\t0\r\n",
        "k61_593\t476\t36\t0\r\n",
        "k61_594\t214\t7\t0\r\n",
        "k61_595\t810\t100\t0\r\n",
        "k61_596\t245\t6\t0\r\n",
        "k61_597\t220\t10\t0\r\n",
        "k61_598\t1221\t116\t0\r\n",
        "k61_599\t1644\t151\t0\r\n",
        "k61_600\t277\t15\t0\r\n",
        "k61_601\t309\t16\t0\r\n",
        "k61_602\t390\t29\t0\r\n",
        "k61_603\t494\t48\t0\r\n",
        "k61_605\t207\t9\t0\r\n",
        "k61_606\t214\t7\t0\r\n",
        "k61_607\t658\t79\t0\r\n",
        "k61_608\t366\t24\t0\r\n",
        "k61_610\t322\t17\t0\r\n",
        "k61_611\t640\t44\t0\r\n",
        "k61_612\t331\t23\t0\r\n",
        "k61_613\t558\t62\t0\r\n",
        "k61_614\t270\t21\t0\r\n",
        "k61_615\t453\t39\t0\r\n",
        "k61_616\t286\t14\t0\r\n",
        "k61_617\t218\t21\t0\r\n",
        "k61_618\t285\t11\t0\r\n",
        "k61_619\t346\t29\t0\r\n",
        "k61_620\t590\t29\t0\r\n",
        "k61_621\t231\t6\t0\r\n",
        "k61_622\t289\t16\t0\r\n",
        "k61_623\t596\t56\t0\r\n",
        "k61_624\t546\t45\t0\r\n",
        "k61_625\t326\t12\t0\r\n",
        "k61_626\t250\t27\t0\r\n",
        "k61_627\t259\t21\t0\r\n",
        "k61_629\t233\t9\t0\r\n",
        "k61_630\t256\t21\t0\r\n",
        "k61_632\t1870\t1641\t0\r\n",
        "k61_633\t842\t74\t0\r\n",
        "k61_634\t211\t11\t0\r\n",
        "k61_635\t441\t46\t0\r\n",
        "k61_636\t390\t35\t0\r\n",
        "k61_637\t360\t37\t0\r\n",
        "k61_638\t321\t15\t0\r\n",
        "k61_639\t215\t17\t0\r\n",
        "k61_640\t311\t14\t0\r\n",
        "k61_641\t263\t24\t0\r\n",
        "k61_642\t399\t34\t0\r\n",
        "k61_643\t471\t46\t0\r\n",
        "k61_644\t432\t30\t0\r\n",
        "k61_645\t278\t11\t0\r\n",
        "k61_646\t275\t10\t0\r\n",
        "k61_647\t1129\t91\t0\r\n",
        "k61_648\t369\t28\t0\r\n",
        "k61_649\t475\t27\t0\r\n",
        "k61_650\t1619\t144\t0\r\n",
        "k61_651\t202\t10\t0\r\n",
        "k61_652\t1138\t95\t0\r\n",
        "k61_653\t218\t10\t0\r\n",
        "k61_654\t269\t17\t0\r\n",
        "k61_655\t351\t32\t0\r\n",
        "k61_656\t713\t65\t0\r\n",
        "k61_657\t228\t21\t0\r\n",
        "k61_658\t202\t20\t0\r\n",
        "k61_659\t647\t65\t0\r\n",
        "k61_661\t312\t21\t0\r\n",
        "k61_662\t442\t39\t0\r\n",
        "k61_663\t313\t25\t0\r\n",
        "k61_664\t746\t60\t0\r\n",
        "k61_665\t644\t55\t0\r\n",
        "k61_666\t220\t11\t0\r\n",
        "k61_667\t358\t24\t0\r\n",
        "k61_668\t340\t29\t0\r\n",
        "k61_669\t470\t29\t0\r\n",
        "k61_670\t400\t41\t0\r\n",
        "k61_671\t264\t17\t0\r\n",
        "k61_672\t873\t85\t0\r\n",
        "k61_673\t1083\t104\t0\r\n",
        "k61_674\t236\t7\t0\r\n",
        "k61_675\t238\t6\t0\r\n",
        "k61_676\t551\t32\t0\r\n",
        "k61_677\t669\t37\t0\r\n",
        "k61_678\t247\t23\t0\r\n",
        "k61_679\t1788\t179\t0\r\n",
        "k61_680\t219\t12\t0\r\n",
        "k61_681\t332\t20\t0\r\n",
        "k61_683\t1025\t101\t0\r\n",
        "k61_684\t247\t19\t0\r\n",
        "k61_685\t222\t23\t0\r\n",
        "k61_686\t250\t9\t0\r\n",
        "k61_687\t245\t18\t0\r\n",
        "k61_688\t532\t33\t0\r\n",
        "k61_689\t426\t29\t0\r\n",
        "k61_691\t243\t19\t0\r\n",
        "k61_692\t561\t54\t0\r\n",
        "k61_693\t629\t48\t0\r\n",
        "k61_694\t464\t32\t0\r\n",
        "k61_695\t229\t20\t0\r\n",
        "k61_696\t396\t20\t0\r\n",
        "k61_697\t262\t11\t0\r\n",
        "k61_698\t303\t31\t0\r\n",
        "k61_699\t558\t27\t0\r\n",
        "k61_700\t252\t16\t0\r\n",
        "k61_701\t410\t44\t0\r\n",
        "k61_703\t345\t33\t0\r\n",
        "k61_704\t239\t20\t0\r\n",
        "k61_705\t500\t44\t0\r\n",
        "k61_706\t385\t37\t0\r\n",
        "k61_707\t205\t16\t0\r\n",
        "k61_708\t288\t14\t0\r\n",
        "k61_709\t357\t18\t0\r\n",
        "k61_710\t266\t10\t0\r\n",
        "k61_711\t381\t29\t0\r\n",
        "k61_712\t339\t27\t0\r\n",
        "k61_713\t304\t14\t0\r\n",
        "k61_714\t495\t57\t0\r\n",
        "k61_715\t875\t69\t0\r\n",
        "k61_716\t407\t26\t0\r\n",
        "k61_717\t878\t67\t0\r\n",
        "k61_719\t234\t20\t0\r\n",
        "k61_720\t730\t66\t0\r\n",
        "k61_721\t671\t68\t0\r\n",
        "k61_722\t220\t18\t0\r\n",
        "k61_723\t497\t25\t0\r\n",
        "k61_724\t398\t29\t0\r\n",
        "k61_725\t563\t57\t0\r\n",
        "k61_726\t225\t7\t0\r\n",
        "k61_727\t234\t11\t0\r\n",
        "k61_728\t551\t57\t0\r\n",
        "k61_729\t686\t49\t0\r\n",
        "k61_730\t409\t40\t0\r\n",
        "k61_731\t288\t14\t0\r\n",
        "k61_732\t238\t16\t0\r\n",
        "k61_733\t242\t17\t0\r\n",
        "k61_734\t1322\t138\t0\r\n",
        "k61_736\t368\t27\t0\r\n",
        "k61_737\t941\t86\t0\r\n",
        "k61_738\t293\t14\t0\r\n",
        "k61_739\t219\t20\t0\r\n",
        "k61_740\t209\t21\t0\r\n",
        "k61_742\t237\t10\t0\r\n",
        "k61_743\t247\t16\t0\r\n",
        "k61_744\t212\t20\t0\r\n",
        "k61_745\t318\t21\t0\r\n",
        "k61_746\t209\t5\t0\r\n",
        "k61_747\t430\t47\t0\r\n",
        "k61_748\t215\t10\t0\r\n",
        "k61_749\t485\t43\t0\r\n",
        "k61_750\t436\t48\t0\r\n",
        "k61_751\t414\t31\t0\r\n",
        "k61_752\t260\t15\t0\r\n",
        "k61_753\t325\t17\t0\r\n",
        "k61_754\t1437\t237\t0\r\n",
        "k61_755\t521\t40\t0\r\n",
        "k61_757\t205\t10\t0\r\n",
        "k61_758\t466\t58\t0\r\n",
        "k61_760\t438\t50\t0\r\n",
        "k61_761\t374\t35\t0\r\n",
        "k61_763\t380\t17\t0\r\n",
        "k61_768\t201\t10\t0\r\n",
        "k61_769\t204\t10\t0\r\n",
        "k61_770\t1006\t98\t0\r\n",
        "k61_771\t381\t37\t0\r\n",
        "k61_772\t252\t11\t0\r\n",
        "k61_773\t268\t26\t0\r\n",
        "k61_775\t661\t61\t0\r\n",
        "k61_776\t541\t30\t0\r\n",
        "k61_777\t240\t24\t0\r\n",
        "k61_778\t286\t14\t0\r\n",
        "k61_779\t303\t16\t0\r\n",
        "k61_780\t382\t33\t0\r\n",
        "k61_781\t227\t12\t0\r\n",
        "k61_783\t526\t37\t0\r\n",
        "k61_784\t2334\t226\t0\r\n",
        "k61_785\t404\t38\t0\r\n",
        "k61_786\t254\t13\t0\r\n",
        "k61_787\t411\t29\t0\r\n",
        "k61_789\t276\t11\t0\r\n",
        "k61_790\t501\t31\t0\r\n",
        "k61_791\t410\t25\t0\r\n",
        "k61_792\t255\t14\t0\r\n",
        "k61_793\t651\t84\t0\r\n",
        "k61_794\t390\t44\t0\r\n",
        "k61_795\t701\t69\t0\r\n",
        "k61_796\t429\t28\t0\r\n",
        "k61_797\t253\t15\t0\r\n",
        "k61_798\t1130\t97\t0\r\n",
        "k61_799\t296\t6\t0\r\n",
        "k61_800\t265\t23\t0\r\n",
        "k61_801\t628\t35\t0\r\n",
        "k61_802\t1792\t165\t0\r\n",
        "k61_803\t810\t63\t0\r\n",
        "k61_804\t663\t47\t0\r\n",
        "k61_805\t352\t17\t0\r\n",
        "k61_806\t252\t10\t0\r\n",
        "k61_808\t414\t30\t0\r\n",
        "k61_809\t298\t13\t0\r\n",
        "k61_811\t261\t12\t0\r\n",
        "k61_813\t465\t45\t0\r\n",
        "k61_814\t427\t44\t0\r\n",
        "k61_815\t447\t43\t0\r\n",
        "k61_816\t784\t65\t0\r\n",
        "k61_817\t251\t19\t0\r\n",
        "k61_818\t225\t9\t0\r\n",
        "k61_819\t233\t8\t0\r\n",
        "k61_820\t210\t6\t0\r\n",
        "k61_821\t1079\t117\t0\r\n",
        "k61_822\t743\t73\t0\r\n",
        "k61_823\t361\t39\t0\r\n",
        "k61_824\t288\t22\t0\r\n",
        "k61_826\t311\t30\t0\r\n",
        "k61_827\t263\t12\t0\r\n",
        "k61_828\t519\t38\t0\r\n",
        "k61_829\t323\t32\t0\r\n",
        "k61_830\t976\t120\t0\r\n",
        "k61_831\t239\t13\t0\r\n",
        "k61_832\t599\t37\t0\r\n",
        "k61_833\t1821\t216\t0\r\n",
        "k61_834\t207\t17\t0\r\n",
        "k61_835\t214\t19\t0\r\n",
        "k61_836\t248\t8\t0\r\n",
        "k61_837\t222\t9\t0\r\n",
        "k61_838\t405\t29\t0\r\n",
        "k61_839\t499\t33\t0\r\n",
        "k61_840\t285\t23\t0\r\n",
        "k61_841\t665\t77\t0\r\n",
        "k61_842\t535\t22\t0\r\n",
        "k61_843\t321\t18\t0\r\n",
        "k61_844\t200\t17\t0\r\n",
        "k61_845\t383\t40\t0\r\n",
        "k61_846\t422\t21\t0\r\n",
        "k61_847\t223\t15\t0\r\n",
        "k61_848\t239\t16\t0\r\n",
        "k61_849\t229\t10\t0\r\n",
        "k61_850\t413\t46\t0\r\n",
        "k61_851\t242\t17\t0\r\n",
        "k61_852\t811\t75\t0\r\n",
        "k61_853\t464\t35\t0\r\n",
        "k61_854\t612\t39\t0\r\n",
        "k61_856\t370\t15\t0\r\n",
        "k61_857\t488\t32\t0\r\n",
        "k61_858\t942\t86\t0\r\n",
        "k61_859\t342\t17\t0\r\n",
        "k61_860\t575\t63\t0\r\n",
        "k61_861\t481\t43\t0\r\n",
        "k61_862\t274\t20\t0\r\n",
        "k61_863\t433\t38\t0\r\n",
        "k61_865\t746\t65\t0\r\n",
        "k61_866\t201\t8\t0\r\n",
        "k61_867\t300\t15\t0\r\n",
        "k61_868\t932\t97\t0\r\n",
        "k61_869\t325\t28\t0\r\n",
        "k61_870\t326\t18\t0\r\n",
        "k61_871\t250\t24\t0\r\n",
        "k61_872\t224\t13\t0\r\n",
        "k61_873\t2346\t185\t0\r\n",
        "k61_874\t221\t10\t0\r\n",
        "k61_875\t222\t10\t0\r\n",
        "k61_876\t364\t18\t0\r\n",
        "k61_878\t309\t25\t0\r\n",
        "k61_879\t497\t30\t0\r\n",
        "k61_880\t612\t68\t0\r\n",
        "k61_881\t282\t21\t0\r\n",
        "k61_882\t271\t25\t0\r\n",
        "k61_883\t366\t33\t0\r\n",
        "k61_884\t1449\t137\t0\r\n",
        "k61_885\t552\t68\t0\r\n",
        "k61_886\t287\t17\t0\r\n",
        "k61_887\t211\t12\t0\r\n",
        "k61_888\t1277\t137\t0\r\n",
        "k61_889\t265\t10\t0\r\n",
        "k61_890\t209\t5\t0\r\n",
        "k61_891\t412\t39\t0\r\n",
        "k61_892\t240\t11\t0\r\n",
        "k61_893\t551\t38\t0\r\n",
        "k61_894\t239\t14\t0\r\n",
        "k61_895\t819\t92\t0\r\n",
        "k61_896\t203\t22\t0\r\n",
        "k61_897\t695\t58\t0\r\n",
        "k61_898\t281\t17\t0\r\n",
        "k61_899\t440\t29\t0\r\n",
        "k61_900\t220\t11\t0\r\n",
        "k61_901\t235\t9\t0\r\n",
        "k61_902\t309\t32\t0\r\n",
        "k61_903\t618\t55\t0\r\n",
        "k61_904\t911\t70\t0\r\n",
        "k61_906\t274\t21\t0\r\n",
        "k61_907\t1180\t86\t0\r\n",
        "k61_908\t657\t52\t0\r\n",
        "k61_909\t239\t8\t0\r\n",
        "k61_910\t212\t7\t0\r\n",
        "k61_912\t302\t19\t0\r\n",
        "k61_913\t383\t23\t0\r\n",
        "k61_914\t257\t10\t0\r\n",
        "k61_915\t209\t7\t0\r\n",
        "k61_917\t581\t62\t0\r\n",
        "k61_919\t554\t31\t0\r\n",
        "k61_920\t304\t31\t0\r\n",
        "k61_921\t207\t5\t0\r\n",
        "k61_922\t202\t7\t0\r\n",
        "k61_923\t668\t46\t0\r\n",
        "k61_924\t226\t14\t0\r\n",
        "k61_926\t729\t66\t0\r\n",
        "k61_927\t741\t87\t0\r\n",
        "k61_928\t344\t26\t0\r\n",
        "k61_929\t534\t42\t0\r\n",
        "k61_930\t315\t22\t0\r\n",
        "k61_932\t406\t17\t0\r\n",
        "k61_934\t385\t39\t0\r\n",
        "k61_935\t319\t20\t0\r\n",
        "k61_936\t384\t32\t0\r\n",
        "k61_937\t307\t27\t0\r\n",
        "k61_938\t321\t15\t0\r\n",
        "k61_939\t266\t10\t0\r\n",
        "k61_940\t201\t34\t0\r\n",
        "k61_941\t235\t11\t0\r\n",
        "k61_942\t236\t13\t0\r\n",
        "k61_943\t386\t35\t0\r\n",
        "k61_944\t387\t21\t0\r\n",
        "k61_945\t321\t25\t0\r\n",
        "k61_946\t268\t24\t0\r\n",
        "k61_948\t222\t10\t0\r\n",
        "k61_949\t695\t73\t0\r\n",
        "k61_950\t205\t7\t0\r\n",
        "k61_951\t453\t50\t0\r\n",
        "k61_952\t406\t32\t0\r\n",
        "k61_953\t356\t25\t0\r\n",
        "k61_954\t234\t27\t0\r\n",
        "k61_955\t220\t18\t0\r\n",
        "k61_956\t261\t10\t0\r\n",
        "k61_957\t547\t39\t0\r\n",
        "k61_958\t475\t44\t0\r\n",
        "k61_959\t379\t36\t0\r\n",
        "k61_960\t393\t18\t0\r\n",
        "k61_961\t456\t29\t0\r\n",
        "k61_964\t204\t14\t0\r\n",
        "k61_965\t247\t18\t0\r\n",
        "k61_966\t483\t36\t0\r\n",
        "k61_968\t527\t47\t0\r\n",
        "k61_969\t346\t22\t0\r\n",
        "k61_970\t231\t19\t0\r\n",
        "k61_971\t666\t56\t0\r\n",
        "k61_972\t948\t88\t0\r\n",
        "k61_973\t668\t67\t0\r\n",
        "k61_974\t490\t45\t0\r\n",
        "k61_975\t1047\t123\t0\r\n",
        "k61_976\t451\t27\t0\r\n",
        "k61_978\t612\t71\t0\r\n",
        "k61_979\t349\t19\t0\r\n",
        "k61_980\t201\t12\t0\r\n",
        "k61_981\t300\t13\t0\r\n",
        "k61_982\t783\t79\t0\r\n",
        "k61_983\t406\t21\t0\r\n",
        "k61_984\t247\t9\t0\r\n",
        "k61_985\t412\t34\t0\r\n",
        "k61_987\t486\t29\t0\r\n",
        "k61_988\t394\t34\t0\r\n",
        "k61_989\t581\t34\t0\r\n",
        "k61_990\t648\t48\t0\r\n",
        "k61_991\t400\t36\t0\r\n",
        "k61_992\t2335\t265\t0\r\n",
        "k61_993\t206\t6\t0\r\n",
        "k61_994\t389\t32\t0\r\n",
        "k61_995\t931\t98\t0\r\n",
        "k61_996\t323\t17\t0\r\n",
        "k61_997\t297\t36\t0\r\n",
        "k61_998\t306\t14\t0\r\n",
        "k61_999\t307\t15\t0\r\n",
        "k61_1000\t310\t17\t0\r\n",
        "k61_1001\t878\t73\t0\r\n",
        "k61_1002\t428\t27\t0\r\n",
        "k61_1004\t261\t17\t0\r\n",
        "k61_1005\t308\t25\t0\r\n",
        "k61_1006\t1201\t79\t0\r\n",
        "k61_1007\t314\t23\t0\r\n",
        "k61_1008\t671\t60\t0\r\n",
        "k61_1009\t219\t8\t0\r\n",
        "k61_1010\t284\t16\t0\r\n",
        "k61_1011\t589\t63\t0\r\n",
        "k61_1012\t1087\t89\t0\r\n",
        "k61_1013\t216\t11\t0\r\n",
        "k61_1014\t1373\t141\t0\r\n",
        "k61_1015\t355\t18\t0\r\n",
        "k61_1016\t360\t16\t0\r\n",
        "k61_1017\t210\t13\t0\r\n",
        "k61_1018\t400\t25\t0\r\n",
        "k61_1019\t211\t9\t0\r\n",
        "k61_1020\t506\t35\t0\r\n",
        "k61_1021\t211\t8\t0\r\n",
        "k61_1022\t393\t36\t0\r\n",
        "k61_1023\t415\t25\t0\r\n",
        "k61_1024\t314\t27\t0\r\n",
        "k61_1025\t307\t17\t0\r\n",
        "k61_1026\t219\t7\t0\r\n",
        "k61_1028\t1905\t240\t0\r\n",
        "k61_1029\t362\t29\t0\r\n",
        "k61_1030\t817\t92\t0\r\n",
        "k61_1031\t834\t91\t0\r\n",
        "k61_1032\t211\t8\t0\r\n",
        "k61_1033\t1031\t103\t0\r\n",
        "k61_1034\t289\t11\t0\r\n",
        "k61_1035\t231\t11\t0\r\n",
        "k61_1036\t518\t213\t0\r\n",
        "k61_1037\t207\t18\t0\r\n",
        "k61_1038\t288\t14\t0\r\n",
        "k61_1039\t211\t10\t0\r\n",
        "k61_1041\t357\t15\t0\r\n",
        "k61_1044\t425\t31\t0\r\n",
        "k61_1045\t1669\t279\t0\r\n",
        "k61_1046\t202\t7\t0\r\n",
        "k61_1047\t237\t21\t0\r\n",
        "k61_1048\t272\t10\t0\r\n",
        "k61_1049\t201\t10\t0\r\n",
        "k61_1050\t407\t29\t0\r\n",
        "k61_1051\t207\t15\t0\r\n",
        "k61_1053\t1242\t121\t0\r\n",
        "k61_1054\t599\t44\t0\r\n",
        "k61_1055\t780\t76\t0\r\n",
        "k61_1056\t275\t13\t0\r\n",
        "k61_1057\t414\t23\t0\r\n",
        "k61_1058\t498\t32\t0\r\n",
        "k61_1059\t358\t23\t0\r\n",
        "k61_1060\t251\t8\t0\r\n",
        "k61_1061\t269\t13\t0\r\n",
        "k61_1062\t490\t58\t0\r\n",
        "k61_1063\t265\t11\t0\r\n",
        "k61_1064\t263\t17\t0\r\n",
        "k61_1065\t699\t54\t0\r\n",
        "k61_1068\t352\t41\t0\r\n",
        "k61_1069\t372\t25\t0\r\n",
        "k61_1070\t645\t62\t0\r\n",
        "k61_1071\t274\t11\t0\r\n",
        "k61_1072\t307\t29\t0\r\n",
        "k61_1073\t221\t12\t0\r\n",
        "k61_1074\t459\t38\t0\r\n",
        "k61_1075\t540\t32\t0\r\n",
        "k61_1076\t399\t26\t0\r\n",
        "k61_1077\t348\t20\t0\r\n",
        "k61_1078\t332\t24\t0\r\n",
        "k61_1079\t652\t32\t0\r\n",
        "k61_1081\t548\t29\t0\r\n",
        "k61_1082\t216\t7\t0\r\n",
        "k61_1086\t347\t15\t0\r\n",
        "k61_1087\t320\t25\t0\r\n",
        "k61_1088\t242\t24\t0\r\n",
        "k61_1089\t299\t23\t0\r\n",
        "k61_1090\t548\t49\t0\r\n",
        "k61_1091\t559\t46\t0\r\n",
        "k61_1092\t660\t77\t0\r\n",
        "k61_1093\t384\t22\t0\r\n",
        "k61_1094\t248\t14\t0\r\n",
        "k61_1095\t460\t21\t0\r\n",
        "k61_1097\t556\t37\t0\r\n",
        "k61_1098\t205\t13\t0\r\n",
        "k61_1099\t852\t66\t0\r\n",
        "k61_1100\t224\t12\t0\r\n",
        "k61_1101\t288\t12\t0\r\n",
        "k61_1102\t286\t10\t0\r\n",
        "k61_1103\t411\t15\t0\r\n",
        "k61_1104\t224\t21\t0\r\n",
        "k61_1105\t234\t18\t0\r\n",
        "k61_1106\t210\t16\t0\r\n",
        "k61_1107\t219\t19\t0\r\n",
        "k61_1108\t240\t10\t0\r\n",
        "k61_1109\t553\t43\t0\r\n",
        "k61_1110\t215\t16\t0\r\n",
        "k61_1111\t569\t38\t0\r\n",
        "k61_1112\t312\t22\t0\r\n",
        "k61_1113\t648\t51\t0\r\n",
        "k61_1114\t211\t18\t0\r\n",
        "k61_1115\t318\t16\t0\r\n",
        "k61_1117\t790\t63\t0\r\n",
        "k61_1118\t918\t63\t0\r\n",
        "k61_1119\t726\t60\t0\r\n",
        "k61_1120\t249\t19\t0\r\n",
        "k61_1121\t762\t67\t0\r\n",
        "k61_1122\t322\t24\t0\r\n",
        "k61_1123\t213\t9\t0\r\n",
        "k61_1124\t231\t25\t0\r\n",
        "k61_1125\t244\t25\t0\r\n",
        "k61_1126\t365\t33\t0\r\n",
        "k61_1127\t577\t72\t0\r\n",
        "k61_1128\t571\t63\t0\r\n",
        "k61_1129\t417\t29\t0\r\n",
        "k61_1130\t238\t18\t0\r\n",
        "k61_1131\t1315\t95\t0\r\n",
        "k61_1132\t205\t10\t0\r\n",
        "k61_1133\t222\t8\t0\r\n",
        "k61_1134\t326\t30\t0\r\n",
        "k61_1135\t215\t9\t0\r\n",
        "k61_1136\t360\t39\t0\r\n",
        "k61_1137\t1094\t95\t0\r\n",
        "k61_1138\t932\t78\t0\r\n",
        "k61_1139\t265\t26\t0\r\n",
        "k61_1140\t321\t23\t0\r\n",
        "k61_1141\t239\t19\t0\r\n",
        "k61_1142\t686\t51\t0\r\n",
        "k61_1144\t393\t15\t0\r\n",
        "k61_1145\t340\t32\t0\r\n",
        "k61_1146\t335\t37\t0\r\n",
        "k61_1147\t299\t11\t0\r\n",
        "k61_1148\t1401\t130\t0\r\n",
        "k61_1149\t253\t18\t0\r\n",
        "k61_1150\t699\t70\t0\r\n",
        "k61_1151\t276\t16\t0\r\n",
        "k61_1152\t202\t7\t0\r\n",
        "k61_1153\t535\t38\t0\r\n",
        "k61_1154\t857\t75\t0\r\n",
        "k61_1155\t302\t21\t0\r\n",
        "k61_1156\t414\t34\t0\r\n",
        "k61_1157\t789\t89\t0\r\n",
        "k61_1158\t690\t68\t0\r\n",
        "k61_1159\t742\t49\t0\r\n",
        "k61_1160\t257\t43\t0\r\n",
        "k61_1161\t585\t54\t0\r\n",
        "k61_1162\t291\t12\t0\r\n",
        "k61_1163\t622\t50\t0\r\n",
        "k61_1164\t242\t16\t0\r\n",
        "k61_1165\t933\t85\t0\r\n",
        "k61_1167\t324\t20\t0\r\n",
        "k61_1168\t303\t15\t0\r\n",
        "k61_1169\t258\t9\t0\r\n",
        "k61_1171\t230\t17\t0\r\n",
        "k61_1172\t227\t33\t0\r\n",
        "k61_1173\t416\t32\t0\r\n",
        "k61_1174\t604\t47\t0\r\n",
        "k61_1175\t388\t68\t0\r\n",
        "k61_1176\t218\t7\t0\r\n",
        "k61_1178\t700\t65\t0\r\n",
        "k61_1179\t413\t26\t0\r\n",
        "k61_1180\t387\t23\t0\r\n",
        "k61_1182\t861\t87\t0\r\n",
        "k61_1183\t1577\t162\t0\r\n",
        "k61_1184\t497\t42\t0\r\n",
        "k61_1185\t441\t38\t0\r\n",
        "k61_1186\t849\t83\t0\r\n",
        "k61_1187\t358\t34\t0\r\n",
        "k61_1188\t282\t11\t0\r\n",
        "k61_1189\t582\t64\t0\r\n",
        "k61_1190\t819\t103\t0\r\n",
        "k61_1191\t281\t26\t0\r\n",
        "k61_1193\t518\t34\t0\r\n",
        "k61_1194\t303\t17\t0\r\n",
        "k61_1195\t428\t34\t0\r\n",
        "k61_1196\t1110\t104\t0\r\n",
        "k61_1197\t1103\t128\t0\r\n",
        "k61_1198\t277\t13\t0\r\n",
        "k61_1199\t994\t87\t0\r\n",
        "k61_1200\t209\t9\t0\r\n",
        "k61_1201\t231\t19\t0\r\n",
        "k61_1202\t869\t77\t0\r\n",
        "k61_1203\t425\t33\t0\r\n",
        "k61_1204\t923\t83\t0\r\n",
        "k61_1205\t628\t57\t0\r\n",
        "k61_1206\t313\t29\t0\r\n",
        "k61_1207\t623\t51\t0\r\n",
        "k61_1208\t306\t16\t0\r\n",
        "k61_1209\t247\t18\t0\r\n",
        "k61_1210\t401\t35\t0\r\n",
        "k61_1211\t204\t11\t0\r\n",
        "k61_1212\t960\t148\t0\r\n",
        "k61_1213\t654\t50\t0\r\n",
        "k61_1215\t525\t66\t0\r\n",
        "k61_1217\t245\t12\t0\r\n",
        "k61_1218\t254\t16\t0\r\n",
        "k61_1219\t235\t13\t0\r\n",
        "k61_1220\t259\t24\t0\r\n",
        "k61_1221\t819\t70\t0\r\n",
        "k61_1222\t327\t15\t0\r\n",
        "k61_1223\t219\t30\t0\r\n",
        "k61_1224\t1368\t150\t0\r\n",
        "k61_1225\t293\t15\t0\r\n",
        "k61_1226\t237\t15\t0\r\n",
        "k61_1227\t217\t6\t0\r\n",
        "k61_1228\t211\t12\t0\r\n",
        "k61_1229\t265\t14\t0\r\n",
        "k61_1230\t274\t9\t0\r\n",
        "k61_1231\t684\t82\t0\r\n",
        "k61_1232\t241\t17\t0\r\n",
        "k61_1233\t212\t12\t0\r\n",
        "k61_1234\t390\t30\t0\r\n",
        "k61_1236\t258\t27\t0\r\n",
        "k61_1237\t358\t23\t0\r\n",
        "k61_1238\t726\t64\t0\r\n",
        "k61_1239\t244\t14\t0\r\n",
        "k61_1240\t828\t83\t0\r\n",
        "k61_1241\t342\t36\t0\r\n",
        "k61_1242\t916\t72\t0\r\n",
        "k61_1243\t313\t24\t0\r\n",
        "k61_1244\t508\t37\t0\r\n",
        "k61_1245\t286\t24\t0\r\n",
        "k61_1246\t206\t14\t0\r\n",
        "k61_1247\t273\t16\t0\r\n",
        "k61_1248\t439\t38\t0\r\n",
        "k61_1249\t238\t16\t0\r\n",
        "k61_1250\t504\t45\t0\r\n",
        "k61_1251\t265\t12\t0\r\n",
        "k61_1252\t284\t9\t0\r\n",
        "k61_1253\t286\t12\t0\r\n",
        "k61_1254\t476\t33\t0\r\n",
        "k61_1255\t377\t27\t0\r\n",
        "k61_1256\t233\t12\t0\r\n",
        "k61_1257\t389\t52\t0\r\n",
        "k61_1258\t218\t18\t0\r\n",
        "k61_1259\t337\t12\t0\r\n",
        "k61_1261\t229\t17\t0\r\n",
        "k61_1262\t2576\t318\t0\r\n",
        "k61_1264\t334\t19\t0\r\n",
        "k61_1265\t2305\t215\t0\r\n",
        "k61_1266\t937\t105\t0\r\n",
        "k61_1268\t230\t17\t0\r\n",
        "k61_1269\t433\t52\t0\r\n",
        "k61_1270\t263\t19\t0\r\n",
        "k61_1271\t317\t17\t0\r\n",
        "k61_1272\t602\t57\t0\r\n",
        "k61_1273\t233\t9\t0\r\n",
        "k61_1275\t276\t14\t0\r\n",
        "k61_1276\t250\t15\t0\r\n",
        "k61_1278\t220\t19\t0\r\n",
        "k61_1279\t425\t34\t0\r\n",
        "k61_1280\t520\t38\t0\r\n",
        "k61_1281\t545\t45\t0\r\n",
        "k61_1282\t361\t41\t0\r\n",
        "k61_1283\t243\t10\t0\r\n",
        "k61_1285\t309\t19\t0\r\n",
        "k61_1286\t294\t14\t0\r\n",
        "k61_1287\t501\t40\t0\r\n",
        "k61_1289\t876\t82\t0\r\n",
        "k61_1290\t396\t28\t0\r\n",
        "k61_1291\t382\t23\t0\r\n",
        "k61_1292\t470\t55\t0\r\n",
        "k61_1293\t898\t80\t0\r\n",
        "k61_1294\t233\t10\t0\r\n",
        "k61_1295\t216\t11\t0\r\n",
        "k61_1296\t427\t30\t0\r\n",
        "k61_1297\t363\t27\t0\r\n",
        "k61_1298\t362\t28\t0\r\n",
        "k61_1299\t608\t57\t0\r\n",
        "k61_1300\t294\t19\t0\r\n",
        "k61_1301\t201\t12\t0\r\n",
        "k61_1303\t456\t39\t0\r\n",
        "k61_1304\t225\t12\t0\r\n",
        "k61_1305\t321\t18\t0\r\n",
        "k61_1306\t224\t7\t0\r\n",
        "k61_1307\t665\t47\t0\r\n",
        "k61_1309\t237\t20\t0\r\n",
        "k61_1310\t532\t40\t0\r\n",
        "k61_1311\t432\t35\t0\r\n",
        "k61_1312\t294\t7\t0\r\n",
        "k61_1313\t270\t25\t0\r\n",
        "k61_1314\t370\t41\t0\r\n",
        "k61_1315\t265\t33\t0\r\n",
        "k61_1316\t234\t10\t0\r\n",
        "k61_1317\t635\t61\t0\r\n",
        "k61_1318\t350\t25\t0\r\n",
        "k61_1319\t539\t56\t0\r\n",
        "k61_1320\t219\t14\t0\r\n",
        "k61_1321\t393\t23\t0\r\n",
        "k61_1322\t296\t28\t0\r\n",
        "k61_1323\t246\t11\t0\r\n",
        "k61_1324\t327\t36\t0\r\n",
        "k61_1325\t307\t21\t0\r\n",
        "k61_1327\t652\t56\t0\r\n",
        "k61_1328\t283\t14\t0\r\n",
        "k61_1329\t218\t10\t0\r\n",
        "k61_1330\t208\t15\t0\r\n",
        "k61_1332\t300\t25\t0\r\n",
        "k61_1333\t269\t25\t0\r\n",
        "k61_1334\t201\t18\t0\r\n",
        "k61_1335\t465\t50\t0\r\n",
        "k61_1336\t1933\t179\t0\r\n",
        "k61_1337\t293\t23\t0\r\n",
        "k61_1338\t267\t23\t0\r\n",
        "k61_1339\t454\t48\t0\r\n",
        "k61_1340\t265\t16\t0\r\n",
        "k61_1341\t457\t61\t0\r\n",
        "k61_1342\t553\t40\t0\r\n",
        "k61_1343\t501\t20\t0\r\n",
        "k61_1345\t455\t38\t0\r\n",
        "k61_1346\t393\t43\t0\r\n",
        "k61_1347\t274\t17\t0\r\n",
        "k61_1348\t3383\t279\t0\r\n",
        "k61_1349\t452\t60\t0\r\n",
        "k61_1350\t580\t41\t0\r\n",
        "k61_1351\t1054\t76\t0\r\n",
        "k61_1352\t295\t28\t0\r\n",
        "k61_1353\t376\t32\t0\r\n",
        "k61_1354\t877\t64\t0\r\n",
        "k61_1355\t234\t14\t0\r\n",
        "k61_1356\t1760\t197\t0\r\n",
        "k61_1357\t310\t13\t0\r\n",
        "k61_1358\t274\t23\t0\r\n",
        "k61_1359\t237\t21\t0\r\n",
        "k61_1360\t281\t13\t0\r\n",
        "k61_1361\t277\t25\t0\r\n",
        "k61_1362\t204\t6\t0\r\n",
        "k61_1363\t705\t55\t0\r\n",
        "k61_1364\t539\t45\t0\r\n",
        "k61_1365\t474\t22\t0\r\n",
        "k61_1366\t422\t24\t0\r\n",
        "k61_1367\t1164\t105\t0\r\n",
        "k61_1368\t777\t49\t0\r\n",
        "k61_1369\t248\t20\t0\r\n",
        "k61_1370\t801\t56\t0\r\n",
        "k61_1371\t222\t8\t0\r\n",
        "k61_1372\t258\t26\t0\r\n",
        "k61_1374\t258\t21\t0\r\n",
        "k61_1375\t311\t21\t0\r\n",
        "k61_1376\t592\t34\t0\r\n",
        "k61_1377\t514\t56\t0\r\n",
        "k61_1378\t206\t10\t0\r\n",
        "k61_1379\t2319\t289\t0\r\n",
        "k61_1380\t292\t15\t0\r\n",
        "k61_1381\t477\t35\t0\r\n",
        "k61_1382\t293\t25\t0\r\n",
        "k61_1383\t369\t22\t0\r\n",
        "k61_1384\t599\t42\t0\r\n",
        "k61_1385\t211\t15\t0\r\n",
        "k61_1386\t309\t24\t0\r\n",
        "k61_1387\t333\t21\t0\r\n",
        "k61_1388\t365\t34\t0\r\n",
        "k61_1389\t348\t37\t0\r\n",
        "k61_1390\t530\t45\t0\r\n",
        "k61_1391\t1478\t551\t0\r\n",
        "k61_1392\t300\t25\t0\r\n",
        "k61_1393\t1045\t65\t0\r\n",
        "k61_1394\t259\t11\t0\r\n",
        "k61_1396\t515\t34\t0\r\n",
        "k61_1397\t314\t23\t0\r\n",
        "k61_1398\t318\t25\t0\r\n",
        "k61_1399\t238\t12\t0\r\n",
        "k61_1400\t319\t16\t0\r\n",
        "k61_1401\t227\t22\t0\r\n",
        "k61_1402\t1031\t67\t0\r\n",
        "k61_1403\t756\t60\t0\r\n",
        "k61_1404\t265\t11\t0\r\n",
        "k61_1405\t227\t12\t0\r\n",
        "k61_1406\t255\t10\t0\r\n",
        "k61_1407\t740\t56\t0\r\n",
        "k61_1408\t227\t7\t0\r\n",
        "k61_1409\t375\t20\t0\r\n",
        "k61_1410\t291\t25\t0\r\n",
        "k61_1411\t486\t40\t0\r\n",
        "k61_1412\t226\t10\t0\r\n",
        "k61_1413\t816\t47\t0\r\n",
        "k61_1414\t474\t27\t0\r\n",
        "k61_1415\t4241\t931\t0\r\n",
        "k61_1416\t265\t18\t0\r\n",
        "k61_1417\t321\t18\t0\r\n",
        "k61_1418\t482\t37\t0\r\n",
        "k61_1419\t677\t54\t0\r\n",
        "k61_1420\t293\t21\t0\r\n",
        "k61_1421\t3438\t374\t0\r\n",
        "k61_1422\t749\t74\t0\r\n",
        "k61_1423\t298\t12\t0\r\n",
        "k61_1424\t554\t43\t0\r\n",
        "k61_1425\t613\t46\t0\r\n",
        "k61_1427\t549\t35\t0\r\n",
        "k61_1428\t353\t21\t0\r\n",
        "k61_1429\t637\t38\t0\r\n",
        "k61_1430\t542\t41\t0\r\n",
        "k61_1431\t249\t20\t0\r\n",
        "k61_1432\t241\t13\t0\r\n",
        "k61_1433\t200\t5\t0\r\n",
        "k61_1434\t218\t11\t0\r\n",
        "k61_1435\t1736\t211\t0\r\n",
        "k61_1436\t215\t6\t0\r\n",
        "k61_1437\t2496\t282\t0\r\n",
        "k61_1438\t219\t10\t0\r\n",
        "k61_1439\t202\t8\t0\r\n",
        "k61_1440\t491\t37\t0\r\n",
        "k61_1441\t340\t34\t0\r\n",
        "k61_1442\t1165\t111\t0\r\n",
        "k61_1443\t214\t17\t0\r\n",
        "k61_1444\t201\t14\t0\r\n",
        "k61_1445\t332\t15\t0\r\n",
        "k61_1446\t889\t63\t0\r\n",
        "k61_1447\t938\t104\t0\r\n",
        "k61_1448\t977\t111\t0\r\n",
        "k61_1449\t383\t31\t0\r\n",
        "k61_1450\t968\t106\t0\r\n",
        "k61_1451\t228\t19\t0\r\n",
        "k61_1452\t618\t46\t0\r\n",
        "k61_1453\t294\t13\t0\r\n",
        "k61_1454\t516\t25\t0\r\n",
        "k61_1455\t415\t46\t0\r\n",
        "k61_1456\t1540\t161\t0\r\n",
        "k61_1457\t544\t47\t0\r\n",
        "k61_1458\t229\t10\t0\r\n",
        "k61_1459\t343\t29\t0\r\n",
        "k61_1460\t217\t12\t0\r\n",
        "k61_1461\t984\t83\t0\r\n",
        "k61_1462\t248\t11\t0\r\n",
        "k61_1463\t327\t21\t0\r\n",
        "k61_1464\t362\t34\t0\r\n",
        "k61_1465\t1075\t133\t0\r\n",
        "k61_1466\t276\t9\t0\r\n",
        "k61_1467\t298\t10\t0\r\n",
        "k61_1468\t319\t22\t0\r\n",
        "k61_1469\t251\t16\t0\r\n",
        "k61_1470\t371\t24\t0\r\n",
        "k61_1471\t236\t9\t0\r\n",
        "k61_1472\t376\t31\t0\r\n",
        "k61_1473\t211\t9\t0\r\n",
        "k61_1474\t236\t8\t0\r\n",
        "k61_1475\t418\t34\t0\r\n",
        "k61_1476\t323\t22\t0\r\n",
        "k61_1477\t451\t38\t0\r\n",
        "k61_1478\t261\t9\t0\r\n",
        "k61_1479\t277\t12\t0\r\n",
        "k61_1480\t1075\t122\t0\r\n",
        "k61_1481\t490\t51\t0\r\n",
        "k61_1482\t561\t55\t0\r\n",
        "k61_1483\t386\t35\t0\r\n",
        "k61_1484\t523\t37\t0\r\n",
        "k61_1485\t231\t11\t0\r\n",
        "k61_1486\t234\t19\t0\r\n",
        "k61_1487\t361\t13\t0\r\n",
        "k61_1488\t944\t105\t0\r\n",
        "k61_1489\t609\t51\t0\r\n",
        "k61_1490\t932\t101\t0\r\n",
        "k61_1491\t306\t20\t0\r\n",
        "k61_1492\t223\t10\t0\r\n",
        "k61_1493\t359\t27\t0\r\n",
        "k61_1494\t677\t74\t0\r\n",
        "k61_1495\t407\t33\t0\r\n",
        "k61_1496\t625\t50\t0\r\n",
        "k61_1497\t268\t11\t0\r\n",
        "k61_1499\t446\t26\t0\r\n",
        "k61_1500\t331\t16\t0\r\n",
        "k61_1502\t605\t56\t0\r\n",
        "k61_1503\t784\t68\t0\r\n",
        "k61_1505\t760\t69\t0\r\n",
        "k61_1506\t919\t72\t0\r\n",
        "k61_1507\t746\t67\t0\r\n",
        "k61_1508\t697\t52\t0\r\n",
        "k61_1509\t665\t64\t0\r\n",
        "k61_1510\t291\t26\t0\r\n",
        "k61_1511\t446\t41\t0\r\n",
        "k61_1512\t291\t13\t0\r\n",
        "k61_1513\t225\t12\t0\r\n",
        "k61_1514\t728\t64\t0\r\n",
        "k61_1515\t599\t52\t0\r\n",
        "k61_1516\t315\t24\t0\r\n",
        "k61_1517\t235\t13\t0\r\n",
        "k61_1518\t370\t29\t0\r\n",
        "k61_1519\t388\t23\t0\r\n",
        "k61_1520\t272\t28\t0\r\n",
        "k61_1521\t346\t44\t0\r\n",
        "k61_1522\t406\t25\t0\r\n",
        "k61_1523\t334\t36\t0\r\n",
        "k61_1524\t429\t19\t0\r\n",
        "k61_1525\t1167\t113\t0\r\n",
        "k61_1526\t886\t65\t0\r\n",
        "k61_1527\t322\t13\t0\r\n",
        "k61_1528\t216\t7\t0\r\n",
        "k61_1529\t626\t48\t0\r\n",
        "k61_1530\t720\t52\t0\r\n",
        "k61_1531\t256\t14\t0\r\n",
        "k61_1532\t368\t28\t0\r\n",
        "k61_1533\t205\t10\t0\r\n",
        "k61_1534\t217\t13\t0\r\n",
        "k61_1535\t486\t23\t0\r\n",
        "k61_1536\t1620\t155\t0\r\n",
        "k61_1538\t254\t18\t0\r\n",
        "k61_1539\t266\t20\t0\r\n",
        "k61_1540\t432\t46\t0\r\n",
        "k61_1542\t222\t16\t0\r\n",
        "k61_1543\t398\t20\t0\r\n",
        "k61_1544\t236\t9\t0\r\n",
        "k61_1545\t612\t51\t0\r\n",
        "k61_1547\t299\t12\t0\r\n",
        "k61_1548\t412\t33\t0\r\n",
        "k61_1549\t208\t10\t0\r\n",
        "k61_1550\t305\t10\t0\r\n",
        "k61_1552\t921\t72\t0\r\n",
        "k61_1553\t308\t19\t0\r\n",
        "k61_1554\t666\t40\t0\r\n",
        "k61_1556\t356\t34\t0\r\n",
        "k61_1557\t245\t15\t0\r\n",
        "k61_1559\t1495\t153\t0\r\n",
        "k61_1560\t200\t13\t0\r\n",
        "k61_1561\t411\t28\t0\r\n",
        "k61_1562\t474\t78\t0\r\n",
        "k61_1563\t898\t64\t0\r\n",
        "k61_1564\t328\t14\t0\r\n",
        "k61_1566\t313\t28\t0\r\n",
        "k61_1568\t434\t28\t0\r\n",
        "k61_1569\t1233\t119\t0\r\n",
        "k61_1570\t217\t8\t0\r\n",
        "k61_1571\t248\t19\t0\r\n",
        "k61_1572\t214\t10\t0\r\n",
        "k61_1573\t501\t56\t0\r\n",
        "k61_1574\t607\t63\t0\r\n",
        "k61_1576\t1650\t146\t0\r\n",
        "k61_1577\t258\t22\t0\r\n",
        "k61_1578\t253\t26\t0\r\n",
        "k61_1579\t275\t21\t0\r\n",
        "k61_1580\t240\t15\t0\r\n",
        "k61_1581\t503\t40\t0\r\n",
        "k61_1582\t242\t10\t0\r\n",
        "k61_1583\t527\t52\t0\r\n",
        "k61_1584\t872\t138\t0\r\n",
        "k61_1585\t212\t14\t0\r\n",
        "k61_1586\t869\t68\t0\r\n",
        "k61_1587\t416\t22\t0\r\n",
        "k61_1588\t1251\t124\t0\r\n",
        "k61_1589\t556\t56\t0\r\n",
        "k61_1590\t383\t24\t0\r\n",
        "k61_1591\t205\t13\t0\r\n",
        "k61_1592\t231\t17\t0\r\n",
        "k61_1593\t823\t66\t0\r\n",
        "k61_1594\t201\t6\t0\r\n",
        "k61_1595\t284\t19\t0\r\n",
        "k61_1596\t220\t17\t0\r\n",
        "k61_1597\t201\t5\t0\r\n",
        "k61_1598\t813\t74\t0\r\n",
        "k61_1599\t223\t8\t0\r\n",
        "k61_1600\t369\t28\t0\r\n",
        "k61_1602\t866\t52\t0\r\n",
        "k61_1603\t287\t21\t0\r\n",
        "k61_1604\t475\t40\t0\r\n",
        "k61_1605\t276\t19\t0\r\n",
        "k61_1606\t207\t15\t0\r\n",
        "k61_1607\t417\t26\t0\r\n",
        "k61_1608\t719\t56\t0\r\n",
        "k61_1609\t300\t16\t0\r\n",
        "k61_1611\t678\t72\t0\r\n",
        "k61_1612\t362\t12\t0\r\n",
        "k61_1613\t252\t17\t0\r\n",
        "k61_1614\t681\t79\t0\r\n",
        "k61_1615\t209\t11\t0\r\n",
        "k61_1616\t247\t10\t0\r\n",
        "k61_1617\t245\t13\t0\r\n",
        "k61_1618\t204\t9\t0\r\n",
        "k61_1619\t348\t30\t0\r\n",
        "k61_1620\t509\t31\t0\r\n",
        "k61_1621\t385\t46\t0\r\n",
        "k61_1623\t202\t7\t0\r\n",
        "k61_1624\t1131\t108\t0\r\n",
        "k61_1625\t712\t56\t0\r\n",
        "k61_1626\t810\t73\t0\r\n",
        "k61_1627\t1531\t163\t0\r\n",
        "k61_1628\t237\t13\t0\r\n",
        "k61_1629\t229\t18\t0\r\n",
        "k61_1631\t370\t19\t0\r\n",
        "k61_1633\t765\t78\t0\r\n",
        "k61_1634\t306\t18\t0\r\n",
        "k61_1635\t783\t87\t0\r\n",
        "k61_1637\t271\t19\t0\r\n",
        "k61_1638\t378\t35\t0\r\n",
        "k61_1639\t222\t14\t0\r\n",
        "k61_1640\t509\t58\t0\r\n",
        "k61_1641\t1104\t103\t0\r\n",
        "k61_1642\t428\t30\t0\r\n",
        "k61_1643\t2639\t274\t0\r\n",
        "k61_1644\t356\t26\t0\r\n",
        "k61_1645\t242\t12\t0\r\n",
        "k61_1646\t577\t54\t0\r\n",
        "k61_1647\t294\t26\t0\r\n",
        "k61_1648\t368\t33\t0\r\n",
        "k61_1649\t671\t41\t0\r\n",
        "k61_1650\t215\t13\t0\r\n",
        "k61_1651\t363\t17\t0\r\n",
        "k61_1652\t334\t20\t0\r\n",
        "k61_1653\t222\t19\t0\r\n",
        "k61_1655\t279\t11\t0\r\n",
        "k61_1656\t215\t11\t0\r\n",
        "k61_1657\t276\t8\t0\r\n",
        "k61_1658\t273\t30\t0\r\n",
        "k61_1659\t351\t26\t0\r\n",
        "k61_1660\t1503\t128\t0\r\n",
        "k61_1661\t473\t36\t0\r\n",
        "k61_1662\t272\t30\t0\r\n",
        "k61_1663\t237\t9\t0\r\n",
        "k61_1664\t291\t14\t0\r\n",
        "k61_1665\t200\t10\t0\r\n",
        "k61_1666\t464\t123\t0\r\n",
        "k61_1667\t305\t13\t0\r\n",
        "k61_1668\t261\t20\t0\r\n",
        "k61_1669\t274\t11\t0\r\n",
        "k61_1670\t362\t38\t0\r\n",
        "k61_1671\t382\t29\t0\r\n",
        "k61_1672\t338\t30\t0\r\n",
        "k61_1673\t623\t44\t0\r\n",
        "k61_1674\t296\t17\t0\r\n",
        "k61_1675\t302\t13\t0\r\n",
        "k61_1676\t519\t18\t0\r\n",
        "k61_1677\t205\t8\t0\r\n",
        "k61_1678\t384\t38\t0\r\n",
        "k61_1680\t474\t35\t0\r\n",
        "k61_1681\t348\t33\t0\r\n",
        "k61_1682\t540\t48\t0\r\n",
        "k61_1683\t428\t26\t0\r\n",
        "k61_1684\t549\t48\t0\r\n",
        "k61_1685\t259\t24\t0\r\n",
        "k61_1687\t317\t21\t0\r\n",
        "k61_1688\t375\t20\t0\r\n",
        "k61_1689\t310\t26\t0\r\n",
        "k61_1690\t321\t18\t0\r\n",
        "k61_1691\t256\t24\t0\r\n",
        "k61_1692\t249\t30\t0\r\n",
        "k61_1693\t630\t49\t0\r\n",
        "k61_1695\t1519\t135\t0\r\n",
        "k61_1696\t569\t37\t0\r\n",
        "k61_1697\t406\t32\t0\r\n",
        "k61_1698\t245\t25\t0\r\n",
        "k61_1699\t499\t55\t0\r\n",
        "k61_1700\t219\t13\t0\r\n",
        "k61_1702\t722\t103\t0\r\n",
        "k61_1703\t282\t11\t0\r\n",
        "k61_1704\t218\t8\t0\r\n",
        "k61_1705\t337\t26\t0\r\n",
        "k61_1706\t543\t39\t0\r\n",
        "k61_1709\t212\t15\t0\r\n",
        "k61_1710\t453\t27\t0\r\n",
        "k61_1712\t453\t34\t0\r\n",
        "k61_1713\t371\t26\t0\r\n",
        "k61_1714\t350\t22\t0\r\n",
        "k61_1715\t319\t24\t0\r\n",
        "k61_1716\t458\t37\t0\r\n",
        "k61_1717\t216\t13\t0\r\n",
        "k61_1718\t266\t24\t0\r\n",
        "k61_1719\t911\t76\t0\r\n",
        "k61_1720\t233\t10\t0\r\n",
        "k61_1721\t223\t7\t0\r\n",
        "k61_1722\t321\t25\t0\r\n",
        "k61_1723\t206\t9\t0\r\n",
        "k61_1724\t252\t12\t0\r\n",
        "k61_1725\t281\t15\t0\r\n",
        "k61_1726\t443\t45\t0\r\n",
        "k61_1727\t394\t32\t0\r\n",
        "k61_1729\t203\t14\t0\r\n",
        "k61_1730\t1552\t196\t0\r\n",
        "k61_1731\t494\t36\t0\r\n",
        "k61_1732\t473\t38\t0\r\n",
        "k61_1734\t207\t6\t0\r\n",
        "k61_1735\t203\t13\t0\r\n",
        "k61_1736\t485\t35\t0\r\n",
        "k61_1737\t885\t90\t0\r\n",
        "k61_1738\t1558\t192\t0\r\n",
        "k61_1739\t383\t23\t0\r\n",
        "k61_1740\t225\t6\t0\r\n",
        "k61_1741\t346\t27\t0\r\n",
        "k61_1742\t240\t21\t0\r\n",
        "k61_1743\t696\t59\t0\r\n",
        "k61_1744\t361\t30\t0\r\n",
        "k61_1745\t933\t71\t0\r\n",
        "k61_1746\t565\t41\t0\r\n",
        "k61_1747\t330\t16\t0\r\n",
        "k61_1748\t559\t52\t0\r\n",
        "k61_1749\t231\t13\t0\r\n",
        "k61_1751\t332\t22\t0\r\n",
        "k61_1752\t421\t29\t0\r\n",
        "k61_1754\t489\t34\t0\r\n",
        "k61_1755\t291\t10\t0\r\n",
        "k61_1757\t273\t19\t0\r\n",
        "k61_1758\t735\t61\t0\r\n",
        "k61_1759\t286\t26\t0\r\n",
        "k61_1760\t6265\t4379\t0\r\n",
        "k61_1761\t315\t13\t0\r\n",
        "k61_1762\t231\t11\t0\r\n",
        "k61_1763\t457\t54\t0\r\n",
        "k61_1764\t600\t55\t0\r\n",
        "k61_1765\t266\t19\t0\r\n",
        "k61_1766\t265\t18\t0\r\n",
        "k61_1767\t319\t22\t0\r\n",
        "k61_1768\t524\t55\t0\r\n",
        "k61_1769\t242\t14\t0\r\n",
        "k61_1770\t226\t13\t0\r\n",
        "k61_1772\t260\t13\t0\r\n",
        "k61_1773\t694\t67\t0\r\n",
        "k61_1775\t251\t24\t0\r\n",
        "k61_1777\t664\t56\t0\r\n",
        "k61_1778\t1261\t129\t0\r\n",
        "k61_1780\t1567\t164\t0\r\n",
        "k61_1781\t528\t44\t0\r\n",
        "k61_1782\t232\t19\t0\r\n",
        "k61_1783\t812\t161\t0\r\n",
        "k61_1784\t862\t72\t0\r\n",
        "k61_1786\t314\t11\t0\r\n",
        "k61_1787\t492\t44\t0\r\n",
        "k61_1788\t478\t43\t0\r\n",
        "k61_1789\t226\t10\t0\r\n",
        "k61_1790\t911\t77\t0\r\n",
        "k61_1791\t318\t21\t0\r\n",
        "k61_1792\t208\t6\t0\r\n",
        "k61_1793\t415\t49\t0\r\n",
        "k61_1794\t405\t21\t0\r\n",
        "k61_1795\t405\t31\t0\r\n",
        "k61_1796\t526\t40\t0\r\n",
        "k61_1797\t327\t17\t0\r\n",
        "k61_1798\t243\t9\t0\r\n",
        "k61_1799\t472\t41\t0\r\n",
        "k61_1800\t309\t25\t0\r\n",
        "k61_1801\t207\t12\t0\r\n",
        "k61_1802\t400\t28\t0\r\n",
        "k61_1803\t382\t21\t0\r\n",
        "k61_1804\t756\t66\t0\r\n",
        "k61_1805\t257\t18\t0\r\n",
        "k61_1807\t497\t37\t0\r\n",
        "k61_1808\t398\t22\t0\r\n",
        "k61_1809\t365\t31\t0\r\n",
        "k61_1810\t246\t17\t0\r\n",
        "k61_1811\t552\t45\t0\r\n",
        "k61_1812\t209\t13\t0\r\n",
        "k61_1814\t1644\t135\t0\r\n",
        "k61_1815\t395\t19\t0\r\n",
        "k61_1816\t692\t65\t0\r\n",
        "k61_1817\t1268\t107\t0\r\n",
        "k61_1818\t405\t22\t0\r\n",
        "k61_1819\t426\t57\t0\r\n",
        "k61_1820\t215\t6\t0\r\n",
        "k61_1821\t446\t39\t0\r\n",
        "k61_1822\t322\t28\t0\r\n",
        "k61_1823\t268\t18\t0\r\n",
        "k61_1824\t338\t27\t0\r\n",
        "k61_1825\t377\t42\t0\r\n",
        "k61_1826\t370\t24\t0\r\n",
        "k61_1828\t551\t45\t0\r\n",
        "k61_1829\t225\t8\t0\r\n",
        "k61_1830\t255\t14\t0\r\n",
        "k61_1831\t978\t93\t0\r\n",
        "k61_1832\t899\t62\t0\r\n",
        "k61_1833\t795\t56\t0\r\n",
        "k61_1834\t203\t17\t0\r\n",
        "k61_1835\t280\t22\t0\r\n",
        "k61_1836\t851\t93\t0\r\n",
        "k61_1837\t279\t9\t0\r\n",
        "k61_1838\t1000\t107\t0\r\n",
        "k61_1839\t1019\t76\t0\r\n",
        "k61_1840\t238\t18\t0\r\n",
        "k61_1841\t217\t43\t0\r\n",
        "k61_1842\t683\t42\t0\r\n",
        "k61_1843\t232\t11\t0\r\n",
        "k61_1844\t206\t7\t0\r\n",
        "k61_1845\t1034\t1042\t0\r\n",
        "k61_1846\t361\t32\t0\r\n",
        "k61_1847\t315\t18\t0\r\n",
        "k61_1848\t210\t47\t0\r\n",
        "k61_1849\t237\t11\t0\r\n",
        "k61_1850\t1485\t196\t0\r\n",
        "k61_1851\t587\t57\t0\r\n",
        "k61_1852\t577\t64\t0\r\n",
        "k61_1853\t538\t58\t0\r\n",
        "k61_1854\t492\t39\t0\r\n",
        "k61_1855\t208\t11\t0\r\n",
        "k61_1856\t413\t43\t0\r\n",
        "k61_1858\t855\t72\t0\r\n",
        "k61_1859\t311\t26\t0\r\n",
        "k61_1860\t279\t18\t0\r\n",
        "k61_1861\t405\t39\t0\r\n",
        "k61_1862\t484\t49\t0\r\n",
        "k61_1863\t1379\t119\t0\r\n",
        "k61_1864\t266\t10\t0\r\n",
        "k61_1865\t553\t37\t0\r\n",
        "k61_1866\t215\t14\t0\r\n",
        "k61_1867\t431\t16\t0\r\n",
        "k61_1868\t548\t53\t0\r\n",
        "k61_1870\t910\t73\t0\r\n",
        "k61_1872\t255\t13\t0\r\n",
        "k61_1873\t346\t23\t0\r\n",
        "k61_1874\t1102\t99\t0\r\n",
        "k61_1875\t489\t33\t0\r\n",
        "k61_1877\t291\t16\t0\r\n",
        "k61_1878\t532\t65\t0\r\n",
        "k61_1882\t286\t16\t0\r\n",
        "k61_1883\t264\t11\t0\r\n",
        "k61_1884\t419\t29\t0\r\n",
        "k61_1885\t200\t6\t0\r\n",
        "k61_1886\t516\t36\t0\r\n",
        "k61_1887\t260\t18\t0\r\n",
        "k61_1888\t301\t19\t0\r\n",
        "k61_1889\t223\t12\t0\r\n",
        "k61_1890\t829\t85\t0\r\n",
        "k61_1891\t431\t25\t0\r\n",
        "k61_1892\t232\t13\t0\r\n",
        "k61_1893\t219\t6\t0\r\n",
        "k61_1894\t527\t48\t0\r\n",
        "k61_1895\t517\t48\t0\r\n",
        "k61_1896\t1069\t92\t0\r\n",
        "k61_1897\t235\t11\t0\r\n",
        "k61_1898\t241\t11\t0\r\n",
        "k61_1899\t1118\t131\t0\r\n",
        "k61_1900\t244\t21\t0\r\n",
        "k61_1901\t364\t14\t0\r\n",
        "k61_1902\t414\t35\t0\r\n",
        "k61_1904\t204\t16\t0\r\n",
        "k61_1905\t1122\t112\t0\r\n",
        "k61_1906\t203\t7\t0\r\n",
        "k61_1907\t1416\t132\t0\r\n",
        "k61_1908\t294\t19\t0\r\n",
        "k61_1909\t479\t26\t0\r\n",
        "k61_1910\t364\t16\t0\r\n",
        "k61_1911\t300\t19\t0\r\n",
        "k61_1912\t504\t25\t0\r\n",
        "k61_1913\t543\t27\t0\r\n",
        "k61_1914\t418\t42\t0\r\n",
        "k61_1915\t327\t17\t0\r\n",
        "k61_1916\t803\t71\t0\r\n",
        "k61_1917\t246\t7\t0\r\n",
        "k61_1918\t322\t25\t0\r\n",
        "k61_1919\t224\t9\t0\r\n",
        "k61_1920\t273\t25\t0\r\n",
        "k61_1921\t539\t47\t0\r\n",
        "k61_1922\t213\t5\t0\r\n",
        "k61_1923\t499\t50\t0\r\n",
        "k61_1924\t251\t9\t0\r\n",
        "k61_1925\t249\t13\t0\r\n",
        "k61_1926\t234\t9\t0\r\n",
        "k61_1927\t641\t62\t0\r\n",
        "k61_1928\t355\t31\t0\r\n",
        "k61_1929\t250\t15\t0\r\n",
        "k61_1930\t357\t20\t0\r\n",
        "k61_1931\t210\t25\t0\r\n",
        "k61_1932\t226\t7\t0\r\n",
        "k61_1933\t356\t12\t0\r\n",
        "k61_1934\t233\t8\t0\r\n",
        "k61_1935\t398\t38\t0\r\n",
        "k61_1936\t1456\t151\t0\r\n",
        "k61_1937\t803\t55\t0\r\n",
        "k61_1938\t203\t8\t0\r\n",
        "k61_1939\t922\t194\t0\r\n",
        "k61_1940\t278\t20\t0\r\n",
        "k61_1941\t295\t17\t0\r\n",
        "k61_1942\t200\t13\t0\r\n",
        "k61_1943\t221\t15\t0\r\n",
        "k61_1944\t620\t63\t0\r\n",
        "k61_1945\t581\t46\t0\r\n",
        "k61_1946\t246\t10\t0\r\n",
        "k61_1948\t461\t44\t0\r\n",
        "k61_1949\t241\t18\t0\r\n",
        "k61_1950\t214\t10\t0\r\n",
        "k61_1951\t455\t38\t0\r\n",
        "k61_1952\t271\t12\t0\r\n",
        "k61_1953\t341\t21\t0\r\n",
        "k61_1954\t236\t7\t0\r\n",
        "k61_1955\t205\t11\t0\r\n",
        "k61_1956\t321\t15\t0\r\n",
        "k61_1957\t317\t22\t0\r\n",
        "k61_1958\t217\t14\t0\r\n",
        "k61_1959\t1226\t92\t0\r\n",
        "k61_1960\t219\t11\t0\r\n",
        "k61_1961\t244\t19\t0\r\n",
        "k61_1962\t304\t28\t0\r\n",
        "k61_1963\t243\t13\t0\r\n",
        "k61_1964\t415\t30\t0\r\n",
        "k61_1965\t259\t7\t0\r\n",
        "k61_1966\t244\t9\t0\r\n",
        "k61_1968\t383\t32\t0\r\n",
        "k61_1969\t503\t51\t0\r\n",
        "k61_1970\t312\t22\t0\r\n",
        "k61_1971\t1054\t91\t0\r\n",
        "k61_1972\t375\t25\t0\r\n",
        "k61_1973\t578\t55\t0\r\n",
        "k61_1975\t1016\t100\t0\r\n",
        "k61_1976\t686\t47\t0\r\n",
        "k61_1977\t428\t25\t0\r\n",
        "k61_1978\t362\t16\t0\r\n",
        "k61_1979\t214\t18\t0\r\n",
        "k61_1980\t234\t7\t0\r\n",
        "k61_1982\t258\t22\t0\r\n",
        "k61_1983\t293\t9\t0\r\n",
        "k61_1984\t296\t19\t0\r\n",
        "k61_1985\t454\t33\t0\r\n",
        "k61_1986\t379\t21\t0\r\n",
        "k61_1987\t650\t69\t0\r\n",
        "k61_1988\t432\t39\t0\r\n",
        "k61_1989\t461\t52\t0\r\n",
        "k61_1990\t364\t34\t0\r\n",
        "k61_1991\t347\t21\t0\r\n",
        "k61_1993\t252\t9\t0\r\n",
        "k61_1994\t477\t35\t0\r\n",
        "k61_1995\t286\t11\t0\r\n",
        "k61_1996\t321\t23\t0\r\n",
        "k61_1997\t461\t30\t0\r\n",
        "k61_1998\t653\t53\t0\r\n",
        "k61_1999\t201\t7\t0\r\n",
        "k61_2000\t647\t47\t0\r\n",
        "k61_2001\t322\t32\t0\r\n",
        "k61_2002\t364\t33\t0\r\n",
        "k61_2003\t265\t15\t0\r\n",
        "k61_2004\t501\t36\t0\r\n",
        "k61_2005\t278\t19\t0\r\n",
        "k61_2006\t231\t9\t0\r\n",
        "k61_2007\t346\t37\t0\r\n",
        "k61_2008\t249\t20\t0\r\n",
        "k61_2009\t331\t19\t0\r\n",
        "k61_2010\t517\t46\t0\r\n",
        "k61_2011\t231\t12\t0\r\n",
        "k61_2012\t201\t7\t0\r\n",
        "k61_2013\t493\t33\t0\r\n",
        "k61_2014\t401\t33\t0\r\n",
        "k61_2015\t635\t42\t0\r\n",
        "k61_2016\t268\t10\t0\r\n",
        "k61_2017\t718\t73\t0\r\n",
        "k61_2018\t219\t22\t0\r\n",
        "k61_2019\t669\t61\t0\r\n",
        "k61_2020\t263\t28\t0\r\n",
        "k61_2021\t328\t18\t0\r\n",
        "k61_2022\t210\t19\t0\r\n",
        "k61_2023\t603\t67\t0\r\n",
        "k61_2024\t221\t13\t0\r\n",
        "k61_2025\t355\t24\t0\r\n",
        "k61_2026\t202\t10\t0\r\n",
        "k61_2027\t489\t28\t0\r\n",
        "k61_2028\t400\t23\t0\r\n",
        "k61_2031\t783\t60\t0\r\n",
        "k61_2033\t447\t38\t0\r\n",
        "k61_2034\t599\t50\t0\r\n",
        "k61_2035\t1290\t144\t0\r\n",
        "k61_2036\t380\t17\t0\r\n",
        "k61_2037\t220\t8\t0\r\n",
        "k61_2038\t412\t28\t0\r\n",
        "k61_2039\t231\t14\t0\r\n",
        "k61_2042\t223\t17\t0\r\n",
        "k61_2043\t585\t35\t0\r\n",
        "k61_2044\t353\t32\t0\r\n",
        "k61_2045\t701\t55\t0\r\n",
        "k61_2047\t350\t29\t0\r\n",
        "k61_2048\t654\t55\t0\r\n",
        "k61_2049\t1186\t135\t0\r\n",
        "k61_2050\t292\t16\t0\r\n",
        "k61_2051\t389\t24\t0\r\n",
        "k61_2053\t477\t39\t0\r\n",
        "k61_2054\t207\t11\t0\r\n",
        "k61_2055\t590\t55\t0\r\n",
        "k61_2056\t1667\t168\t0\r\n",
        "k61_2057\t1482\t123\t0\r\n",
        "k61_2058\t266\t15\t0\r\n",
        "k61_2059\t1007\t107\t0\r\n",
        "k61_2061\t892\t87\t0\r\n",
        "k61_2062\t281\t21\t0\r\n",
        "k61_2063\t375\t30\t0\r\n",
        "k61_2064\t390\t17\t0\r\n",
        "k61_2065\t212\t7\t0\r\n",
        "k61_2066\t262\t18\t0\r\n",
        "k61_2067\t421\t32\t0\r\n",
        "k61_2068\t219\t15\t0\r\n",
        "k61_2069\t228\t11\t0\r\n",
        "k61_2070\t311\t32\t0\r\n",
        "k61_2071\t317\t25\t0\r\n",
        "k61_2072\t237\t24\t0\r\n",
        "k61_2073\t414\t50\t0\r\n",
        "k61_2075\t237\t14\t0\r\n",
        "k61_2077\t209\t12\t0\r\n",
        "k61_2078\t458\t46\t0\r\n",
        "k61_2079\t1498\t136\t0\r\n",
        "k61_2080\t354\t34\t0\r\n",
        "k61_2081\t861\t61\t0\r\n",
        "k61_2082\t380\t19\t0\r\n",
        "k61_2083\t260\t7\t0\r\n",
        "k61_2085\t412\t38\t0\r\n",
        "k61_2086\t535\t36\t0\r\n",
        "k61_2087\t1276\t118\t0\r\n",
        "k61_2088\t539\t49\t0\r\n",
        "k61_2090\t669\t55\t0\r\n",
        "k61_2091\t361\t26\t0\r\n",
        "k61_2092\t257\t33\t0\r\n",
        "k61_2093\t284\t33\t0\r\n",
        "k61_2094\t405\t23\t0\r\n",
        "k61_2096\t315\t13\t0\r\n",
        "k61_2097\t294\t23\t0\r\n",
        "k61_2098\t417\t20\t0\r\n",
        "k61_2099\t204\t11\t0\r\n",
        "k61_2100\t304\t29\t0\r\n",
        "k61_2101\t483\t36\t0\r\n",
        "k61_2102\t523\t38\t0\r\n",
        "k61_2103\t680\t47\t0\r\n",
        "k61_2104\t503\t37\t0\r\n",
        "k61_2105\t213\t5\t0\r\n",
        "k61_2106\t314\t22\t0\r\n",
        "k61_2107\t414\t25\t0\r\n",
        "k61_2108\t296\t39\t0\r\n",
        "k61_2109\t396\t30\t0\r\n",
        "k61_2110\t740\t67\t0\r\n",
        "k61_2111\t292\t13\t0\r\n",
        "k61_2112\t452\t37\t0\r\n",
        "k61_2113\t371\t32\t0\r\n",
        "k61_2114\t289\t13\t0\r\n",
        "k61_2115\t560\t55\t0\r\n",
        "k61_2117\t224\t13\t0\r\n",
        "k61_2118\t226\t15\t0\r\n",
        "k61_2119\t1458\t140\t0\r\n",
        "k61_2120\t364\t27\t0\r\n",
        "k61_2121\t205\t5\t0\r\n",
        "k61_2122\t234\t20\t0\r\n",
        "k61_2123\t265\t10\t0\r\n",
        "k61_2125\t1070\t75\t0\r\n",
        "k61_2126\t237\t10\t0\r\n",
        "k61_2127\t405\t35\t0\r\n",
        "k61_2128\t581\t53\t0\r\n",
        "k61_2129\t383\t30\t0\r\n",
        "k61_2130\t319\t26\t0\r\n",
        "k61_2131\t214\t8\t0\r\n",
        "k61_2132\t404\t21\t0\r\n",
        "k61_2133\t266\t24\t0\r\n",
        "k61_2134\t540\t50\t0\r\n",
        "k61_2135\t467\t42\t0\r\n",
        "k61_2136\t324\t19\t0\r\n",
        "k61_2137\t715\t55\t0\r\n",
        "k61_2138\t340\t27\t0\r\n",
        "k61_2139\t1072\t106\t0\r\n",
        "k61_2140\t454\t27\t0\r\n",
        "k61_2141\t514\t37\t0\r\n",
        "k61_2142\t328\t26\t0\r\n",
        "k61_2143\t216\t11\t0\r\n",
        "k61_2144\t330\t18\t0\r\n",
        "k61_2146\t611\t56\t0\r\n",
        "k61_2147\t215\t15\t0\r\n",
        "k61_2148\t251\t16\t0\r\n",
        "k61_2149\t381\t20\t0\r\n",
        "k61_2150\t233\t7\t0\r\n",
        "k61_2151\t201\t8\t0\r\n",
        "k61_2152\t217\t7\t0\r\n",
        "k61_2153\t796\t290\t0\r\n",
        "k61_2154\t824\t74\t0\r\n",
        "k61_2156\t506\t39\t0\r\n",
        "k61_2157\t487\t36\t0\r\n",
        "k61_2158\t817\t86\t0\r\n",
        "k61_2159\t296\t20\t0\r\n",
        "k61_2160\t410\t33\t0\r\n",
        "k61_2161\t226\t21\t0\r\n",
        "k61_2162\t768\t69\t0\r\n",
        "k61_2163\t202\t22\t0\r\n",
        "k61_2166\t769\t67\t0\r\n",
        "k61_2167\t364\t22\t0\r\n",
        "k61_2168\t215\t10\t0\r\n",
        "k61_2169\t331\t14\t0\r\n",
        "k61_2171\t915\t82\t0\r\n",
        "k61_2172\t211\t15\t0\r\n",
        "k61_2173\t1597\t148\t0\r\n",
        "k61_2174\t760\t52\t0\r\n",
        "k61_2176\t218\t20\t0\r\n",
        "k61_2177\t303\t34\t0\r\n",
        "k61_2179\t314\t11\t0\r\n",
        "k61_2180\t421\t40\t0\r\n",
        "k61_2181\t511\t23\t0\r\n",
        "k61_2182\t508\t36\t0\r\n",
        "k61_2183\t259\t12\t0\r\n",
        "k61_2184\t1060\t105\t0\r\n",
        "k61_2185\t321\t18\t0\r\n",
        "k61_2186\t277\t14\t0\r\n",
        "k61_2187\t321\t14\t0\r\n",
        "k61_2188\t556\t45\t0\r\n",
        "k61_2189\t313\t11\t0\r\n",
        "k61_2190\t1376\t137\t0\r\n",
        "k61_2191\t655\t69\t0\r\n",
        "k61_2192\t275\t26\t0\r\n",
        "k61_2193\t268\t17\t0\r\n",
        "k61_2194\t211\t8\t0\r\n",
        "k61_2195\t202\t5\t0\r\n",
        "k61_2196\t573\t46\t0\r\n",
        "k61_2197\t342\t16\t0\r\n",
        "k61_2198\t336\t26\t0\r\n",
        "k61_2199\t634\t48\t0\r\n",
        "k61_2200\t431\t28\t0\r\n",
        "k61_2201\t296\t14\t0\r\n",
        "k61_2202\t287\t19\t0\r\n",
        "k61_2204\t203\t7\t0\r\n",
        "k61_2205\t280\t17\t0\r\n",
        "k61_2206\t894\t104\t0\r\n",
        "k61_2207\t556\t66\t0\r\n",
        "k61_2208\t655\t58\t0\r\n",
        "k61_2209\t309\t26\t0\r\n",
        "k61_2211\t259\t21\t0\r\n",
        "k61_2212\t509\t58\t0\r\n",
        "k61_2213\t323\t30\t0\r\n",
        "k61_2214\t327\t25\t0\r\n",
        "k61_2215\t1137\t119\t0\r\n",
        "k61_2216\t840\t67\t0\r\n",
        "k61_2217\t257\t19\t0\r\n",
        "k61_2218\t241\t15\t0\r\n",
        "k61_2219\t275\t13\t0\r\n",
        "k61_2220\t284\t34\t0\r\n",
        "k61_2221\t811\t79\t0\r\n",
        "k61_2222\t380\t47\t0\r\n",
        "k61_2223\t666\t71\t0\r\n",
        "k61_2224\t248\t9\t0\r\n",
        "k61_2225\t205\t6\t0\r\n",
        "k61_2226\t264\t22\t0\r\n",
        "k61_2227\t321\t30\t0\r\n",
        "k61_2228\t234\t6\t0\r\n",
        "k61_2229\t227\t113\t0\r\n",
        "k61_2230\t202\t9\t0\r\n",
        "k61_2231\t215\t18\t0\r\n",
        "k61_2232\t263\t15\t0\r\n",
        "k61_2233\t889\t82\t0\r\n",
        "k61_2234\t296\t16\t0\r\n",
        "k61_2235\t625\t59\t0\r\n",
        "k61_2237\t219\t9\t0\r\n",
        "k61_2238\t356\t22\t0\r\n",
        "k61_2239\t437\t46\t0\r\n",
        "k61_2240\t276\t14\t0\r\n",
        "k61_2241\t428\t38\t0\r\n",
        "k61_2242\t285\t18\t0\r\n",
        "k61_2243\t523\t36\t0\r\n",
        "k61_2245\t210\t9\t0\r\n",
        "k61_2246\t584\t25\t0\r\n",
        "k61_2247\t314\t14\t0\r\n",
        "k61_2248\t397\t39\t0\r\n",
        "k61_2249\t229\t14\t0\r\n",
        "k61_2250\t508\t46\t0\r\n",
        "k61_2252\t378\t46\t0\r\n",
        "k61_2254\t772\t68\t0\r\n",
        "k61_2255\t272\t14\t0\r\n",
        "k61_2258\t229\t15\t0\r\n",
        "k61_2259\t279\t26\t0\r\n",
        "k61_2260\t1165\t96\t0\r\n",
        "k61_2261\t328\t27\t0\r\n",
        "k61_2262\t342\t14\t0\r\n",
        "k61_2263\t377\t32\t0\r\n",
        "k61_2265\t279\t13\t0\r\n",
        "k61_2267\t265\t19\t0\r\n",
        "k61_2268\t649\t56\t0\r\n",
        "k61_2269\t644\t57\t0\r\n",
        "k61_2270\t328\t17\t0\r\n",
        "k61_2272\t416\t30\t0\r\n",
        "k61_2274\t227\t25\t0\r\n",
        "k61_2275\t256\t5\t0\r\n",
        "k61_2276\t236\t11\t0\r\n",
        "k61_2277\t574\t49\t0\r\n",
        "k61_2278\t898\t65\t0\r\n",
        "k61_2279\t1403\t148\t0\r\n",
        "k61_2280\t625\t55\t0\r\n",
        "k61_2281\t228\t10\t0\r\n",
        "k61_2282\t245\t12\t0\r\n",
        "k61_2283\t458\t43\t0\r\n",
        "k61_2284\t263\t16\t0\r\n",
        "k61_2285\t256\t15\t0\r\n",
        "k61_2287\t466\t43\t0\r\n",
        "k61_2288\t862\t81\t0\r\n",
        "k61_2289\t208\t13\t0\r\n",
        "k61_2290\t449\t47\t0\r\n",
        "k61_2292\t600\t49\t0\r\n",
        "k61_2293\t584\t63\t0\r\n",
        "k61_2294\t233\t20\t0\r\n",
        "k61_2295\t835\t69\t0\r\n",
        "k61_2296\t567\t44\t0\r\n",
        "k61_2297\t576\t24\t0\r\n",
        "k61_2298\t549\t27\t0\r\n",
        "k61_2299\t562\t46\t0\r\n",
        "k61_2300\t815\t68\t0\r\n",
        "k61_2301\t375\t14\t0\r\n",
        "k61_2302\t215\t25\t0\r\n",
        "k61_2303\t213\t7\t0\r\n",
        "k61_2304\t214\t7\t0\r\n",
        "k61_2305\t328\t27\t0\r\n",
        "k61_2307\t1741\t150\t0\r\n",
        "k61_2308\t341\t31\t0\r\n",
        "k61_2309\t523\t56\t0\r\n",
        "k61_2310\t355\t34\t0\r\n",
        "k61_2311\t211\t16\t0\r\n",
        "k61_2312\t240\t21\t0\r\n",
        "k61_2313\t264\t12\t0\r\n",
        "k61_2314\t294\t20\t0\r\n",
        "k61_2315\t866\t72\t0\r\n",
        "k61_2316\t4214\t735\t0\r\n",
        "k61_2317\t283\t19\t0\r\n",
        "k61_2318\t456\t48\t0\r\n",
        "k61_2319\t1013\t86\t0\r\n",
        "k61_2320\t234\t12\t0\r\n",
        "k61_2321\t366\t32\t0\r\n",
        "k61_2324\t392\t26\t0\r\n",
        "k61_2325\t334\t23\t0\r\n",
        "k61_2326\t611\t59\t0\r\n",
        "k61_2327\t456\t43\t0\r\n",
        "k61_2328\t424\t23\t0\r\n",
        "k61_2329\t635\t52\t0\r\n",
        "k61_2330\t411\t36\t0\r\n",
        "k61_2331\t437\t29\t0\r\n",
        "k61_2332\t765\t71\t0\r\n",
        "k61_2334\t279\t17\t0\r\n",
        "k61_2336\t426\t39\t0\r\n",
        "k61_2337\t379\t26\t0\r\n",
        "k61_2338\t357\t23\t0\r\n",
        "k61_2339\t382\t22\t0\r\n",
        "k61_2340\t243\t16\t0\r\n",
        "k61_2341\t424\t41\t0\r\n",
        "k61_2342\t670\t54\t0\r\n",
        "k61_2343\t532\t67\t0\r\n",
        "k61_2344\t348\t36\t0\r\n",
        "k61_2347\t212\t13\t0\r\n",
        "k61_2348\t598\t46\t0\r\n",
        "k61_2349\t768\t66\t0\r\n",
        "k61_2351\t463\t48\t0\r\n",
        "k61_2352\t930\t110\t0\r\n",
        "k61_2353\t789\t48\t0\r\n",
        "k61_2354\t233\t12\t0\r\n",
        "k61_2355\t537\t52\t0\r\n",
        "k61_2356\t207\t18\t0\r\n",
        "k61_2357\t628\t63\t0\r\n",
        "k61_2358\t210\t19\t0\r\n",
        "k61_2359\t209\t9\t0\r\n",
        "k61_2360\t234\t23\t0\r\n",
        "k61_2361\t250\t14\t0\r\n",
        "k61_2362\t615\t65\t0\r\n",
        "k61_2363\t258\t23\t0\r\n",
        "k61_2365\t310\t23\t0\r\n",
        "k61_2366\t211\t7\t0\r\n",
        "k61_2367\t274\t21\t0\r\n",
        "k61_2368\t376\t30\t0\r\n",
        "k61_2369\t344\t18\t0\r\n",
        "k61_2370\t298\t17\t0\r\n",
        "k61_2371\t341\t36\t0\r\n",
        "k61_2372\t451\t48\t0\r\n",
        "k61_2373\t274\t32\t0\r\n",
        "k61_2374\t300\t20\t0\r\n",
        "k61_2377\t209\t12\t0\r\n",
        "k61_2378\t323\t16\t0\r\n",
        "k61_2379\t200\t7\t0\r\n",
        "k61_2380\t243\t13\t0\r\n",
        "k61_2381\t252\t14\t0\r\n",
        "k61_2383\t572\t42\t0\r\n",
        "k61_2384\t338\t23\t0\r\n",
        "k61_2385\t315\t40\t0\r\n",
        "k61_2386\t326\t19\t0\r\n",
        "k61_2387\t802\t71\t0\r\n",
        "k61_2388\t285\t14\t0\r\n",
        "k61_2389\t699\t43\t0\r\n",
        "k61_2390\t371\t38\t0\r\n",
        "k61_2391\t277\t20\t0\r\n",
        "k61_2392\t368\t22\t0\r\n",
        "k61_2394\t217\t11\t0\r\n",
        "k61_2395\t928\t68\t0\r\n",
        "k61_2397\t206\t18\t0\r\n",
        "k61_2398\t242\t18\t0\r\n",
        "k61_2399\t554\t41\t0\r\n",
        "k61_2400\t569\t53\t0\r\n",
        "k61_2401\t263\t11\t0\r\n",
        "k61_2402\t379\t18\t0\r\n",
        "k61_2403\t264\t28\t0\r\n",
        "k61_2404\t215\t10\t0\r\n",
        "k61_2405\t1032\t92\t0\r\n",
        "k61_2406\t362\t22\t0\r\n",
        "k61_2407\t240\t9\t0\r\n",
        "k61_2408\t374\t26\t0\r\n",
        "k61_2409\t248\t13\t0\r\n",
        "k61_2410\t1279\t122\t0\r\n",
        "k61_2411\t250\t11\t0\r\n",
        "k61_2412\t368\t312\t0\r\n",
        "k61_2413\t730\t71\t0\r\n",
        "k61_2414\t230\t10\t0\r\n",
        "k61_2415\t1065\t103\t0\r\n",
        "k61_2416\t223\t16\t0\r\n",
        "k61_2417\t420\t29\t0\r\n",
        "k61_2418\t431\t28\t0\r\n",
        "k61_2419\t205\t7\t0\r\n",
        "k61_2420\t253\t27\t0\r\n",
        "k61_2421\t829\t66\t0\r\n",
        "k61_2422\t283\t24\t0\r\n",
        "k61_2424\t297\t16\t0\r\n",
        "k61_2425\t311\t28\t0\r\n",
        "k61_2427\t458\t33\t0\r\n",
        "k61_2428\t652\t41\t0\r\n",
        "k61_2429\t623\t37\t0\r\n",
        "k61_2430\t270\t21\t0\r\n",
        "k61_2431\t480\t34\t0\r\n",
        "k61_2433\t218\t13\t0\r\n",
        "k61_2434\t721\t56\t0\r\n",
        "k61_2435\t698\t54\t0\r\n",
        "k61_2436\t270\t19\t0\r\n",
        "k61_2437\t476\t25\t0\r\n",
        "k61_2438\t340\t24\t0\r\n",
        "k61_2439\t281\t10\t0\r\n",
        "k61_2440\t326\t15\t0\r\n",
        "k61_2441\t297\t9\t0\r\n",
        "k61_2442\t301\t16\t0\r\n",
        "k61_2443\t338\t29\t0\r\n",
        "k61_2444\t351\t23\t0\r\n",
        "k61_2445\t284\t34\t0\r\n",
        "k61_2447\t1642\t973\t0\r\n",
        "k61_2448\t466\t44\t0\r\n",
        "k61_2449\t216\t7\t0\r\n",
        "k61_2450\t282\t20\t0\r\n",
        "k61_2451\t202\t15\t0\r\n",
        "k61_2453\t311\t30\t0\r\n",
        "k61_2454\t313\t13\t0\r\n",
        "k61_2455\t370\t19\t0\r\n",
        "k61_2456\t271\t17\t0\r\n",
        "k61_2457\t399\t26\t0\r\n",
        "k61_2458\t246\t12\t0\r\n",
        "k61_2459\t689\t58\t0\r\n",
        "k61_2460\t543\t59\t0\r\n",
        "k61_2461\t475\t20\t0\r\n",
        "k61_2462\t632\t44\t0\r\n",
        "k61_2463\t562\t36\t0\r\n",
        "k61_2464\t762\t59\t0\r\n",
        "k61_2465\t429\t37\t0\r\n",
        "k61_2467\t958\t96\t0\r\n",
        "k61_2468\t427\t37\t0\r\n",
        "k61_2470\t289\t20\t0\r\n",
        "k61_2471\t362\t39\t0\r\n",
        "k61_2472\t306\t13\t0\r\n",
        "k61_2473\t216\t22\t0\r\n",
        "k61_2474\t587\t51\t0\r\n",
        "k61_2475\t828\t74\t0\r\n",
        "k61_2476\t618\t74\t0\r\n",
        "k61_2477\t497\t37\t0\r\n",
        "k61_2478\t279\t8\t0\r\n",
        "k61_2479\t871\t84\t0\r\n",
        "k61_2480\t256\t11\t0\r\n",
        "k61_2481\t691\t58\t0\r\n",
        "k61_2482\t355\t20\t0\r\n",
        "k61_2483\t232\t7\t0\r\n",
        "k61_2484\t1457\t144\t0\r\n",
        "k61_2485\t487\t49\t0\r\n",
        "k61_2486\t236\t11\t0\r\n",
        "k61_2487\t293\t21\t0\r\n",
        "k61_2488\t286\t18\t0\r\n",
        "k61_2489\t1762\t243\t0\r\n",
        "k61_2490\t277\t16\t0\r\n",
        "k61_2491\t317\t31\t0\r\n",
        "k61_2492\t209\t11\t0\r\n",
        "k61_2493\t368\t36\t0\r\n",
        "k61_2494\t373\t31\t0\r\n",
        "k61_2495\t243\t11\t0\r\n",
        "k61_2497\t205\t7\t0\r\n",
        "k61_2498\t385\t30\t0\r\n",
        "k61_2499\t650\t32\t0\r\n",
        "k61_2500\t214\t10\t0\r\n",
        "k61_2501\t346\t19\t0\r\n",
        "k61_2502\t443\t26\t0\r\n",
        "k61_2503\t530\t35\t0\r\n",
        "k61_2504\t414\t33\t0\r\n",
        "k61_2505\t1342\t135\t0\r\n",
        "k61_2507\t773\t57\t0\r\n",
        "k61_2508\t237\t17\t0\r\n",
        "k61_2509\t382\t33\t0\r\n",
        "k61_2510\t546\t54\t0\r\n",
        "k61_2511\t221\t16\t0\r\n",
        "k61_2512\t900\t82\t0\r\n",
        "k61_2513\t210\t15\t0\r\n",
        "k61_2514\t395\t24\t0\r\n",
        "k61_2515\t342\t25\t0\r\n",
        "k61_2516\t324\t11\t0\r\n",
        "k61_2517\t292\t7\t0\r\n",
        "k61_2518\t325\t29\t0\r\n",
        "k61_2519\t208\t10\t0\r\n",
        "k61_2520\t300\t14\t0\r\n",
        "k61_2521\t281\t28\t0\r\n",
        "k61_2522\t391\t23\t0\r\n",
        "k61_2523\t329\t23\t0\r\n",
        "k61_2524\t226\t13\t0\r\n",
        "k61_2525\t204\t24\t0\r\n",
        "k61_2527\t314\t17\t0\r\n",
        "k61_2528\t240\t9\t0\r\n",
        "k61_2529\t354\t19\t0\r\n",
        "k61_2531\t366\t19\t0\r\n",
        "k61_2532\t486\t29\t0\r\n",
        "k61_2533\t313\t21\t0\r\n",
        "k61_2534\t213\t10\t0\r\n",
        "k61_2536\t210\t10\t0\r\n",
        "k61_2537\t295\t22\t0\r\n",
        "k61_2539\t317\t16\t0\r\n",
        "k61_2541\t1282\t119\t0\r\n",
        "k61_2542\t281\t17\t0\r\n",
        "k61_2543\t3183\t334\t0\r\n",
        "k61_2544\t417\t29\t0\r\n",
        "k61_2545\t301\t12\t0\r\n",
        "k61_2547\t397\t22\t0\r\n",
        "k61_2548\t352\t26\t0\r\n",
        "k61_2549\t1353\t154\t0\r\n",
        "k61_2551\t211\t14\t0\r\n",
        "k61_2552\t694\t57\t0\r\n",
        "k61_2553\t280\t16\t0\r\n",
        "k61_2555\t345\t21\t0\r\n",
        "k61_2556\t366\t22\t0\r\n",
        "k61_2557\t215\t12\t0\r\n",
        "k61_2558\t710\t80\t0\r\n",
        "k61_2559\t285\t15\t0\r\n",
        "k61_2560\t209\t18\t0\r\n",
        "k61_2561\t285\t21\t0\r\n",
        "k61_2562\t564\t45\t0\r\n",
        "k61_2563\t1079\t103\t0\r\n",
        "k61_2564\t936\t105\t0\r\n",
        "k61_2565\t207\t20\t0\r\n",
        "k61_2566\t384\t24\t0\r\n",
        "k61_2567\t629\t54\t0\r\n",
        "k61_2568\t1045\t134\t0\r\n",
        "k61_2569\t543\t54\t0\r\n",
        "k61_2570\t1632\t130\t0\r\n",
        "k61_2571\t275\t17\t0\r\n",
        "k61_2572\t322\t26\t0\r\n",
        "k61_2573\t498\t44\t0\r\n",
        "k61_2574\t200\t14\t0\r\n",
        "k61_2575\t287\t22\t0\r\n",
        "k61_2576\t343\t24\t0\r\n",
        "k61_2577\t903\t94\t0\r\n",
        "k61_2579\t1136\t127\t0\r\n",
        "k61_2580\t1305\t91\t0\r\n",
        "k61_2581\t340\t15\t0\r\n",
        "k61_2582\t990\t77\t0\r\n",
        "k61_2583\t308\t24\t0\r\n",
        "k61_2584\t269\t19\t0\r\n",
        "k61_2585\t458\t47\t0\r\n",
        "k61_2586\t363\t37\t0\r\n",
        "k61_2587\t773\t74\t0\r\n",
        "k61_2588\t1006\t72\t0\r\n",
        "k61_2589\t436\t38\t0\r\n",
        "k61_2590\t205\t12\t0\r\n",
        "k61_2591\t914\t88\t0\r\n",
        "k61_2592\t437\t31\t0\r\n",
        "k61_2594\t596\t43\t0\r\n",
        "k61_2595\t322\t26\t0\r\n",
        "k61_2596\t280\t17\t0\r\n",
        "k61_2597\t488\t29\t0\r\n",
        "k61_2599\t848\t51\t0\r\n",
        "k61_2600\t314\t27\t0\r\n",
        "k61_2601\t218\t14\t0\r\n",
        "k61_2602\t2028\t197\t0\r\n",
        "k61_2603\t698\t60\t0\r\n",
        "k61_2604\t646\t67\t0\r\n",
        "k61_2605\t562\t61\t0\r\n",
        "k61_2606\t555\t50\t0\r\n",
        "k61_2607\t501\t16\t0\r\n",
        "k61_2608\t282\t30\t0\r\n",
        "k61_2609\t486\t34\t0\r\n",
        "k61_2610\t241\t9\t0\r\n",
        "k61_2611\t268\t17\t0\r\n",
        "k61_2612\t800\t59\t0\r\n",
        "k61_2613\t378\t27\t0\r\n",
        "k61_2614\t566\t48\t0\r\n",
        "k61_2615\t1463\t138\t0\r\n",
        "k61_2616\t593\t56\t0\r\n",
        "k61_2617\t324\t23\t0\r\n",
        "k61_2618\t420\t34\t0\r\n",
        "k61_2619\t924\t85\t0\r\n",
        "k61_2620\t338\t22\t0\r\n",
        "k61_2621\t540\t37\t0\r\n",
        "k61_2622\t277\t15\t0\r\n",
        "k61_2623\t445\t37\t0\r\n",
        "k61_2624\t360\t11\t0\r\n",
        "k61_2625\t404\t41\t0\r\n",
        "k61_2626\t678\t55\t0\r\n",
        "k61_2627\t205\t4\t0\r\n",
        "k61_2628\t503\t46\t0\r\n",
        "k61_2629\t222\t17\t0\r\n",
        "k61_2630\t220\t17\t0\r\n",
        "k61_2631\t656\t75\t0\r\n",
        "k61_2632\t769\t72\t0\r\n",
        "k61_2633\t218\t23\t0\r\n",
        "k61_2634\t436\t24\t0\r\n",
        "k61_2635\t483\t40\t0\r\n",
        "k61_2636\t243\t14\t0\r\n",
        "k61_2637\t217\t9\t0\r\n",
        "k61_2638\t513\t56\t0\r\n",
        "k61_2639\t233\t15\t0\r\n",
        "k61_2641\t221\t13\t0\r\n",
        "k61_2643\t240\t11\t0\r\n",
        "k61_2645\t355\t40\t0\r\n",
        "k61_2646\t950\t105\t0\r\n",
        "k61_2647\t874\t73\t0\r\n",
        "k61_2648\t242\t15\t0\r\n",
        "k61_2649\t610\t60\t0\r\n",
        "k61_2652\t1073\t69\t0\r\n",
        "k61_2653\t211\t15\t0\r\n",
        "k61_2654\t321\t24\t0\r\n",
        "k61_2655\t284\t14\t0\r\n",
        "k61_2656\t270\t24\t0\r\n",
        "k61_2657\t271\t13\t0\r\n",
        "k61_2658\t301\t21\t0\r\n",
        "k61_2659\t582\t55\t0\r\n",
        "k61_2660\t454\t49\t0\r\n",
        "k61_2661\t516\t47\t0\r\n",
        "k61_2662\t434\t35\t0\r\n",
        "k61_2663\t349\t18\t0\r\n",
        "k61_2664\t363\t20\t0\r\n",
        "k61_2665\t360\t13\t0\r\n",
        "k61_2666\t335\t21\t0\r\n",
        "k61_2667\t373\t25\t0\r\n",
        "k61_2668\t256\t13\t0\r\n",
        "k61_2669\t232\t8\t0\r\n",
        "k61_2670\t235\t10\t0\r\n",
        "k61_2671\t439\t25\t0\r\n",
        "k61_2672\t439\t49\t0\r\n",
        "k61_2673\t392\t30\t0\r\n",
        "k61_2674\t349\t34\t0\r\n",
        "k61_2675\t1007\t109\t0\r\n",
        "k61_2676\t228\t14\t0\r\n",
        "k61_2677\t292\t19\t0\r\n",
        "k61_2678\t217\t10\t0\r\n",
        "k61_2679\t388\t28\t0\r\n",
        "k61_2680\t783\t69\t0\r\n",
        "k61_2681\t237\t12\t0\r\n",
        "k61_2682\t371\t32\t0\r\n",
        "k61_2683\t1217\t116\t0\r\n",
        "k61_2684\t245\t22\t0\r\n",
        "k61_2685\t434\t31\t0\r\n",
        "k61_2686\t873\t83\t0\r\n",
        "k61_2687\t308\t20\t0\r\n",
        "k61_2688\t329\t21\t0\r\n",
        "k61_2689\t266\t13\t0\r\n",
        "k61_2690\t344\t29\t0\r\n",
        "k61_2691\t317\t22\t0\r\n",
        "k61_2692\t715\t57\t0\r\n",
        "k61_2693\t206\t9\t0\r\n",
        "k61_2694\t211\t6\t0\r\n",
        "k61_2695\t404\t31\t0\r\n",
        "k61_2696\t363\t33\t0\r\n",
        "k61_2697\t278\t19\t0\r\n",
        "k61_2698\t265\t7\t0\r\n",
        "k61_2699\t614\t54\t0\r\n",
        "k61_2700\t217\t12\t0\r\n",
        "k61_2701\t1322\t120\t0\r\n",
        "k61_2702\t207\t9\t0\r\n",
        "k61_2703\t762\t66\t0\r\n",
        "k61_2705\t355\t18\t0\r\n",
        "k61_2706\t330\t15\t0\r\n",
        "k61_2707\t260\t14\t0\r\n",
        "k61_2708\t350\t18\t0\r\n",
        "k61_2709\t473\t36\t0\r\n",
        "k61_2711\t310\t26\t0\r\n",
        "k61_2712\t200\t12\t0\r\n",
        "k61_2713\t779\t70\t0\r\n",
        "k61_2714\t375\t24\t0\r\n",
        "k61_2715\t222\t10\t0\r\n",
        "k61_2716\t301\t18\t0\r\n",
        "k61_2717\t507\t54\t0\r\n",
        "k61_2718\t541\t50\t0\r\n",
        "k61_2719\t213\t16\t0\r\n",
        "k61_2720\t250\t19\t0\r\n",
        "k61_2721\t536\t44\t0\r\n",
        "k61_2722\t288\t13\t0\r\n",
        "k61_2723\t276\t20\t0\r\n",
        "k61_2724\t545\t36\t0\r\n",
        "k61_2725\t238\t6\t0\r\n",
        "k61_2726\t445\t51\t0\r\n",
        "k61_2727\t734\t64\t0\r\n",
        "k61_2728\t205\t7\t0\r\n",
        "k61_2729\t412\t19\t0\r\n",
        "k61_2730\t243\t12\t0\r\n",
        "k61_2731\t1410\t149\t0\r\n",
        "k61_2732\t356\t22\t0\r\n",
        "k61_2733\t342\t24\t0\r\n",
        "k61_2734\t214\t12\t0\r\n",
        "k61_2735\t649\t65\t0\r\n",
        "k61_2736\t868\t101\t0\r\n",
        "k61_2737\t357\t27\t0\r\n",
        "k61_2738\t255\t16\t0\r\n",
        "k61_2739\t398\t30\t0\r\n",
        "k61_2740\t536\t49\t0\r\n",
        "k61_2741\t246\t11\t0\r\n",
        "k61_2742\t566\t35\t0\r\n",
        "k61_2743\t265\t17\t0\r\n",
        "k61_2744\t405\t25\t0\r\n",
        "k61_2745\t988\t92\t0\r\n",
        "k61_2746\t400\t35\t0\r\n",
        "k61_2747\t400\t42\t0\r\n",
        "k61_2748\t537\t25\t0\r\n",
        "k61_2749\t381\t28\t0\r\n",
        "k61_2750\t239\t14\t0\r\n",
        "k61_2751\t260\t16\t0\r\n",
        "k61_2752\t225\t19\t0\r\n",
        "k61_2753\t290\t39\t0\r\n",
        "k61_2755\t513\t53\t0\r\n",
        "k61_2756\t211\t10\t0\r\n",
        "k61_2757\t503\t43\t0\r\n",
        "k61_2758\t260\t12\t0\r\n",
        "k61_2759\t632\t46\t0\r\n",
        "k61_2760\t688\t56\t0\r\n",
        "k61_2761\t282\t26\t0\r\n",
        "k61_2762\t246\t7\t0\r\n",
        "k61_2764\t294\t16\t0\r\n",
        "k61_2766\t349\t24\t0\r\n",
        "k61_2767\t297\t21\t0\r\n",
        "k61_2768\t402\t39\t0\r\n",
        "k61_2769\t717\t71\t0\r\n",
        "k61_2770\t272\t21\t0\r\n",
        "k61_2771\t242\t12\t0\r\n",
        "k61_2772\t459\t35\t0\r\n",
        "k61_2773\t245\t12\t0\r\n",
        "k61_2774\t664\t31\t0\r\n",
        "k61_2775\t651\t43\t0\r\n",
        "k61_2776\t203\t17\t0\r\n",
        "k61_2778\t396\t50\t0\r\n",
        "k61_2779\t208\t9\t0\r\n",
        "k61_2780\t608\t71\t0\r\n",
        "k61_2781\t255\t20\t0\r\n",
        "k61_2782\t300\t20\t0\r\n",
        "k61_2783\t536\t43\t0\r\n",
        "k61_2784\t775\t74\t0\r\n",
        "k61_2785\t209\t22\t0\r\n",
        "k61_2786\t221\t12\t0\r\n",
        "k61_2787\t579\t59\t0\r\n",
        "k61_2788\t390\t23\t0\r\n",
        "k61_2789\t258\t11\t0\r\n",
        "k61_2790\t260\t16\t0\r\n",
        "k61_2791\t329\t32\t0\r\n",
        "k61_2792\t308\t17\t0\r\n",
        "k61_2793\t246\t13\t0\r\n",
        "k61_2795\t292\t21\t0\r\n",
        "k61_2798\t422\t29\t0\r\n",
        "k61_2799\t293\t25\t0\r\n",
        "k61_2800\t220\t9\t0\r\n",
        "k61_2801\t290\t18\t0\r\n",
        "k61_2802\t439\t37\t0\r\n",
        "k61_2803\t1074\t117\t0\r\n",
        "k61_2804\t423\t32\t0\r\n",
        "k61_2806\t275\t20\t0\r\n",
        "k61_2807\t493\t51\t0\r\n",
        "k61_2808\t212\t11\t0\r\n",
        "k61_2809\t202\t12\t0\r\n",
        "k61_2810\t677\t79\t0\r\n",
        "k61_2811\t246\t11\t0\r\n",
        "k61_2812\t206\t7\t0\r\n",
        "k61_2813\t678\t43\t0\r\n",
        "k61_2814\t245\t13\t0\r\n",
        "k61_2815\t393\t33\t0\r\n",
        "k61_2816\t219\t8\t0\r\n",
        "k61_2817\t246\t14\t0\r\n",
        "k61_2818\t446\t25\t0\r\n",
        "k61_2819\t215\t14\t0\r\n",
        "k61_2820\t373\t25\t0\r\n",
        "k61_2821\t363\t14\t0\r\n",
        "k61_2822\t201\t17\t0\r\n",
        "k61_2825\t371\t25\t0\r\n",
        "k61_2827\t793\t79\t0\r\n",
        "k61_2828\t364\t26\t0\r\n",
        "k61_2829\t457\t24\t0\r\n",
        "k61_2830\t401\t28\t0\r\n",
        "k61_2831\t396\t31\t0\r\n",
        "k61_2832\t324\t38\t0\r\n",
        "k61_2833\t853\t77\t0\r\n",
        "k61_2834\t215\t17\t0\r\n",
        "k61_2835\t243\t15\t0\r\n",
        "k61_2836\t301\t22\t0\r\n",
        "k61_2837\t356\t30\t0\r\n",
        "k61_2838\t216\t11\t0\r\n",
        "k61_2839\t344\t33\t0\r\n",
        "k61_2840\t486\t48\t0\r\n",
        "k61_2841\t537\t43\t0\r\n",
        "k61_2842\t278\t11\t0\r\n",
        "k61_2843\t456\t35\t0\r\n",
        "k61_2844\t346\t26\t0\r\n",
        "k61_2846\t590\t49\t0\r\n",
        "k61_2847\t245\t8\t0\r\n",
        "k61_2848\t246\t12\t0\r\n",
        "k61_2849\t305\t25\t0\r\n",
        "k61_2852\t337\t17\t0\r\n",
        "k61_2853\t227\t16\t0\r\n",
        "k61_2855\t202\t12\t0\r\n",
        "k61_2856\t284\t17\t0\r\n",
        "k61_2857\t645\t62\t0\r\n",
        "k61_2858\t317\t25\t0\r\n",
        "k61_2859\t283\t14\t0\r\n",
        "k61_2860\t243\t11\t0\r\n",
        "k61_2861\t1704\t147\t0\r\n",
        "k61_2863\t221\t14\t0\r\n",
        "k61_2864\t436\t24\t0\r\n",
        "k61_2865\t238\t10\t0\r\n",
        "k61_2866\t229\t12\t0\r\n",
        "k61_2867\t344\t37\t0\r\n",
        "k61_2868\t204\t8\t0\r\n",
        "k61_2869\t215\t6\t0\r\n",
        "k61_2870\t399\t35\t0\r\n",
        "k61_2871\t426\t32\t0\r\n",
        "k61_2872\t403\t33\t0\r\n",
        "k61_2873\t203\t10\t0\r\n",
        "k61_2874\t622\t51\t0\r\n",
        "k61_2875\t304\t20\t0\r\n",
        "k61_2876\t437\t44\t0\r\n",
        "k61_2877\t372\t47\t0\r\n",
        "k61_2878\t709\t77\t0\r\n",
        "k61_2879\t374\t23\t0\r\n",
        "k61_2880\t330\t26\t0\r\n",
        "k61_2881\t317\t22\t0\r\n",
        "k61_2882\t465\t29\t0\r\n",
        "k61_2883\t299\t39\t0\r\n",
        "k61_2884\t240\t10\t0\r\n",
        "k61_2885\t237\t17\t0\r\n",
        "k61_2886\t877\t72\t0\r\n",
        "k61_2887\t523\t61\t0\r\n",
        "k61_2888\t452\t24\t0\r\n",
        "k61_2890\t870\t64\t0\r\n",
        "k61_2891\t237\t15\t0\r\n",
        "k61_2892\t235\t9\t0\r\n",
        "k61_2893\t408\t35\t0\r\n",
        "k61_2895\t389\t17\t0\r\n",
        "k61_2896\t284\t8\t0\r\n",
        "k61_2897\t201\t8\t0\r\n",
        "k61_2898\t337\t22\t0\r\n",
        "k61_2899\t285\t20\t0\r\n",
        "k61_2900\t220\t18\t0\r\n",
        "k61_2901\t965\t73\t0\r\n",
        "k61_2902\t769\t66\t0\r\n",
        "k61_2903\t666\t71\t0\r\n",
        "k61_2904\t439\t26\t0\r\n",
        "k61_2905\t598\t38\t0\r\n",
        "k61_2906\t287\t14\t0\r\n",
        "k61_2907\t232\t19\t0\r\n",
        "k61_2908\t380\t19\t0\r\n",
        "k61_2909\t262\t12\t0\r\n",
        "k61_2910\t244\t19\t0\r\n",
        "k61_2911\t444\t34\t0\r\n",
        "k61_2912\t343\t28\t0\r\n",
        "k61_2913\t206\t13\t0\r\n",
        "k61_2914\t296\t26\t0\r\n",
        "k61_2915\t415\t29\t0\r\n",
        "k61_2916\t215\t15\t0\r\n",
        "k61_2917\t221\t15\t0\r\n",
        "k61_2918\t203\t20\t0\r\n",
        "k61_2919\t268\t9\t0\r\n",
        "k61_2920\t258\t9\t0\r\n",
        "k61_2921\t325\t20\t0\r\n",
        "k61_2922\t481\t22\t0\r\n",
        "k61_2923\t291\t31\t0\r\n",
        "k61_2924\t401\t27\t0\r\n",
        "k61_2925\t1028\t93\t0\r\n",
        "k61_2926\t272\t16\t0\r\n",
        "k61_2927\t640\t69\t0\r\n",
        "k61_2929\t384\t32\t0\r\n",
        "k61_2930\t246\t15\t0\r\n",
        "k61_2931\t835\t91\t0\r\n",
        "k61_2932\t1013\t91\t0\r\n",
        "k61_2933\t431\t32\t0\r\n",
        "k61_2934\t1160\t99\t0\r\n",
        "k61_2935\t251\t12\t0\r\n",
        "k61_2936\t240\t28\t0\r\n",
        "k61_2937\t242\t9\t0\r\n",
        "k61_2938\t338\t29\t0\r\n",
        "k61_2939\t324\t22\t0\r\n",
        "k61_2940\t422\t34\t0\r\n",
        "k61_2941\t269\t24\t0\r\n",
        "k61_2942\t430\t30\t0\r\n",
        "k61_2943\t541\t32\t0\r\n",
        "k61_2944\t475\t47\t0\r\n",
        "k61_2945\t271\t10\t0\r\n",
        "k61_2946\t207\t8\t0\r\n",
        "k61_2947\t318\t27\t0\r\n",
        "k61_2948\t240\t16\t0\r\n",
        "k61_2949\t283\t10\t0\r\n",
        "k61_2950\t239\t22\t0\r\n",
        "k61_2951\t280\t8\t0\r\n",
        "k61_2952\t425\t33\t0\r\n",
        "k61_2953\t436\t41\t0\r\n",
        "k61_2954\t964\t82\t0\r\n",
        "k61_2955\t587\t52\t0\r\n",
        "k61_2956\t204\t8\t0\r\n",
        "k61_2957\t296\t17\t0\r\n",
        "k61_2958\t458\t43\t0\r\n",
        "k61_2959\t892\t81\t0\r\n",
        "k61_2960\t204\t13\t0\r\n",
        "k61_2963\t387\t29\t0\r\n",
        "k61_2964\t205\t5\t0\r\n",
        "k61_2965\t574\t38\t0\r\n",
        "k61_2966\t320\t19\t0\r\n",
        "k61_2967\t1175\t145\t0\r\n",
        "k61_2968\t352\t23\t0\r\n",
        "k61_2969\t573\t44\t0\r\n",
        "k61_2970\t690\t64\t0\r\n",
        "k61_2971\t229\t8\t0\r\n",
        "k61_2972\t431\t41\t0\r\n",
        "k61_2973\t640\t104\t0\r\n",
        "k61_2974\t210\t10\t0\r\n",
        "k61_2975\t397\t31\t0\r\n",
        "k61_2976\t267\t16\t0\r\n",
        "k61_2977\t268\t14\t0\r\n",
        "k61_2978\t217\t15\t0\r\n",
        "k61_2979\t220\t13\t0\r\n",
        "k61_2980\t576\t36\t0\r\n",
        "k61_2981\t347\t22\t0\r\n",
        "k61_2982\t295\t21\t0\r\n",
        "k61_2983\t262\t16\t0\r\n",
        "k61_2984\t200\t6\t0\r\n",
        "k61_2985\t578\t41\t0\r\n",
        "k61_2986\t232\t12\t0\r\n",
        "k61_2987\t274\t19\t0\r\n",
        "k61_2988\t217\t8\t0\r\n",
        "k61_2989\t270\t6\t0\r\n",
        "k61_2990\t1036\t102\t0\r\n",
        "k61_2991\t230\t17\t0\r\n",
        "k61_2993\t784\t56\t0\r\n",
        "k61_2994\t377\t40\t0\r\n",
        "k61_2995\t898\t73\t0\r\n",
        "k61_2996\t329\t24\t0\r\n",
        "k61_2997\t211\t16\t0\r\n",
        "k61_2998\t1116\t93\t0\r\n",
        "k61_2999\t416\t42\t0\r\n",
        "k61_3000\t211\t14\t0\r\n",
        "k61_3001\t331\t18\t0\r\n",
        "k61_3002\t3153\t350\t0\r\n",
        "k61_3003\t322\t15\t0\r\n",
        "k61_3004\t453\t29\t0\r\n",
        "k61_3005\t278\t12\t0\r\n",
        "k61_3006\t313\t14\t0\r\n",
        "k61_3007\t263\t19\t0\r\n",
        "k61_3008\t315\t17\t0\r\n",
        "k61_3009\t219\t20\t0\r\n",
        "k61_3010\t1049\t141\t0\r\n",
        "k61_3011\t456\t20\t0\r\n",
        "k61_3013\t234\t20\t0\r\n",
        "k61_3014\t242\t8\t0\r\n",
        "k61_3015\t250\t24\t0\r\n",
        "k61_3016\t235\t10\t0\r\n",
        "k61_3017\t559\t31\t0\r\n",
        "k61_3018\t387\t27\t0\r\n",
        "k61_3019\t884\t89\t0\r\n",
        "k61_3020\t307\t13\t0\r\n",
        "k61_3021\t620\t39\t0\r\n",
        "k61_3022\t464\t22\t0\r\n",
        "k61_3023\t728\t73\t0\r\n",
        "k61_3024\t1147\t95\t0\r\n",
        "k61_3026\t229\t8\t0\r\n",
        "k61_3027\t1008\t89\t0\r\n",
        "k61_3028\t271\t13\t0\r\n",
        "k61_3029\t429\t21\t0\r\n",
        "k61_3030\t304\t20\t0\r\n",
        "k61_3031\t1417\t118\t0\r\n",
        "k61_3032\t475\t17\t0\r\n",
        "k61_3033\t367\t33\t0\r\n",
        "k61_3034\t1891\t204\t0\r\n",
        "k61_3035\t226\t14\t0\r\n",
        "k61_3036\t222\t8\t0\r\n",
        "k61_3037\t254\t9\t0\r\n",
        "k61_3038\t598\t31\t0\r\n",
        "k61_3040\t210\t12\t0\r\n",
        "k61_3041\t672\t52\t0\r\n",
        "k61_3042\t201\t9\t0\r\n",
        "k61_3043\t407\t26\t0\r\n",
        "k61_3044\t747\t70\t0\r\n",
        "k61_3045\t865\t78\t0\r\n",
        "k61_3046\t271\t17\t0\r\n",
        "k61_3047\t304\t23\t0\r\n",
        "k61_3048\t516\t50\t0\r\n",
        "k61_3049\t240\t13\t0\r\n",
        "k61_3050\t794\t62\t0\r\n",
        "k61_3051\t503\t36\t0\r\n",
        "k61_3052\t1029\t94\t0\r\n",
        "k61_3053\t261\t28\t0\r\n",
        "k61_3054\t215\t9\t0\r\n",
        "k61_3055\t200\t8\t0\r\n",
        "k61_3056\t537\t48\t0\r\n",
        "k61_3057\t977\t124\t0\r\n",
        "k61_3059\t202\t10\t0\r\n",
        "k61_3060\t215\t14\t0\r\n",
        "k61_3061\t1323\t101\t0\r\n",
        "k61_3062\t577\t43\t0\r\n",
        "k61_3063\t281\t31\t0\r\n",
        "k61_3064\t462\t39\t0\r\n",
        "k61_3065\t240\t6\t0\r\n",
        "k61_3067\t295\t23\t0\r\n",
        "k61_3068\t367\t29\t0\r\n",
        "k61_3069\t209\t17\t0\r\n",
        "k61_3070\t310\t25\t0\r\n",
        "k61_3071\t502\t44\t0\r\n",
        "k61_3072\t489\t43\t0\r\n",
        "k61_3073\t262\t10\t0\r\n",
        "k61_3074\t1241\t111\t0\r\n",
        "k61_3075\t394\t33\t0\r\n",
        "k61_3076\t225\t12\t0\r\n",
        "k61_3077\t283\t21\t0\r\n",
        "k61_3078\t365\t39\t0\r\n",
        "k61_3079\t288\t10\t0\r\n",
        "k61_3080\t203\t6\t0\r\n",
        "k61_3082\t869\t88\t0\r\n",
        "k61_3083\t241\t11\t0\r\n",
        "k61_3084\t592\t43\t0\r\n",
        "k61_3085\t319\t17\t0\r\n",
        "k61_3086\t459\t59\t0\r\n",
        "k61_3087\t555\t41\t0\r\n",
        "k61_3088\t254\t22\t0\r\n",
        "k61_3089\t1015\t90\t0\r\n",
        "k61_3090\t248\t26\t0\r\n",
        "k61_3091\t316\t29\t0\r\n",
        "k61_3092\t333\t16\t0\r\n",
        "k61_3093\t226\t20\t0\r\n",
        "k61_3095\t827\t67\t0\r\n",
        "k61_3096\t469\t27\t0\r\n",
        "k61_3097\t240\t18\t0\r\n",
        "k61_3099\t396\t40\t0\r\n",
        "k61_3100\t519\t51\t0\r\n",
        "k61_3101\t327\t20\t0\r\n",
        "k61_3102\t237\t12\t0\r\n",
        "k61_3103\t3632\t3961\t0\r\n",
        "k61_3104\t251\t18\t0\r\n",
        "k61_3105\t507\t54\t0\r\n",
        "k61_3107\t276\t15\t0\r\n",
        "k61_3108\t239\t11\t0\r\n",
        "k61_3109\t202\t7\t0\r\n",
        "k61_3110\t253\t29\t0\r\n",
        "k61_3112\t260\t30\t0\r\n",
        "k61_3113\t224\t8\t0\r\n",
        "k61_3114\t476\t37\t0\r\n",
        "k61_3116\t213\t14\t0\r\n",
        "k61_3117\t386\t32\t0\r\n",
        "k61_3118\t421\t26\t0\r\n",
        "k61_3119\t271\t7\t0\r\n",
        "k61_3120\t247\t9\t0\r\n",
        "k61_3121\t638\t50\t0\r\n",
        "k61_3122\t318\t25\t0\r\n",
        "k61_3123\t222\t12\t0\r\n",
        "k61_3124\t303\t21\t0\r\n",
        "k61_3125\t664\t75\t0\r\n",
        "k61_3126\t287\t17\t0\r\n",
        "k61_3127\t234\t17\t0\r\n",
        "k61_3128\t286\t28\t0\r\n",
        "k61_3129\t288\t24\t0\r\n",
        "k61_3130\t354\t34\t0\r\n",
        "k61_3131\t339\t20\t0\r\n",
        "k61_3132\t884\t70\t0\r\n",
        "k61_3133\t491\t35\t0\r\n",
        "k61_3134\t700\t62\t0\r\n",
        "k61_3135\t288\t23\t0\r\n",
        "k61_3137\t348\t22\t0\r\n",
        "k61_3138\t350\t26\t0\r\n",
        "k61_3139\t200\t14\t0\r\n",
        "k61_3140\t233\t8\t0\r\n",
        "k61_3141\t563\t41\t0\r\n",
        "k61_3142\t1070\t90\t0\r\n",
        "k61_3143\t284\t13\t0\r\n",
        "k61_3144\t1055\t99\t0\r\n",
        "k61_3145\t351\t22\t0\r\n",
        "k61_3146\t316\t31\t0\r\n",
        "k61_3147\t633\t51\t0\r\n",
        "k61_3148\t622\t36\t0\r\n",
        "k61_3149\t287\t15\t0\r\n",
        "k61_3150\t465\t34\t0\r\n",
        "k61_3153\t1056\t93\t0\r\n",
        "k61_3154\t275\t11\t0\r\n",
        "k61_3155\t350\t25\t0\r\n",
        "k61_3156\t206\t11\t0\r\n",
        "k61_3158\t406\t21\t0\r\n",
        "k61_3159\t201\t18\t0\r\n",
        "k61_3160\t366\t25\t0\r\n",
        "k61_3161\t292\t19\t0\r\n",
        "k61_3162\t655\t55\t0\r\n",
        "k61_3163\t345\t24\t0\r\n",
        "k61_3164\t368\t24\t0\r\n",
        "k61_3165\t207\t10\t0\r\n",
        "k61_3166\t350\t31\t0\r\n",
        "k61_3167\t213\t14\t0\r\n",
        "k61_3169\t685\t77\t0\r\n",
        "k61_3170\t281\t14\t0\r\n",
        "k61_3171\t374\t29\t0\r\n",
        "k61_3172\t781\t60\t0\r\n",
        "k61_3173\t228\t9\t0\r\n",
        "k61_3174\t775\t78\t0\r\n",
        "k61_3175\t227\t15\t0\r\n",
        "k61_3176\t620\t74\t0\r\n",
        "k61_3177\t337\t32\t0\r\n",
        "k61_3178\t432\t29\t0\r\n",
        "k61_3179\t626\t57\t0\r\n",
        "k61_3180\t334\t23\t0\r\n",
        "k61_3181\t374\t22\t0\r\n",
        "k61_3182\t364\t10\t0\r\n",
        "k61_3183\t275\t17\t0\r\n",
        "k61_3184\t767\t58\t0\r\n",
        "k61_3185\t243\t14\t0\r\n",
        "k61_3186\t353\t32\t0\r\n",
        "k61_3187\t472\t19\t0\r\n",
        "k61_3188\t248\t14\t0\r\n",
        "k61_3189\t306\t16\t0\r\n",
        "k61_3190\t765\t68\t0\r\n",
        "k61_3191\t586\t53\t0\r\n",
        "k61_3192\t625\t49\t0\r\n",
        "k61_3193\t461\t37\t0\r\n",
        "k61_3195\t843\t68\t0\r\n",
        "k61_3196\t706\t71\t0\r\n",
        "k61_3197\t1189\t148\t0\r\n",
        "k61_3198\t238\t23\t0\r\n",
        "k61_3199\t228\t11\t0\r\n",
        "k61_3200\t757\t70\t0\r\n",
        "k61_3201\t2589\t263\t0\r\n",
        "k61_3202\t646\t47\t0\r\n",
        "k61_3203\t603\t33\t0\r\n",
        "k61_3204\t268\t15\t0\r\n",
        "k61_3205\t372\t18\t0\r\n",
        "k61_3206\t261\t12\t0\r\n",
        "k61_3207\t1106\t86\t0\r\n",
        "k61_3208\t1125\t89\t0\r\n",
        "k61_3209\t233\t16\t0\r\n",
        "k61_3210\t212\t14\t0\r\n",
        "k61_3211\t350\t10\t0\r\n",
        "k61_3212\t396\t24\t0\r\n",
        "k61_3213\t646\t58\t0\r\n",
        "k61_3214\t406\t35\t0\r\n",
        "k61_3215\t245\t13\t0\r\n",
        "k61_3216\t503\t38\t0\r\n",
        "k61_3217\t314\t22\t0\r\n",
        "k61_3218\t226\t19\t0\r\n",
        "k61_3220\t401\t24\t0\r\n",
        "k61_3221\t404\t35\t0\r\n",
        "k61_3222\t244\t12\t0\r\n",
        "k61_3223\t268\t30\t0\r\n",
        "k61_3224\t377\t22\t0\r\n",
        "k61_3225\t315\t11\t0\r\n",
        "k61_3226\t555\t80\t0\r\n",
        "k61_3227\t792\t100\t0\r\n",
        "k61_3228\t482\t38\t0\r\n",
        "k61_3230\t233\t14\t0\r\n",
        "k61_3231\t200\t5\t0\r\n",
        "k61_3232\t229\t15\t0\r\n",
        "k61_3233\t361\t25\t0\r\n",
        "k61_3234\t216\t12\t0\r\n",
        "k61_3235\t222\t21\t0\r\n",
        "k61_3236\t344\t29\t0\r\n",
        "k61_3237\t639\t51\t0\r\n",
        "k61_3238\t780\t67\t0\r\n",
        "k61_3239\t277\t20\t0\r\n",
        "k61_3240\t307\t16\t0\r\n",
        "k61_3241\t795\t193\t0\r\n",
        "k61_3242\t295\t16\t0\r\n",
        "k61_3243\t241\t14\t0\r\n",
        "k61_3244\t525\t40\t0\r\n",
        "k61_3245\t233\t10\t0\r\n",
        "k61_3246\t571\t47\t0\r\n",
        "k61_3247\t236\t8\t0\r\n",
        "k61_3248\t237\t23\t0\r\n",
        "k61_3249\t229\t16\t0\r\n",
        "k61_3250\t257\t13\t0\r\n",
        "k61_3251\t1035\t85\t0\r\n",
        "k61_3253\t245\t20\t0\r\n",
        "k61_3254\t215\t11\t0\r\n",
        "k61_3255\t230\t15\t0\r\n",
        "k61_3256\t209\t6\t0\r\n",
        "k61_3257\t267\t21\t0\r\n",
        "k61_3258\t318\t22\t0\r\n",
        "k61_3259\t998\t85\t0\r\n",
        "k61_3260\t205\t28\t0\r\n",
        "k61_3261\t231\t12\t0\r\n",
        "k61_3262\t1253\t104\t0\r\n",
        "k61_3263\t725\t81\t0\r\n",
        "k61_3264\t832\t68\t0\r\n",
        "k61_3265\t224\t15\t0\r\n",
        "k61_3266\t296\t13\t0\r\n",
        "k61_3267\t737\t69\t0\r\n",
        "k61_3268\t828\t70\t0\r\n",
        "k61_3269\t209\t17\t0\r\n",
        "k61_3270\t709\t83\t0\r\n",
        "k61_3271\t209\t14\t0\r\n",
        "k61_3272\t271\t22\t0\r\n",
        "k61_3273\t213\t11\t0\r\n",
        "k61_3274\t204\t10\t0\r\n",
        "k61_3275\t417\t19\t0\r\n",
        "k61_3276\t234\t14\t0\r\n",
        "k61_3277\t358\t22\t0\r\n",
        "k61_3278\t474\t42\t0\r\n",
        "k61_3280\t668\t76\t0\r\n",
        "k61_3281\t201\t8\t0\r\n",
        "k61_3282\t358\t25\t0\r\n",
        "k61_3283\t687\t62\t0\r\n",
        "k61_3284\t914\t126\t0\r\n",
        "k61_3285\t203\t13\t0\r\n",
        "k61_3286\t248\t12\t0\r\n",
        "k61_3289\t319\t13\t0\r\n",
        "k61_3290\t270\t12\t0\r\n",
        "k61_3291\t245\t43\t0\r\n",
        "k61_3292\t684\t80\t0\r\n",
        "k61_3294\t235\t6\t0\r\n",
        "k61_3295\t514\t40\t0\r\n",
        "k61_3296\t285\t22\t0\r\n",
        "k61_3297\t404\t33\t0\r\n",
        "k61_3298\t587\t63\t0\r\n",
        "k61_3299\t748\t95\t0\r\n",
        "k61_3300\t743\t70\t0\r\n",
        "k61_3301\t339\t25\t0\r\n",
        "k61_3302\t562\t39\t0\r\n",
        "k61_3303\t1487\t205\t0\r\n",
        "k61_3304\t1312\t107\t0\r\n",
        "k61_3305\t442\t35\t0\r\n",
        "k61_3306\t642\t53\t0\r\n",
        "k61_3307\t284\t21\t0\r\n",
        "k61_3308\t295\t24\t0\r\n",
        "k61_3309\t1263\t116\t0\r\n",
        "k61_3310\t224\t13\t0\r\n",
        "k61_3311\t1260\t126\t0\r\n",
        "k61_3312\t233\t9\t0\r\n",
        "k61_3313\t1120\t80\t0\r\n",
        "k61_3314\t234\t10\t0\r\n",
        "k61_3317\t608\t40\t0\r\n",
        "k61_3318\t521\t45\t0\r\n",
        "k61_3319\t328\t27\t0\r\n",
        "k61_3320\t385\t45\t0\r\n",
        "k61_3321\t323\t19\t0\r\n",
        "k61_3322\t217\t25\t0\r\n",
        "k61_3323\t237\t17\t0\r\n",
        "k61_3324\t648\t45\t0\r\n",
        "k61_3325\t1258\t115\t0\r\n",
        "k61_3326\t206\t10\t0\r\n",
        "k61_3327\t632\t56\t0\r\n",
        "k61_3328\t974\t81\t0\r\n",
        "k61_3329\t327\t24\t0\r\n",
        "k61_3330\t490\t59\t0\r\n",
        "k61_3331\t316\t24\t0\r\n",
        "k61_3332\t359\t28\t0\r\n",
        "k61_3333\t284\t16\t0\r\n",
        "k61_3334\t399\t34\t0\r\n",
        "k61_3335\t1043\t72\t0\r\n",
        "k61_3336\t1161\t99\t0\r\n",
        "k61_3338\t1046\t70\t0\r\n",
        "k61_3339\t232\t28\t0\r\n",
        "k61_3340\t374\t45\t0\r\n",
        "k61_3341\t309\t20\t0\r\n",
        "k61_3342\t338\t21\t0\r\n",
        "k61_3343\t212\t7\t0\r\n",
        "k61_3344\t259\t17\t0\r\n",
        "k61_3345\t202\t5\t0\r\n",
        "k61_3346\t569\t52\t0\r\n",
        "k61_3347\t357\t32\t0\r\n",
        "k61_3348\t288\t12\t0\r\n",
        "k61_3349\t673\t46\t0\r\n",
        "k61_3350\t682\t52\t0\r\n",
        "k61_3352\t641\t92\t0\r\n",
        "k61_3353\t239\t12\t0\r\n",
        "k61_3354\t389\t34\t0\r\n",
        "k61_3355\t314\t30\t0\r\n",
        "k61_3356\t785\t80\t0\r\n",
        "k61_3357\t346\t11\t0\r\n",
        "k61_3358\t664\t65\t0\r\n",
        "k61_3360\t391\t23\t0\r\n",
        "k61_3363\t469\t41\t0\r\n",
        "k61_3364\t254\t12\t0\r\n",
        "k61_3365\t1209\t140\t0\r\n",
        "k61_3366\t404\t23\t0\r\n",
        "k61_3367\t775\t61\t0\r\n",
        "k61_3368\t201\t7\t0\r\n",
        "k61_3369\t328\t23\t0\r\n",
        "k61_3370\t445\t28\t0\r\n",
        "k61_3371\t560\t45\t0\r\n",
        "k61_3372\t241\t12\t0\r\n",
        "k61_3373\t659\t56\t0\r\n",
        "k61_3374\t455\t42\t0\r\n",
        "k61_3375\t344\t22\t0\r\n",
        "k61_3376\t617\t62\t0\r\n",
        "k61_3377\t671\t63\t0\r\n",
        "k61_3378\t252\t24\t0\r\n",
        "k61_3379\t736\t91\t0\r\n",
        "k61_3380\t316\t22\t0\r\n",
        "k61_3381\t210\t19\t0\r\n",
        "k61_3382\t222\t6\t0\r\n",
        "k61_3383\t799\t77\t0\r\n",
        "k61_3384\t261\t17\t0\r\n",
        "k61_3385\t420\t42\t0\r\n",
        "k61_3386\t215\t6\t0\r\n",
        "k61_3387\t667\t58\t0\r\n",
        "k61_3388\t335\t19\t0\r\n",
        "k61_3389\t252\t16\t0\r\n",
        "k61_3390\t237\t9\t0\r\n",
        "k61_3391\t1416\t133\t0\r\n",
        "k61_3392\t248\t6\t0\r\n",
        "k61_3393\t225\t9\t0\r\n",
        "k61_3394\t295\t29\t0\r\n",
        "k61_3395\t243\t26\t0\r\n",
        "k61_3396\t469\t27\t0\r\n",
        "k61_3397\t204\t7\t0\r\n",
        "k61_3398\t261\t10\t0\r\n",
        "k61_3399\t281\t17\t0\r\n",
        "k61_3400\t419\t34\t0\r\n",
        "k61_3401\t260\t15\t0\r\n",
        "k61_3403\t346\t23\t0\r\n",
        "k61_3405\t639\t55\t0\r\n",
        "k61_3406\t330\t21\t0\r\n",
        "k61_3408\t443\t31\t0\r\n",
        "k61_3409\t967\t90\t0\r\n",
        "k61_3410\t284\t12\t0\r\n",
        "k61_3411\t507\t47\t0\r\n",
        "k61_3412\t223\t14\t0\r\n",
        "k61_3415\t244\t12\t0\r\n",
        "k61_3416\t239\t11\t0\r\n",
        "k61_3418\t336\t13\t0\r\n",
        "k61_3419\t343\t32\t0\r\n",
        "k61_3420\t276\t18\t0\r\n",
        "k61_3421\t286\t10\t0\r\n",
        "k61_3422\t238\t13\t0\r\n",
        "k61_3423\t252\t23\t0\r\n",
        "k61_3424\t468\t31\t0\r\n",
        "k61_3425\t252\t14\t0\r\n",
        "k61_3426\t1080\t95\t0\r\n",
        "k61_3427\t766\t94\t0\r\n",
        "k61_3428\t212\t19\t0\r\n",
        "k61_3429\t649\t58\t0\r\n",
        "k61_3430\t873\t87\t0\r\n",
        "k61_3431\t213\t9\t0\r\n",
        "k61_3432\t327\t22\t0\r\n",
        "k61_3433\t682\t67\t0\r\n",
        "k61_3434\t312\t13\t0\r\n",
        "k61_3435\t230\t25\t0\r\n",
        "k61_3436\t1523\t193\t0\r\n",
        "k61_3437\t304\t21\t0\r\n",
        "k61_3438\t246\t11\t0\r\n",
        "k61_3439\t416\t29\t0\r\n",
        "k61_3440\t349\t24\t0\r\n",
        "k61_3442\t311\t19\t0\r\n",
        "k61_3443\t246\t8\t0\r\n",
        "k61_3444\t989\t67\t0\r\n",
        "k61_3445\t231\t17\t0\r\n",
        "k61_3448\t263\t26\t0\r\n",
        "k61_3449\t1070\t125\t0\r\n",
        "k61_3450\t213\t12\t0\r\n",
        "k61_3451\t592\t42\t0\r\n",
        "k61_3452\t421\t33\t0\r\n",
        "k61_3453\t385\t34\t0\r\n",
        "k61_3454\t364\t30\t0\r\n",
        "k61_3456\t203\t8\t0\r\n",
        "k61_3457\t393\t39\t0\r\n",
        "k61_3458\t223\t10\t0\r\n",
        "k61_3460\t488\t23\t0\r\n",
        "k61_3461\t494\t44\t0\r\n",
        "k61_3462\t528\t50\t0\r\n",
        "k61_3463\t1030\t82\t0\r\n",
        "k61_3464\t348\t26\t0\r\n",
        "k61_3465\t312\t28\t0\r\n",
        "k61_3466\t248\t11\t0\r\n",
        "k61_3467\t219\t8\t0\r\n",
        "k61_3468\t619\t40\t0\r\n",
        "k61_3469\t506\t24\t0\r\n",
        "k61_3470\t221\t11\t0\r\n",
        "k61_3471\t552\t50\t0\r\n",
        "k61_3472\t251\t13\t0\r\n",
        "k61_3474\t298\t29\t0\r\n",
        "k61_3476\t241\t8\t0\r\n",
        "k61_3477\t254\t24\t0\r\n",
        "k61_3478\t375\t33\t0\r\n",
        "k61_3479\t299\t25\t0\r\n",
        "k61_3480\t287\t15\t0\r\n",
        "k61_3481\t235\t16\t0\r\n",
        "k61_3482\t364\t16\t0\r\n",
        "k61_3483\t268\t24\t0\r\n",
        "k61_3485\t227\t12\t0\r\n",
        "k61_3486\t201\t5\t0\r"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\n",
        "k61_3487\t752\t78\t0\r\n",
        "k61_3488\t862\t80\t0\r\n",
        "k61_3489\t249\t12\t0\r\n",
        "k61_3490\t335\t15\t0\r\n",
        "k61_3491\t243\t16\t0\r\n",
        "k61_3492\t224\t19\t0\r\n",
        "k61_3493\t246\t26\t0\r\n",
        "k61_3494\t1472\t141\t0\r\n",
        "k61_3495\t263\t17\t0\r\n",
        "k61_3496\t220\t15\t0\r\n",
        "k61_3497\t335\t24\t0\r\n",
        "k61_3498\t271\t19\t0\r\n",
        "k61_3499\t1031\t88\t0\r\n",
        "k61_3500\t819\t56\t0\r\n",
        "k61_3501\t241\t19\t0\r\n",
        "k61_3502\t245\t14\t0\r\n",
        "k61_3504\t722\t54\t0\r\n",
        "k61_3505\t631\t40\t0\r\n",
        "k61_3507\t805\t64\t0\r\n",
        "k61_3508\t211\t15\t0\r\n",
        "k61_3509\t258\t20\t0\r\n",
        "k61_3510\t213\t14\t0\r\n",
        "k61_3511\t262\t17\t0\r\n",
        "k61_3512\t390\t15\t0\r\n",
        "k61_3513\t469\t35\t0\r\n",
        "k61_3514\t718\t59\t0\r\n",
        "k61_3515\t578\t51\t0\r\n",
        "k61_3516\t272\t18\t0\r\n",
        "k61_3517\t337\t22\t0\r\n",
        "k61_3518\t349\t26\t0\r\n",
        "k61_3519\t217\t4\t0\r\n",
        "k61_3520\t453\t39\t0\r\n",
        "k61_3521\t298\t25\t0\r\n",
        "k61_3522\t863\t92\t0\r\n",
        "k61_3523\t222\t11\t0\r\n",
        "k61_3525\t933\t89\t0\r\n",
        "k61_3526\t436\t42\t0\r\n",
        "k61_3527\t224\t10\t0\r\n",
        "k61_3528\t273\t19\t0\r\n",
        "k61_3530\t312\t15\t0\r\n",
        "k61_3531\t247\t10\t0\r\n",
        "k61_3532\t213\t10\t0\r\n",
        "k61_3533\t253\t15\t0\r\n",
        "k61_3534\t216\t10\t0\r\n",
        "k61_3535\t271\t20\t0\r\n",
        "k61_3536\t1127\t108\t0\r\n",
        "k61_3537\t333\t23\t0\r\n",
        "k61_3538\t333\t25\t0\r\n",
        "k61_3539\t208\t24\t0\r\n",
        "k61_3541\t596\t42\t0\r\n",
        "k61_3543\t870\t69\t0\r\n",
        "k61_3544\t212\t12\t0\r\n",
        "k61_3545\t341\t26\t0\r\n",
        "k61_3546\t342\t24\t0\r\n",
        "k61_3547\t282\t19\t0\r\n",
        "k61_3548\t367\t27\t0\r\n",
        "k61_3549\t224\t11\t0\r\n",
        "k61_3550\t974\t74\t0\r\n",
        "k61_3551\t248\t17\t0\r\n",
        "k61_3552\t458\t41\t0\r\n",
        "k61_3553\t229\t14\t0\r\n",
        "k61_3554\t396\t16\t0\r\n",
        "k61_3555\t326\t27\t0\r\n",
        "k61_3556\t638\t41\t0\r\n",
        "k61_3557\t403\t26\t0\r\n",
        "k61_3558\t580\t52\t0\r\n",
        "k61_3559\t234\t22\t0\r\n",
        "k61_3560\t601\t56\t0\r\n",
        "k61_3561\t872\t66\t0\r\n",
        "k61_3562\t438\t20\t0\r\n",
        "k61_3563\t913\t72\t0\r\n",
        "k61_3565\t217\t11\t0\r\n",
        "k61_3566\t694\t66\t0\r\n",
        "k61_3567\t516\t39\t0\r\n",
        "k61_3568\t446\t29\t0\r\n",
        "k61_3569\t292\t21\t0\r\n",
        "k61_3570\t297\t12\t0\r\n",
        "k61_3572\t517\t44\t0\r\n",
        "k61_3573\t480\t51\t0\r\n",
        "k61_3574\t470\t27\t0\r\n",
        "k61_3575\t261\t6\t0\r\n",
        "k61_3576\t256\t8\t0\r\n",
        "k61_3577\t230\t16\t0\r\n",
        "k61_3578\t383\t30\t0\r\n",
        "k61_3579\t308\t20\t0\r\n",
        "k61_3581\t377\t33\t0\r\n",
        "k61_3582\t540\t37\t0\r\n",
        "k61_3583\t337\t14\t0\r\n",
        "k61_3584\t346\t28\t0\r\n",
        "k61_3585\t342\t31\t0\r\n",
        "k61_3586\t1372\t134\t0\r\n",
        "k61_3587\t724\t57\t0\r\n",
        "k61_3588\t241\t12\t0\r\n",
        "k61_3589\t625\t47\t0\r\n",
        "k61_3590\t349\t18\t0\r\n",
        "k61_3591\t263\t15\t0\r\n",
        "k61_3592\t235\t15\t0\r\n",
        "k61_3593\t1251\t118\t0\r\n",
        "k61_3594\t230\t13\t0\r\n",
        "k61_3595\t447\t35\t0\r\n",
        "k61_3596\t432\t28\t0\r\n",
        "k61_3597\t405\t31\t0\r\n",
        "k61_3598\t487\t42\t0\r\n",
        "k61_3599\t272\t28\t0\r\n",
        "k61_3600\t541\t42\t0\r\n",
        "k61_3601\t212\t17\t0\r\n",
        "k61_3602\t405\t35\t0\r\n",
        "k61_3603\t277\t26\t0\r\n",
        "k61_3604\t226\t16\t0\r\n",
        "k61_3605\t202\t23\t0\r\n",
        "k61_3606\t382\t45\t0\r\n",
        "k61_3607\t218\t7\t0\r\n",
        "k61_3608\t353\t21\t0\r\n",
        "k61_3609\t338\t26\t0\r\n",
        "k61_3610\t862\t73\t0\r\n",
        "k61_3611\t606\t63\t0\r\n",
        "k61_3612\t424\t27\t0\r\n",
        "k61_3614\t918\t95\t0\r\n",
        "k61_3615\t342\t20\t0\r\n",
        "k61_3616\t399\t38\t0\r\n",
        "k61_3617\t361\t37\t0\r\n",
        "k61_3619\t272\t11\t0\r\n",
        "k61_3620\t222\t8\t0\r\n",
        "k61_3621\t859\t78\t0\r\n",
        "k61_3622\t291\t16\t0\r\n",
        "k61_3623\t461\t19\t0\r\n",
        "k61_3624\t266\t12\t0\r\n",
        "k61_3625\t577\t40\t0\r\n",
        "k61_3626\t572\t49\t0\r\n",
        "k61_3627\t211\t11\t0\r\n",
        "k61_3628\t614\t37\t0\r\n",
        "k61_3629\t461\t36\t0\r\n",
        "k61_3630\t367\t24\t0\r\n",
        "k61_3631\t1241\t121\t0\r\n",
        "k61_3632\t445\t23\t0\r\n",
        "k61_3633\t491\t37\t0\r\n",
        "k61_3634\t1319\t169\t0\r\n",
        "k61_3635\t202\t10\t0\r\n",
        "k61_3636\t381\t28\t0\r\n",
        "k61_3637\t384\t26\t0\r\n",
        "k61_3638\t227\t14\t0\r\n",
        "k61_3639\t536\t47\t0\r\n",
        "k61_3640\t235\t18\t0\r\n",
        "k61_3641\t814\t55\t0\r\n",
        "k61_3642\t283\t11\t0\r\n",
        "k61_3643\t227\t10\t0\r\n",
        "k61_3644\t212\t10\t0\r\n",
        "k61_3645\t510\t47\t0\r\n",
        "k61_3646\t689\t63\t0\r\n",
        "k61_3647\t328\t32\t0\r\n",
        "k61_3648\t393\t16\t0\r\n",
        "k61_3649\t430\t42\t0\r\n",
        "k61_3650\t430\t34\t0\r\n",
        "k61_3651\t832\t61\t0\r\n",
        "k61_3652\t908\t86\t0\r\n",
        "k61_3653\t589\t41\t0\r\n",
        "k61_3654\t357\t14\t0\r\n",
        "k61_3656\t226\t13\t0\r\n",
        "k61_3657\t270\t18\t0\r\n",
        "k61_3658\t403\t23\t0\r\n",
        "k61_3659\t261\t21\t0\r\n",
        "k61_3663\t2473\t250\t0\r\n",
        "k61_3664\t391\t29\t0\r\n",
        "k61_3665\t490\t36\t0\r\n",
        "k61_3666\t369\t17\t0\r\n",
        "k61_3667\t202\t6\t0\r\n",
        "k61_3668\t439\t30\t0\r\n",
        "k61_3669\t480\t48\t0\r\n",
        "k61_3670\t203\t5\t0\r\n",
        "k61_3671\t671\t72\t0\r\n",
        "k61_3672\t705\t70\t0\r\n",
        "k61_3673\t1710\t152\t0\r\n",
        "k61_3674\t739\t69\t0\r\n",
        "k61_3675\t839\t91\t0\r\n",
        "k61_3676\t973\t111\t0\r\n",
        "k61_3677\t287\t14\t0\r\n",
        "k61_3678\t542\t72\t0\r\n",
        "k61_3679\t374\t41\t0\r\n",
        "k61_3680\t1516\t163\t0\r\n",
        "k61_3681\t352\t17\t0\r\n",
        "k61_3682\t590\t37\t0\r\n",
        "k61_3684\t263\t15\t0\r\n",
        "k61_3685\t217\t9\t0\r\n",
        "k61_3686\t282\t23\t0\r\n",
        "k61_3687\t656\t61\t0\r\n",
        "k61_3688\t294\t21\t0\r\n",
        "k61_3689\t202\t18\t0\r\n",
        "k61_3692\t200\t7\t0\r\n",
        "k61_3693\t207\t15\t0\r\n",
        "k61_3694\t467\t35\t0\r\n",
        "k61_3695\t428\t18\t0\r\n",
        "k61_3696\t440\t43\t0\r\n",
        "k61_3697\t334\t19\t0\r\n",
        "k61_3698\t386\t23\t0\r\n",
        "k61_3699\t214\t12\t0\r\n",
        "k61_3700\t454\t31\t0\r\n",
        "k61_3701\t218\t7\t0\r\n",
        "k61_3702\t325\t10\t0\r\n",
        "k61_3703\t413\t48\t0\r\n",
        "k61_3704\t435\t26\t0\r\n",
        "k61_3706\t445\t30\t0\r\n",
        "k61_3707\t397\t22\t0\r\n",
        "k61_3708\t326\t18\t0\r\n",
        "k61_3709\t267\t25\t0\r\n",
        "k61_3710\t387\t29\t0\r\n",
        "k61_3711\t267\t31\t0\r\n",
        "k61_3712\t278\t27\t0\r\n",
        "k61_3713\t238\t10\t0\r\n",
        "k61_3714\t330\t33\t0\r\n",
        "k61_3715\t479\t42\t0\r\n",
        "k61_3716\t528\t38\t0\r\n",
        "k61_3717\t365\t29\t0\r\n",
        "k61_3718\t474\t29\t0\r\n",
        "k61_3719\t357\t20\t0\r\n",
        "k61_3720\t203\t11\t0\r\n",
        "k61_3721\t266\t17\t0\r\n",
        "k61_3722\t578\t39\t0\r\n",
        "k61_3723\t352\t29\t0\r\n",
        "k61_3724\t620\t46\t0\r\n",
        "k61_3725\t268\t15\t0\r\n",
        "k61_3726\t202\t12\t0\r\n",
        "k61_3727\t765\t63\t0\r\n",
        "k61_3728\t285\t13\t0\r\n",
        "k61_3729\t699\t45\t0\r\n",
        "k61_3731\t301\t12\t0\r\n",
        "k61_3732\t317\t22\t0\r\n",
        "k61_3734\t969\t61\t0\r\n",
        "k61_3735\t225\t10\t0\r\n",
        "k61_3736\t399\t31\t0\r\n",
        "k61_3739\t223\t15\t0\r\n",
        "k61_3740\t881\t86\t0\r\n",
        "k61_3741\t419\t36\t0\r\n",
        "k61_3742\t446\t25\t0\r\n",
        "k61_3743\t837\t97\t0\r\n",
        "k61_3744\t218\t11\t0\r\n",
        "k61_3745\t217\t13\t0\r\n",
        "k61_3746\t541\t41\t0\r\n",
        "k61_3747\t325\t25\t0\r\n",
        "k61_3748\t498\t46\t0\r\n",
        "k61_3750\t992\t85\t0\r\n",
        "k61_3751\t238\t10\t0\r\n",
        "k61_3752\t349\t27\t0\r\n",
        "k61_3753\t410\t38\t0\r\n",
        "k61_3754\t396\t30\t0\r\n",
        "k61_3755\t211\t7\t0\r\n",
        "k61_3756\t205\t10\t0\r\n",
        "k61_3757\t668\t47\t0\r\n",
        "k61_3758\t212\t10\t0\r\n",
        "k61_3759\t399\t36\t0\r\n",
        "k61_3760\t539\t35\t0\r\n",
        "k61_3761\t366\t22\t0\r\n",
        "k61_3762\t212\t10\t0\r\n",
        "k61_3763\t385\t16\t0\r\n",
        "k61_3764\t1267\t124\t0\r\n",
        "k61_3765\t286\t16\t0\r\n",
        "k61_3766\t263\t20\t0\r\n",
        "k61_3768\t227\t14\t0\r\n",
        "k61_3770\t677\t54\t0\r\n",
        "k61_3772\t455\t45\t0\r\n",
        "k61_3773\t233\t15\t0\r\n",
        "k61_3774\t411\t33\t0\r\n",
        "k61_3775\t536\t49\t0\r\n",
        "k61_3776\t201\t12\t0\r\n",
        "k61_3777\t355\t18\t0\r\n",
        "k61_3778\t265\t11\t0\r\n",
        "k61_3779\t488\t38\t0\r\n",
        "k61_3780\t339\t19\t0\r\n",
        "k61_3781\t502\t57\t0\r\n",
        "k61_3782\t681\t64\t0\r\n",
        "k61_3783\t222\t10\t0\r\n",
        "k61_3784\t319\t23\t0\r\n",
        "k61_3785\t208\t12\t0\r\n",
        "k61_3787\t377\t39\t0\r\n",
        "k61_3788\t1262\t115\t0\r\n",
        "k61_3789\t537\t48\t0\r\n",
        "k61_3790\t210\t13\t0\r\n",
        "k61_3791\t527\t44\t0\r\n",
        "k61_3792\t373\t29\t0\r\n",
        "k61_3793\t227\t14\t0\r\n",
        "k61_3794\t210\t9\t0\r\n",
        "k61_3795\t991\t90\t0\r\n",
        "k61_3796\t1033\t73\t0\r\n",
        "k61_3797\t323\t10\t0\r\n",
        "k61_3798\t266\t14\t0\r\n",
        "k61_3799\t232\t10\t0\r\n",
        "k61_3800\t231\t7\t0\r\n",
        "k61_3801\t209\t10\t0\r\n",
        "k61_3802\t1507\t131\t0\r\n",
        "k61_3803\t226\t16\t0\r\n",
        "k61_3804\t549\t43\t0\r\n",
        "k61_3805\t224\t13\t0\r\n",
        "k61_3806\t220\t17\t0\r\n",
        "k61_3807\t343\t33\t0\r\n",
        "k61_3808\t215\t15\t0\r\n",
        "k61_3809\t233\t14\t0\r\n",
        "k61_3810\t1098\t123\t0\r\n",
        "k61_3811\t1272\t112\t0\r\n",
        "k61_3813\t232\t27\t0\r\n",
        "k61_3815\t436\t30\t0\r\n",
        "k61_3817\t290\t47\t0\r\n",
        "k61_3818\t246\t23\t0\r\n",
        "k61_3819\t256\t20\t0\r\n",
        "k61_3820\t246\t19\t0\r\n",
        "k61_3821\t322\t21\t0\r\n",
        "k61_3822\t601\t68\t0\r\n",
        "k61_3823\t235\t8\t0\r\n",
        "k61_3824\t225\t14\t0\r\n",
        "k61_3825\t494\t28\t0\r\n",
        "k61_3826\t202\t7\t0\r\n",
        "k61_3828\t408\t32\t0\r\n",
        "k61_3829\t253\t15\t0\r\n",
        "k61_3830\t207\t22\t0\r\n",
        "k61_3831\t258\t13\t0\r\n",
        "k61_3833\t263\t12\t0\r\n",
        "k61_3834\t261\t22\t0\r\n",
        "k61_3835\t239\t6\t0\r\n",
        "k61_3836\t1015\t88\t0\r\n",
        "k61_3837\t487\t34\t0\r\n",
        "k61_3838\t250\t13\t0\r\n",
        "k61_3839\t339\t21\t0\r\n",
        "k61_3840\t804\t99\t0\r\n",
        "k61_3841\t698\t55\t0\r\n",
        "k61_3842\t584\t51\t0\r\n",
        "k61_3844\t331\t17\t0\r\n",
        "k61_3845\t403\t27\t0\r\n",
        "k61_3846\t259\t8\t0\r\n",
        "k61_3847\t313\t22\t0\r\n",
        "k61_3848\t263\t17\t0\r\n",
        "k61_3849\t232\t24\t0\r\n",
        "k61_3850\t230\t8\t0\r\n",
        "k61_3851\t583\t56\t0\r\n",
        "k61_3852\t221\t17\t0\r\n",
        "k61_3853\t270\t17\t0\r\n",
        "k61_3854\t264\t12\t0\r\n",
        "k61_3855\t697\t66\t0\r\n",
        "k61_3856\t411\t38\t0\r\n",
        "k61_3857\t231\t9\t0\r\n",
        "k61_3858\t242\t15\t0\r\n",
        "k61_3859\t226\t12\t0\r\n",
        "k61_3861\t257\t13\t0\r\n",
        "k61_3862\t392\t41\t0\r\n",
        "k61_3863\t253\t23\t0\r\n",
        "k61_3865\t531\t50\t0\r\n",
        "k61_3867\t245\t22\t0\r\n",
        "k61_3868\t240\t14\t0\r\n",
        "k61_3869\t399\t23\t0\r\n",
        "k61_3870\t632\t54\t0\r\n",
        "k61_3871\t683\t48\t0\r\n",
        "k61_3873\t244\t20\t0\r\n",
        "k61_3874\t1662\t163\t0\r\n",
        "k61_3875\t204\t8\t0\r\n",
        "k61_3876\t641\t53\t0\r\n",
        "k61_3877\t236\t14\t0\r\n",
        "k61_3878\t443\t27\t0\r\n",
        "k61_3879\t422\t28\t0\r\n",
        "k61_3880\t612\t67\t0\r\n",
        "k61_3881\t248\t13\t0\r\n",
        "k61_3882\t768\t61\t0\r\n",
        "k61_3883\t205\t12\t0\r\n",
        "k61_3884\t258\t19\t0\r\n",
        "k61_3885\t257\t15\t0\r\n",
        "k61_3886\t251\t12\t0\r\n",
        "k61_3887\t370\t34\t0\r\n",
        "k61_3888\t748\t90\t0\r\n",
        "k61_3889\t1053\t100\t0\r\n",
        "k61_3891\t265\t16\t0\r\n",
        "k61_3892\t309\t28\t0\r\n",
        "k61_3893\t201\t6\t0\r\n",
        "k61_3894\t234\t20\t0\r\n",
        "k61_3895\t208\t13\t0\r\n",
        "k61_3896\t1353\t159\t0\r\n",
        "k61_3897\t275\t13\t0\r\n",
        "k61_3898\t314\t21\t0\r\n",
        "k61_3899\t207\t8\t0\r\n",
        "k61_3900\t827\t78\t0\r\n",
        "k61_3901\t227\t15\t0\r\n",
        "k61_3902\t372\t28\t0\r\n",
        "k61_3903\t256\t15\t0\r\n",
        "k61_3904\t381\t28\t0\r\n",
        "k61_3905\t340\t23\t0\r\n",
        "k61_3906\t555\t38\t0\r\n",
        "k61_3907\t332\t19\t0\r\n",
        "k61_3908\t395\t21\t0\r\n",
        "k61_3909\t261\t19\t0\r\n",
        "k61_3911\t310\t21\t0\r\n",
        "k61_3913\t366\t28\t0\r\n",
        "k61_3914\t462\t37\t0\r\n",
        "k61_3915\t214\t18\t0\r\n",
        "k61_3916\t328\t16\t0\r\n",
        "k61_3917\t491\t53\t0\r\n",
        "k61_3918\t241\t18\t0\r\n",
        "k61_3919\t771\t60\t0\r\n",
        "k61_3920\t810\t70\t0\r\n",
        "k61_3921\t345\t19\t0\r\n",
        "k61_3922\t614\t47\t0\r\n",
        "k61_3923\t402\t33\t0\r\n",
        "k61_3924\t274\t15\t0\r\n",
        "k61_3926\t788\t61\t0\r\n",
        "k61_3927\t603\t69\t0\r\n",
        "k61_3928\t380\t21\t0\r\n",
        "k61_3929\t929\t91\t0\r\n",
        "k61_3930\t471\t21\t0\r\n",
        "k61_3931\t212\t15\t0\r\n",
        "k61_3932\t442\t15\t0\r\n",
        "k61_3933\t490\t42\t0\r\n",
        "k61_3934\t327\t29\t0\r\n",
        "k61_3935\t319\t38\t0\r\n",
        "k61_3936\t583\t106\t0\r\n",
        "k61_3937\t441\t28\t0\r\n",
        "k61_3938\t207\t10\t0\r\n",
        "k61_3939\t395\t23\t0\r\n",
        "k61_3940\t1130\t99\t0\r\n",
        "k61_3943\t315\t31\t0\r\n",
        "k61_3944\t251\t18\t0\r\n",
        "k61_3945\t388\t16\t0\r\n",
        "k61_3946\t400\t43\t0\r\n",
        "k61_3947\t642\t36\t0\r\n",
        "k61_3948\t331\t32\t0\r\n",
        "k61_3949\t293\t17\t0\r\n",
        "k61_3950\t467\t43\t0\r\n",
        "k61_3951\t229\t10\t0\r\n",
        "k61_3952\t308\t16\t0\r\n",
        "k61_3953\t482\t50\t0\r\n",
        "k61_3955\t228\t9\t0\r\n",
        "k61_3956\t469\t23\t0\r\n",
        "k61_3958\t205\t18\t0\r\n",
        "k61_3959\t954\t92\t0\r\n",
        "k61_3960\t271\t20\t0\r\n",
        "k61_3961\t746\t83\t0\r\n",
        "k61_3962\t490\t39\t0\r\n",
        "k61_3963\t623\t43\t0\r\n",
        "k61_3964\t349\t26\t0\r\n",
        "k61_3966\t894\t74\t0\r\n",
        "k61_3967\t610\t65\t0\r\n",
        "k61_3968\t867\t95\t0\r\n",
        "k61_3969\t204\t13\t0\r\n",
        "k61_3970\t1922\t194\t0\r\n",
        "k61_3971\t211\t12\t0\r\n",
        "k61_3972\t281\t29\t0\r\n",
        "k61_3973\t395\t35\t0\r\n",
        "k61_3974\t536\t41\t0\r\n",
        "k61_3976\t394\t36\t0\r\n",
        "k61_3977\t820\t80\t0\r\n",
        "k61_3979\t364\t23\t0\r\n",
        "k61_3980\t560\t44\t0\r\n",
        "k61_3983\t219\t17\t0\r\n",
        "k61_3984\t388\t23\t0\r\n",
        "k61_3985\t228\t11\t0\r\n",
        "k61_3986\t218\t8\t0\r\n",
        "k61_3987\t227\t9\t0\r\n",
        "k61_3988\t269\t19\t0\r\n",
        "k61_3989\t293\t21\t0\r\n",
        "k61_3990\t826\t80\t0\r\n",
        "k61_3991\t1253\t116\t0\r\n",
        "k61_3992\t233\t8\t0\r\n",
        "k61_3993\t323\t34\t0\r\n",
        "k61_3994\t345\t29\t0\r\n",
        "k61_3995\t537\t52\t0\r\n",
        "k61_3996\t883\t86\t0\r\n",
        "k61_3998\t237\t14\t0\r\n",
        "k61_3999\t273\t16\t0\r\n",
        "k61_4000\t368\t33\t0\r\n",
        "k61_4001\t304\t17\t0\r\n",
        "k61_4002\t543\t48\t0\r\n",
        "k61_4003\t280\t26\t0\r\n",
        "k61_4004\t254\t13\t0\r\n",
        "k61_4005\t357\t23\t0\r\n",
        "k61_4006\t399\t24\t0\r\n",
        "k61_4007\t311\t17\t0\r\n",
        "k61_4008\t315\t22\t0\r\n",
        "k61_4009\t231\t8\t0\r\n",
        "k61_4010\t207\t14\t0\r\n",
        "k61_4011\t269\t25\t0\r\n",
        "k61_4012\t273\t16\t0\r\n",
        "k61_4014\t745\t98\t0\r\n",
        "k61_4015\t201\t9\t0\r\n",
        "k61_4017\t218\t9\t0\r\n",
        "k61_4018\t310\t46\t0\r\n",
        "k61_4019\t308\t24\t0\r\n",
        "k61_4020\t261\t12\t0\r\n",
        "k61_4021\t249\t24\t0\r\n",
        "k61_4022\t970\t89\t0\r\n",
        "k61_4023\t494\t51\t0\r\n",
        "k61_4024\t488\t48\t0\r\n",
        "k61_4025\t549\t52\t0\r\n",
        "k61_4026\t343\t41\t0\r\n",
        "k61_4027\t359\t28\t0\r\n",
        "k61_4028\t207\t5\t0\r\n",
        "k61_4029\t359\t16\t0\r\n",
        "k61_4030\t627\t50\t0\r\n",
        "k61_4031\t303\t29\t0\r\n",
        "k61_4032\t382\t24\t0\r\n",
        "k61_4033\t501\t37\t0\r\n",
        "k61_4034\t366\t18\t0\r\n",
        "k61_4035\t261\t26\t0\r\n",
        "k61_4036\t792\t80\t0\r\n",
        "k61_4037\t257\t22\t0\r\n",
        "k61_4038\t617\t56\t0\r\n",
        "k61_4039\t442\t38\t0\r\n",
        "k61_4040\t406\t31\t0\r\n",
        "k61_4042\t205\t14\t0\r\n",
        "k61_4043\t202\t6\t0\r\n",
        "k61_4044\t292\t28\t0\r\n",
        "k61_4045\t1580\t209\t0\r\n",
        "k61_4046\t264\t26\t0\r\n",
        "k61_4047\t262\t15\t0\r\n",
        "k61_4048\t227\t10\t0\r\n",
        "k61_4049\t443\t31\t0\r\n",
        "k61_4050\t500\t35\t0\r\n",
        "k61_4051\t301\t18\t0\r\n",
        "k61_4052\t241\t13\t0\r\n",
        "k61_4053\t272\t11\t0\r\n",
        "k61_4054\t375\t33\t0\r\n",
        "k61_4057\t214\t14\t0\r\n",
        "k61_4058\t1489\t138\t0\r\n",
        "k61_4059\t367\t44\t0\r\n",
        "k61_4060\t385\t37\t0\r\n",
        "k61_4061\t255\t27\t0\r\n",
        "k61_4062\t286\t34\t0\r\n",
        "k61_4063\t530\t45\t0\r\n",
        "k61_4064\t210\t12\t0\r\n",
        "k61_4065\t229\t16\t0\r\n",
        "k61_4066\t445\t34\t0\r\n",
        "k61_4067\t266\t17\t0\r\n",
        "k61_4068\t618\t52\t0\r\n",
        "k61_4069\t270\t19\t0\r\n",
        "k61_4070\t461\t47\t0\r\n",
        "k61_4071\t220\t11\t0\r\n",
        "k61_4072\t286\t16\t0\r\n",
        "k61_4073\t309\t15\t0\r\n",
        "k61_4074\t789\t75\t0\r\n",
        "k61_4075\t237\t16\t0\r\n",
        "k61_4076\t219\t12\t0\r\n",
        "k61_4077\t747\t57\t0\r\n",
        "k61_4078\t264\t13\t0\r\n",
        "k61_4079\t337\t17\t0\r\n",
        "k61_4080\t2009\t214\t0\r\n",
        "k61_4081\t331\t26\t0\r\n",
        "k61_4082\t200\t7\t0\r\n",
        "k61_4083\t202\t18\t0\r\n",
        "k61_4084\t696\t58\t0\r\n",
        "k61_4085\t304\t21\t0\r\n",
        "k61_4086\t265\t13\t0\r\n",
        "k61_4087\t602\t51\t0\r\n",
        "k61_4088\t314\t23\t0\r\n",
        "k61_4089\t205\t12\t0\r\n",
        "k61_4090\t270\t21\t0\r\n",
        "k61_4091\t432\t21\t0\r\n",
        "k61_4092\t224\t15\t0\r\n",
        "k61_4093\t513\t40\t0\r\n",
        "k61_4094\t214\t9\t0\r\n",
        "k61_4095\t351\t16\t0\r\n",
        "k61_4096\t1138\t79\t0\r\n",
        "k61_4097\t922\t72\t0\r\n",
        "k61_4098\t409\t29\t0\r\n",
        "k61_4099\t363\t43\t0\r\n",
        "k61_4100\t742\t85\t0\r\n",
        "k61_4101\t323\t16\t0\r\n",
        "k61_4102\t1508\t176\t0\r\n",
        "k61_4103\t229\t11\t0\r\n",
        "k61_4104\t697\t62\t0\r\n",
        "k61_4105\t208\t12\t0\r\n",
        "k61_4106\t316\t27\t0\r\n",
        "k61_4107\t1092\t105\t0\r\n",
        "k61_4108\t253\t7\t0\r\n",
        "k61_4109\t332\t21\t0\r\n",
        "k61_4110\t248\t10\t0\r\n",
        "k61_4111\t369\t16\t0\r\n",
        "k61_4112\t584\t41\t0\r\n",
        "k61_4113\t347\t17\t0\r\n",
        "k61_4114\t702\t64\t0\r\n",
        "k61_4115\t285\t19\t0\r\n",
        "k61_4117\t622\t46\t0\r\n",
        "k61_4118\t513\t33\t0\r\n",
        "k61_4119\t627\t49\t0\r\n",
        "k61_4121\t326\t22\t0\r\n",
        "k61_4122\t423\t49\t0\r\n",
        "k61_4123\t209\t15\t0\r\n",
        "k61_4124\t1736\t189\t0\r\n",
        "k61_4125\t466\t24\t0\r\n",
        "k61_4126\t771\t54\t0\r\n",
        "k61_4127\t232\t17\t0\r\n",
        "k61_4128\t212\t11\t0\r\n",
        "k61_4129\t1386\t162\t0\r\n",
        "k61_4130\t926\t85\t0\r\n",
        "k61_4131\t1856\t1116\t0\r\n",
        "k61_4132\t537\t42\t0\r\n",
        "k61_4133\t396\t34\t0\r\n",
        "k61_4135\t718\t53\t0\r\n",
        "k61_4136\t453\t41\t0\r\n",
        "k61_4138\t267\t20\t0\r\n",
        "k61_4139\t205\t9\t0\r\n",
        "k61_4140\t279\t17\t0\r\n",
        "k61_4141\t265\t11\t0\r\n",
        "k61_4142\t260\t33\t0\r\n",
        "k61_4143\t478\t31\t0\r\n",
        "k61_4144\t348\t20\t0\r\n",
        "k61_4145\t505\t41\t0\r\n",
        "k61_4146\t243\t18\t0\r\n",
        "k61_4147\t684\t64\t0\r\n",
        "k61_4148\t213\t17\t0\r\n",
        "k61_4149\t580\t47\t0\r\n",
        "k61_4150\t830\t73\t0\r\n",
        "k61_4151\t343\t29\t0\r\n",
        "k61_4152\t334\t17\t0\r\n",
        "k61_4153\t257\t17\t0\r\n",
        "k61_4154\t414\t43\t0\r\n",
        "k61_4155\t236\t9\t0\r\n",
        "k61_4156\t476\t43\t0\r\n",
        "k61_4157\t939\t91\t0\r\n",
        "k61_4159\t212\t6\t0\r\n",
        "k61_4160\t329\t31\t0\r\n",
        "k61_4161\t202\t9\t0\r\n",
        "k61_4162\t255\t18\t0\r\n",
        "k61_4163\t540\t48\t0\r\n",
        "k61_4164\t446\t43\t0\r\n",
        "k61_4165\t202\t6\t0\r\n",
        "k61_4166\t347\t29\t0\r\n",
        "k61_4167\t642\t49\t0\r\n",
        "k61_4168\t299\t17\t0\r\n",
        "k61_4170\t234\t9\t0\r\n",
        "k61_4171\t413\t27\t0\r\n",
        "k61_4172\t332\t27\t0\r\n",
        "k61_4173\t204\t10\t0\r\n",
        "k61_4174\t215\t8\t0\r\n",
        "k61_4175\t365\t25\t0\r\n",
        "k61_4176\t503\t33\t0\r\n",
        "k61_4177\t806\t82\t0\r\n",
        "k61_4178\t376\t23\t0\r\n",
        "k61_4179\t659\t56\t0\r\n",
        "k61_4180\t364\t22\t0\r\n",
        "k61_4181\t2296\t385\t0\r\n",
        "k61_4182\t441\t33\t0\r\n",
        "k61_4183\t831\t76\t0\r\n",
        "k61_4184\t835\t53\t0\r\n",
        "k61_4185\t200\t12\t0\r\n",
        "k61_4186\t653\t44\t0\r\n",
        "k61_4187\t367\t20\t0\r\n",
        "k61_4188\t252\t10\t0\r\n",
        "k61_4189\t446\t46\t0\r\n",
        "k61_4190\t295\t26\t0\r\n",
        "k61_4191\t1420\t122\t0\r\n",
        "k61_4192\t418\t30\t0\r\n",
        "k61_4193\t266\t18\t0\r\n",
        "k61_4194\t201\t8\t0\r\n",
        "k61_4195\t327\t19\t0\r\n",
        "k61_4196\t717\t49\t0\r\n",
        "k61_4197\t305\t29\t0\r\n",
        "k61_4200\t211\t17\t0\r\n",
        "k61_4201\t590\t46\t0\r\n",
        "k61_4202\t350\t25\t0\r\n",
        "k61_4203\t341\t27\t0\r\n",
        "k61_4204\t226\t11\t0\r\n",
        "k61_4205\t321\t8\t0\r\n",
        "k61_4206\t932\t128\t0\r\n",
        "k61_4207\t436\t22\t0\r\n",
        "k61_4208\t353\t32\t0\r\n",
        "k61_4209\t235\t7\t0\r\n",
        "k61_4210\t243\t9\t0\r\n",
        "k61_4211\t223\t16\t0\r\n",
        "k61_4212\t2040\t158\t0\r\n",
        "k61_4213\t363\t23\t0\r\n",
        "k61_4214\t202\t8\t0\r\n",
        "k61_4215\t393\t48\t0\r\n",
        "k61_4216\t825\t69\t0\r\n",
        "k61_4217\t658\t65\t0\r\n",
        "k61_4218\t396\t21\t0\r\n",
        "k61_4219\t282\t21\t0\r\n",
        "k61_4221\t218\t14\t0\r\n",
        "k61_4222\t302\t14\t0\r\n",
        "k61_4223\t209\t8\t0\r\n",
        "k61_4224\t753\t72\t0\r\n",
        "k61_4225\t242\t7\t0\r\n",
        "k61_4226\t604\t46\t0\r\n",
        "k61_4227\t269\t15\t0\r\n",
        "k61_4228\t232\t11\t0\r\n",
        "k61_4229\t321\t33\t0\r\n",
        "k61_4230\t207\t10\t0\r\n",
        "k61_4231\t400\t80\t0\r\n",
        "k61_4232\t321\t22\t0\r\n",
        "k61_4233\t1134\t115\t0\r\n",
        "k61_4234\t592\t46\t0\r\n",
        "k61_4235\t419\t20\t0\r\n",
        "k61_4236\t220\t9\t0\r\n",
        "k61_4238\t1056\t95\t0\r\n",
        "k61_4239\t611\t76\t0\r\n",
        "k61_4240\t254\t11\t0\r\n",
        "k61_4241\t346\t18\t0\r\n",
        "k61_4242\t479\t27\t0\r\n",
        "k61_4243\t277\t20\t0\r\n",
        "k61_4244\t263\t20\t0\r\n",
        "k61_4245\t416\t29\t0\r\n",
        "k61_4246\t403\t24\t0\r\n",
        "k61_4247\t1240\t129\t0\r\n",
        "k61_4248\t238\t14\t0\r\n",
        "k61_4249\t454\t61\t0\r\n",
        "k61_4250\t378\t37\t0\r\n",
        "k61_4251\t406\t36\t0\r\n",
        "k61_4252\t519\t42\t0\r\n",
        "k61_4253\t383\t32\t0\r\n",
        "k61_4254\t329\t25\t0\r\n",
        "k61_4255\t338\t15\t0\r\n",
        "k61_4256\t403\t29\t0\r\n",
        "k61_4257\t587\t40\t0\r\n",
        "k61_4258\t513\t40\t0\r\n",
        "k61_4259\t496\t49\t0\r\n",
        "k61_4260\t221\t6\t0\r\n",
        "k61_4261\t732\t66\t0\r\n",
        "k61_4262\t484\t44\t0\r\n",
        "k61_4264\t310\t23\t0\r\n",
        "k61_4265\t285\t33\t0\r\n",
        "k61_4266\t1185\t105\t0\r\n",
        "k61_4267\t362\t20\t0\r\n",
        "k61_4268\t593\t47\t0\r\n",
        "k61_4269\t337\t31\t0\r\n",
        "k61_4270\t293\t25\t0\r\n",
        "k61_4271\t284\t20\t0\r\n",
        "k61_4272\t320\t18\t0\r\n",
        "k61_4273\t218\t9\t0\r\n",
        "k61_4274\t260\t15\t0\r\n",
        "k61_4275\t909\t83\t0\r\n",
        "k61_4276\t580\t63\t0\r\n",
        "k61_4277\t1049\t107\t0\r\n",
        "k61_4278\t539\t33\t0\r\n",
        "k61_4279\t325\t32\t0\r\n",
        "k61_4280\t341\t18\t0\r\n",
        "k61_4281\t324\t20\t0\r\n",
        "k61_4282\t651\t62\t0\r\n",
        "k61_4283\t243\t10\t0\r\n",
        "k61_4284\t220\t8\t0\r\n",
        "k61_4285\t382\t30\t0\r\n",
        "k61_4286\t222\t15\t0\r\n",
        "k61_4287\t698\t49\t0\r\n",
        "k61_4288\t208\t10\t0\r\n",
        "k61_4289\t360\t14\t0\r\n",
        "k61_4290\t295\t36\t0\r\n",
        "k61_4291\t514\t45\t0\r\n",
        "k61_4292\t212\t11\t0\r\n",
        "k61_4293\t571\t48\t0\r\n",
        "k61_4294\t697\t68\t0\r\n",
        "k61_4295\t202\t18\t0\r\n",
        "k61_4296\t414\t44\t0\r\n",
        "k61_4297\t339\t33\t0\r\n",
        "k61_4298\t361\t21\t0\r\n",
        "k61_4299\t1166\t132\t0\r\n",
        "k61_4300\t330\t26\t0\r\n",
        "k61_4301\t269\t23\t0\r\n",
        "k61_4302\t297\t17\t0\r\n",
        "k61_4303\t265\t18\t0\r\n",
        "k61_4305\t599\t48\t0\r\n",
        "k61_4307\t414\t19\t0\r\n",
        "k61_4308\t692\t71\t0\r\n",
        "k61_4309\t264\t14\t0\r\n",
        "k61_4311\t819\t70\t0\r\n",
        "k61_4312\t201\t18\t0\r\n",
        "k61_4313\t506\t46\t0\r\n",
        "k61_4314\t383\t19\t0\r\n",
        "k61_4315\t341\t13\t0\r\n",
        "k61_4317\t215\t8\t0\r\n",
        "k61_4318\t373\t24\t0\r\n",
        "k61_4319\t1446\t129\t0\r\n",
        "k61_4320\t345\t24\t0\r\n",
        "k61_4322\t1418\t133\t0\r\n",
        "k61_4323\t255\t17\t0\r\n",
        "k61_4324\t279\t24\t0\r\n",
        "k61_4326\t374\t23\t0\r\n",
        "k61_4327\t549\t53\t0\r\n",
        "k61_4328\t228\t9\t0\r\n",
        "k61_4329\t326\t26\t0\r\n",
        "k61_4330\t286\t26\t0\r\n",
        "k61_4331\t432\t29\t0\r\n",
        "k61_4332\t221\t19\t0\r\n",
        "k61_4333\t311\t25\t0\r\n",
        "k61_4334\t1112\t123\t0\r\n",
        "k61_4335\t573\t44\t0\r\n",
        "k61_4336\t234\t10\t0\r\n",
        "k61_4337\t256\t15\t0\r\n",
        "k61_4339\t265\t16\t0\r\n",
        "k61_4340\t282\t19\t0\r\n",
        "k61_4341\t297\t11\t0\r\n",
        "k61_4342\t258\t13\t0\r\n",
        "k61_4343\t1528\t181\t0\r\n",
        "k61_4345\t615\t44\t0\r\n",
        "k61_4346\t342\t16\t0\r\n",
        "k61_4347\t237\t4\t0\r\n",
        "k61_4348\t395\t39\t0\r\n",
        "k61_4349\t424\t43\t0\r\n",
        "k61_4350\t400\t28\t0\r\n",
        "k61_4351\t885\t66\t0\r\n",
        "k61_4352\t346\t20\t0\r\n",
        "k61_4353\t350\t40\t0\r\n",
        "k61_4354\t625\t47\t0\r\n",
        "k61_4355\t525\t52\t0\r\n",
        "k61_4357\t256\t13\t0\r\n",
        "k61_4358\t1152\t97\t0\r\n",
        "k61_4359\t576\t38\t0\r\n",
        "k61_4360\t257\t17\t0\r\n",
        "k61_4361\t330\t18\t0\r\n",
        "k61_4362\t262\t13\t0\r\n",
        "k61_4363\t242\t32\t0\r\n",
        "k61_4364\t730\t63\t0\r\n",
        "k61_4365\t270\t30\t0\r\n",
        "k61_4366\t266\t13\t0\r\n",
        "k61_4367\t1979\t164\t0\r\n",
        "k61_4368\t360\t19\t0\r\n",
        "k61_4369\t609\t37\t0\r\n",
        "k61_4370\t652\t41\t0\r\n",
        "k61_4371\t482\t36\t0\r\n",
        "k61_4372\t240\t12\t0\r\n",
        "k61_4373\t340\t19\t0\r\n",
        "k61_4374\t1091\t105\t0\r\n",
        "k61_4375\t440\t31\t0\r\n",
        "k61_4376\t305\t23\t0\r\n",
        "k61_4377\t457\t35\t0\r\n",
        "k61_4378\t228\t10\t0\r\n",
        "k61_4379\t311\t24\t0\r\n",
        "k61_4380\t481\t54\t0\r\n",
        "k61_4381\t325\t21\t0\r\n",
        "k61_4382\t234\t10\t0\r\n",
        "k61_4383\t445\t29\t0\r\n",
        "k61_4384\t222\t5\t0\r\n",
        "k61_4385\t272\t25\t0\r\n",
        "k61_4386\t349\t22\t0\r\n",
        "k61_4387\t207\t8\t0\r\n",
        "k61_4388\t289\t11\t0\r\n",
        "k61_4390\t364\t27\t0\r\n",
        "k61_4391\t249\t16\t0\r\n",
        "k61_4392\t488\t71\t0\r\n",
        "k61_4393\t233\t25\t0\r\n",
        "k61_4395\t337\t11\t0\r\n",
        "k61_4397\t616\t64\t0\r\n",
        "k61_4398\t254\t8\t0\r\n",
        "k61_4399\t430\t17\t0\r\n",
        "k61_4400\t252\t10\t0\r\n",
        "k61_4401\t420\t30\t0\r\n",
        "k61_4402\t236\t12\t0\r\n",
        "k61_4403\t570\t59\t0\r\n",
        "k61_4404\t226\t19\t0\r\n",
        "k61_4405\t456\t55\t0\r\n",
        "k61_4406\t711\t81\t0\r\n",
        "k61_4407\t479\t41\t0\r\n",
        "k61_4409\t713\t65\t0\r\n",
        "k61_4410\t206\t6\t0\r\n",
        "k61_4411\t1860\t214\t0\r\n",
        "k61_4412\t593\t46\t0\r\n",
        "k61_4413\t233\t21\t0\r\n",
        "k61_4416\t296\t14\t0\r\n",
        "k61_4417\t1621\t156\t0\r\n",
        "k61_4418\t330\t26\t0\r\n",
        "k61_4419\t393\t30\t0\r\n",
        "k61_4420\t256\t10\t0\r\n",
        "k61_4421\t370\t46\t0\r\n",
        "k61_4422\t2231\t213\t0\r\n",
        "k61_4423\t286\t12\t0\r\n",
        "k61_4424\t593\t59\t0\r\n",
        "k61_4425\t215\t8\t0\r\n",
        "k61_4426\t304\t22\t0\r\n",
        "k61_4427\t592\t68\t0\r\n",
        "k61_4428\t526\t30\t0\r\n",
        "k61_4429\t295\t20\t0\r\n",
        "k61_4430\t262\t26\t0\r\n",
        "k61_4432\t537\t44\t0\r\n",
        "k61_4433\t834\t65\t0\r\n",
        "k61_4434\t464\t36\t0\r\n",
        "k61_4435\t219\t8\t0\r\n",
        "k61_4436\t220\t11\t0\r\n",
        "k61_4437\t311\t17\t0\r\n",
        "k61_4438\t313\t22\t0\r\n",
        "k61_4439\t476\t61\t0\r\n",
        "k61_4440\t1173\t125\t0\r\n",
        "k61_4441\t319\t14\t0\r\n",
        "k61_4443\t405\t27\t0\r\n",
        "k61_4444\t208\t14\t0\r\n",
        "k61_4445\t439\t29\t0\r\n",
        "k61_4446\t334\t21\t0\r\n",
        "k61_4448\t249\t9\t0\r\n",
        "k61_4449\t415\t31\t0\r\n",
        "k61_4450\t251\t23\t0\r\n",
        "k61_4451\t311\t15\t0\r\n",
        "k61_4452\t527\t43\t0\r\n",
        "k61_4453\t504\t44\t0\r\n",
        "k61_4454\t374\t23\t0\r\n",
        "k61_4455\t400\t32\t0\r\n",
        "k61_4456\t311\t27\t0\r\n",
        "k61_4457\t304\t25\t0\r\n",
        "k61_4458\t476\t39\t0\r\n",
        "k61_4459\t229\t16\t0\r\n",
        "k61_4460\t1248\t123\t0\r\n",
        "k61_4461\t497\t44\t0\r\n",
        "k61_4463\t305\t24\t0\r\n",
        "k61_4464\t994\t97\t0\r\n",
        "k61_4465\t316\t27\t0\r\n",
        "k61_4467\t483\t57\t0\r\n",
        "k61_4468\t219\t13\t0\r\n",
        "k61_4469\t297\t24\t0\r\n",
        "k61_4470\t422\t35\t0\r\n",
        "k61_4471\t288\t31\t0\r\n",
        "k61_4472\t219\t11\t0\r\n",
        "k61_4473\t291\t16\t0\r\n",
        "k61_4474\t232\t19\t0\r\n",
        "k61_4475\t528\t43\t0\r\n",
        "k61_4476\t2160\t205\t0\r\n",
        "k61_4477\t519\t37\t0\r\n",
        "k61_4478\t246\t12\t0\r\n",
        "k61_4479\t396\t37\t0\r\n",
        "k61_4480\t363\t48\t0\r\n",
        "k61_4482\t219\t21\t0\r\n",
        "k61_4483\t377\t33\t0\r\n",
        "k61_4484\t331\t16\t0\r\n",
        "k61_4485\t1603\t200\t0\r\n",
        "k61_4486\t291\t17\t0\r\n",
        "k61_4487\t360\t21\t0\r\n",
        "k61_4488\t433\t31\t0\r\n",
        "k61_4489\t409\t29\t0\r\n",
        "k61_4490\t414\t34\t0\r\n",
        "k61_4491\t202\t7\t0\r\n",
        "k61_4492\t231\t18\t0\r\n",
        "k61_4493\t206\t8\t0\r\n",
        "k61_4494\t206\t13\t0\r\n",
        "k61_4496\t394\t25\t0\r\n",
        "k61_4497\t397\t20\t0\r\n",
        "k61_4498\t482\t36\t0\r\n",
        "k61_4499\t385\t32\t0\r\n",
        "k61_4500\t334\t37\t0\r\n",
        "k61_4502\t434\t58\t0\r\n",
        "k61_4503\t334\t26\t0\r\n",
        "k61_4504\t868\t70\t0\r\n",
        "k61_4506\t211\t12\t0\r\n",
        "k61_4508\t429\t38\t0\r\n",
        "k61_4509\t752\t64\t0\r\n",
        "k61_4510\t307\t14\t0\r\n",
        "k61_4511\t269\t11\t0\r\n",
        "k61_4512\t323\t28\t0\r\n",
        "k61_4513\t320\t29\t0\r\n",
        "k61_4514\t241\t12\t0\r\n",
        "k61_4517\t369\t16\t0\r\n",
        "k61_4518\t624\t56\t0\r\n",
        "k61_4519\t249\t22\t0\r\n",
        "k61_4520\t296\t17\t0\r\n",
        "k61_4521\t478\t28\t0\r\n",
        "k61_4522\t782\t62\t0\r\n",
        "k61_4523\t292\t25\t0\r\n",
        "k61_4524\t299\t29\t0\r\n",
        "k61_4525\t1098\t107\t0\r\n",
        "k61_4526\t299\t20\t0\r\n",
        "k61_4527\t264\t21\t0\r\n",
        "k61_4528\t512\t49\t0\r\n",
        "k61_4529\t462\t37\t0\r\n",
        "k61_4530\t650\t71\t0\r\n",
        "k61_4532\t937\t64\t0\r\n",
        "k61_4533\t645\t68\t0\r\n",
        "k61_4534\t324\t16\t0\r\n",
        "k61_4535\t216\t20\t0\r\n",
        "k61_4536\t651\t71\t0\r\n",
        "k61_4537\t480\t31\t0\r\n",
        "k61_4538\t211\t10\t0\r\n",
        "k61_4539\t388\t25\t0\r\n",
        "k61_4540\t388\t34\t0\r\n",
        "k61_4541\t202\t8\t0\r\n",
        "k61_4543\t728\t59\t0\r\n",
        "k61_4544\t1026\t75\t0\r\n",
        "k61_4545\t508\t36\t0\r\n",
        "k61_4546\t309\t25\t0\r\n",
        "k61_4547\t1427\t143\t0\r\n",
        "k61_4548\t350\t24\t0\r\n",
        "k61_4549\t258\t9\t0\r\n",
        "k61_4550\t295\t21\t0\r\n",
        "k61_4551\t410\t43\t0\r\n",
        "k61_4552\t854\t80\t0\r\n",
        "k61_4553\t1024\t120\t0\r\n",
        "k61_4554\t295\t13\t0\r\n",
        "k61_4555\t526\t54\t0\r\n",
        "k61_4556\t328\t21\t0\r\n",
        "k61_4557\t202\t8\t0\r\n",
        "k61_4558\t261\t9\t0\r\n",
        "k61_4559\t318\t36\t0\r\n",
        "k61_4560\t287\t43\t0\r\n",
        "k61_4562\t289\t11\t0\r\n",
        "k61_4563\t628\t64\t0\r\n",
        "k61_4565\t446\t42\t0\r\n",
        "k61_4566\t263\t9\t0\r\n",
        "k61_4567\t418\t30\t0\r\n",
        "k61_4568\t452\t29\t0\r\n",
        "k61_4569\t316\t25\t0\r\n",
        "k61_4571\t358\t24\t0\r\n",
        "k61_4572\t286\t24\t0\r\n",
        "k61_4573\t1110\t1117\t0\r\n",
        "k61_4574\t566\t35\t0\r\n",
        "k61_4575\t253\t13\t0\r\n",
        "k61_4577\t286\t15\t0\r\n",
        "k61_4578\t1324\t117\t0\r\n",
        "k61_4579\t202\t19\t0\r\n",
        "k61_4580\t327\t20\t0\r\n",
        "k61_4581\t308\t11\t0\r\n",
        "k61_4582\t392\t40\t0\r\n",
        "k61_4583\t369\t481\t0\r\n",
        "k61_4585\t929\t97\t0\r\n",
        "k61_4587\t307\t16\t0\r\n",
        "k61_4588\t242\t12\t0\r\n",
        "k61_4589\t288\t31\t0\r\n",
        "k61_4590\t358\t23\t0\r\n",
        "k61_4591\t240\t9\t0\r\n",
        "k61_4593\t579\t42\t0\r\n",
        "k61_4594\t257\t12\t0\r\n",
        "k61_4595\t478\t50\t0\r\n",
        "k61_4597\t543\t53\t0\r\n",
        "k61_4598\t390\t32\t0\r\n",
        "k61_4599\t429\t16\t0\r\n",
        "k61_4600\t225\t8\t0\r\n",
        "k61_4601\t240\t11\t0\r\n",
        "k61_4602\t228\t9\t0\r\n",
        "k61_4603\t246\t21\t0\r\n",
        "k61_4605\t855\t69\t0\r\n",
        "k61_4606\t279\t24\t0\r\n",
        "k61_4607\t226\t8\t0\r\n",
        "k61_4608\t640\t51\t0\r\n",
        "k61_4609\t843\t104\t0\r\n",
        "k61_4610\t281\t10\t0\r\n",
        "k61_4611\t410\t40\t0\r\n",
        "k61_4612\t468\t51\t0\r\n",
        "k61_4613\t283\t22\t0\r\n",
        "k61_4614\t295\t9\t0\r\n",
        "k61_4616\t228\t15\t0\r\n",
        "k61_4617\t924\t100\t0\r\n",
        "k61_4618\t1343\t125\t0\r\n",
        "k61_4619\t244\t10\t0\r\n",
        "k61_4620\t300\t14\t0\r\n",
        "k61_4621\t284\t19\t0\r\n",
        "k61_4622\t248\t12\t0\r\n",
        "k61_4623\t316\t22\t0\r\n",
        "k61_4624\t214\t11\t0\r\n",
        "k61_4625\t339\t30\t0\r\n",
        "k61_4626\t245\t15\t0\r\n",
        "k61_4627\t239\t12\t0\r\n",
        "k61_4628\t218\t12\t0\r\n",
        "k61_4629\t207\t20\t0\r\n",
        "k61_4630\t239\t13\t0\r\n",
        "k61_4631\t298\t22\t0\r\n",
        "k61_4632\t211\t15\t0\r\n",
        "k61_4633\t233\t16\t0\r\n",
        "k61_4634\t231\t10\t0\r\n",
        "k61_4635\t256\t23\t0\r\n",
        "k61_4636\t323\t17\t0\r\n",
        "k61_4638\t455\t30\t0\r\n",
        "k61_4640\t293\t10\t0\r\n",
        "k61_4641\t273\t10\t0\r\n",
        "k61_4642\t210\t24\t0\r\n",
        "k61_4643\t728\t75\t0\r\n",
        "k61_4644\t213\t8\t0\r\n",
        "k61_4645\t216\t12\t0\r\n",
        "k61_4646\t309\t21\t0\r\n",
        "k61_4647\t597\t42\t0\r\n",
        "k61_4648\t517\t47\t0\r\n",
        "k61_4649\t449\t20\t0\r\n",
        "k61_4650\t759\t52\t0\r\n",
        "k61_4651\t654\t48\t0\r\n",
        "k61_4654\t533\t40\t0\r\n",
        "k61_4655\t355\t28\t0\r\n",
        "k61_4656\t264\t22\t0\r\n",
        "k61_4657\t239\t16\t0\r\n",
        "k61_4658\t326\t32\t0\r\n",
        "k61_4659\t405\t16\t0\r\n",
        "k61_4660\t351\t24\t0\r\n",
        "k61_4661\t296\t26\t0\r\n",
        "k61_4662\t263\t17\t0\r\n",
        "k61_4663\t549\t40\t0\r\n",
        "k61_4664\t291\t22\t0\r\n",
        "k61_4665\t260\t13\t0\r\n",
        "k61_4666\t409\t28\t0\r\n",
        "k61_4667\t250\t10\t0\r\n",
        "k61_4668\t273\t16\t0\r\n",
        "k61_4669\t251\t9\t0\r\n",
        "k61_4671\t353\t30\t0\r\n",
        "k61_4672\t460\t38\t0\r\n",
        "k61_4673\t272\t20\t0\r\n",
        "k61_4674\t265\t14\t0\r\n",
        "k61_4675\t657\t54\t0\r\n",
        "k61_4676\t273\t20\t0\r\n",
        "k61_4677\t630\t54\t0\r\n",
        "k61_4678\t208\t9\t0\r\n",
        "k61_4679\t327\t23\t0\r\n",
        "k61_4680\t510\t73\t0\r\n",
        "k61_4681\t316\t24\t0\r\n",
        "k61_4683\t1685\t194\t0\r\n",
        "k61_4684\t216\t43\t0\r\n",
        "k61_4685\t292\t12\t0\r\n",
        "k61_4686\t273\t22\t0\r\n",
        "k61_4687\t336\t18\t0\r\n",
        "k61_4688\t339\t21\t0\r\n",
        "k61_4689\t680\t48\t0\r\n",
        "k61_4690\t856\t80\t0\r\n",
        "k61_4691\t629\t43\t0\r\n",
        "k61_4692\t1240\t108\t0\r\n",
        "k61_4693\t296\t27\t0\r\n",
        "k61_4694\t228\t16\t0\r\n",
        "k61_4695\t1362\t136\t0\r\n",
        "k61_4696\t530\t52\t0\r\n",
        "k61_4697\t454\t32\t0\r\n",
        "k61_4698\t536\t46\t0\r\n",
        "k61_4699\t207\t10\t0\r\n",
        "k61_4700\t703\t62\t0\r\n",
        "k61_4702\t392\t25\t0\r\n",
        "k61_4703\t450\t21\t0\r\n",
        "k61_4704\t231\t10\t0\r\n",
        "k61_4705\t264\t9\t0\r\n",
        "k61_4706\t505\t39\t0\r\n",
        "k61_4707\t702\t75\t0\r\n",
        "k61_4708\t236\t17\t0\r\n",
        "k61_4709\t710\t56\t0\r\n",
        "k61_4710\t390\t33\t0\r\n",
        "k61_4711\t542\t34\t0\r\n",
        "k61_4712\t380\t16\t0\r\n",
        "k61_4713\t589\t44\t0\r\n",
        "k61_4714\t510\t34\t0\r\n",
        "k61_4715\t329\t16\t0\r\n",
        "k61_4716\t370\t26\t0\r\n",
        "k61_4719\t329\t15\t0\r\n",
        "k61_4720\t440\t37\t0\r\n",
        "k61_4721\t619\t46\t0\r\n",
        "k61_4722\t593\t57\t0\r\n",
        "k61_4723\t645\t63\t0\r\n",
        "k61_4727\t246\t13\t0\r\n",
        "k61_4728\t436\t33\t0\r\n",
        "k61_4729\t201\t7\t0\r\n",
        "k61_4731\t733\t56\t0\r\n",
        "k61_4732\t439\t33\t0\r\n",
        "k61_4734\t228\t12\t0\r\n",
        "k61_4735\t719\t71\t0\r\n",
        "k61_4736\t355\t36\t0\r\n",
        "k61_4737\t345\t38\t0\r\n",
        "k61_4738\t246\t15\t0\r\n",
        "k61_4739\t309\t23\t0\r\n",
        "k61_4740\t378\t37\t0\r\n",
        "k61_4741\t302\t34\t0\r\n",
        "k61_4742\t468\t57\t0\r\n",
        "k61_4744\t364\t22\t0\r\n",
        "k61_4745\t472\t56\t0\r\n",
        "k61_4746\t233\t13\t0\r\n",
        "k61_4747\t262\t8\t0\r\n",
        "k61_4748\t2168\t221\t0\r\n",
        "k61_4749\t865\t1070\t0\r\n",
        "k61_4751\t676\t66\t0\r\n",
        "k61_4752\t200\t9\t0\r\n",
        "k61_4753\t220\t8\t0\r\n",
        "k61_4754\t873\t77\t0\r\n",
        "k61_4755\t680\t51\t0\r\n",
        "k61_4756\t238\t15\t0\r\n",
        "k61_4757\t452\t26\t0\r\n",
        "k61_4758\t415\t33\t0\r\n",
        "k61_4759\t1040\t189\t0\r\n",
        "k61_4760\t5189\t809\t0\r\n",
        "k61_4761\t204\t10\t0\r\n",
        "k61_4762\t268\t20\t0\r\n",
        "k61_4763\t293\t26\t0\r\n",
        "k61_4764\t408\t27\t0\r\n",
        "k61_4765\t687\t47\t0\r\n",
        "k61_4766\t279\t22\t0\r\n",
        "k61_4767\t221\t7\t0\r\n",
        "k61_4769\t253\t21\t0\r\n",
        "k61_4770\t255\t10\t0\r\n",
        "k61_4771\t224\t51\t0\r\n",
        "k61_4772\t381\t25\t0\r\n",
        "k61_4773\t242\t12\t0\r\n",
        "k61_4774\t565\t63\t0\r\n",
        "k61_4775\t393\t31\t0\r\n",
        "k61_4776\t483\t42\t0\r\n",
        "k61_4777\t240\t10\t0\r\n",
        "k61_4778\t355\t12\t0\r\n",
        "k61_4779\t321\t23\t0\r\n",
        "k61_4780\t778\t54\t0\r\n",
        "k61_4781\t332\t22\t0\r\n",
        "k61_4782\t223\t20\t0\r\n",
        "k61_4783\t543\t55\t0\r\n",
        "k61_4784\t461\t21\t0\r\n",
        "k61_4785\t671\t43\t0\r\n",
        "k61_4786\t1606\t158\t0\r\n",
        "k61_4787\t257\t10\t0\r\n",
        "k61_4788\t631\t51\t0\r\n",
        "k61_4789\t257\t21\t0\r\n",
        "k61_4790\t463\t35\t0\r\n",
        "k61_4791\t243\t31\t0\r\n",
        "k61_4792\t678\t65\t0\r\n",
        "k61_4793\t237\t14\t0\r\n",
        "k61_4794\t1207\t148\t0\r\n",
        "k61_4795\t830\t84\t0\r\n",
        "k61_4796\t216\t6\t0\r\n",
        "k61_4797\t261\t17\t0\r\n",
        "k61_4798\t321\t13\t0\r\n",
        "k61_4799\t276\t38\t0\r\n",
        "k61_4800\t397\t16\t0\r\n",
        "k61_4801\t285\t14\t0\r\n",
        "k61_4803\t603\t41\t0\r\n",
        "k61_4804\t1550\t201\t0\r\n",
        "k61_4805\t284\t20\t0\r\n",
        "k61_4806\t213\t10\t0\r\n",
        "k61_4807\t464\t41\t0\r\n",
        "k61_4808\t1815\t170\t0\r\n",
        "k61_4809\t201\t9\t0\r\n",
        "k61_4810\t307\t27\t0\r\n",
        "k61_4811\t672\t58\t0\r\n",
        "k61_4812\t311\t18\t0\r\n",
        "k61_4813\t335\t16\t0\r\n",
        "k61_4814\t1294\t109\t0\r\n",
        "k61_4816\t252\t15\t0\r\n",
        "k61_4817\t383\t42\t0\r\n",
        "k61_4818\t312\t22\t0\r\n",
        "k61_4819\t1122\t137\t0\r\n",
        "k61_4820\t222\t12\t0\r\n",
        "k61_4822\t556\t52\t0\r\n",
        "k61_4823\t220\t9\t0\r\n",
        "k61_4825\t363\t60\t0\r\n",
        "k61_4826\t344\t85\t0\r\n",
        "k61_4829\t267\t13\t0\r\n",
        "k61_4830\t688\t55\t0\r\n",
        "k61_4831\t230\t10\t0\r\n",
        "k61_4832\t573\t52\t0\r\n",
        "k61_4833\t397\t28\t0\r\n",
        "k61_4834\t536\t44\t0\r\n",
        "k61_4835\t435\t33\t0\r\n",
        "k61_4836\t2566\t258\t0\r\n",
        "k61_4837\t236\t17\t0\r\n",
        "k61_4838\t501\t42\t0\r\n",
        "k61_4840\t231\t12\t0\r\n",
        "k61_4841\t552\t31\t0\r\n",
        "k61_4842\t951\t102\t0\r\n",
        "k61_4843\t396\t30\t0\r\n",
        "k61_4844\t849\t72\t0\r\n",
        "k61_4846\t278\t15\t0\r\n",
        "k61_4848\t321\t15\t0\r\n",
        "k61_4849\t763\t64\t0\r\n",
        "k61_4850\t414\t50\t0\r\n",
        "k61_4851\t529\t46\t0\r\n",
        "k61_4852\t301\t9\t0\r\n",
        "k61_4853\t212\t13\t0\r\n",
        "k61_4855\t349\t16\t0\r\n",
        "k61_4856\t233\t9\t0\r\n",
        "k61_4857\t372\t40\t0\r\n",
        "k61_4858\t212\t8\t0\r\n",
        "k61_4859\t265\t24\t0\r\n",
        "k61_4860\t232\t12\t0\r\n",
        "k61_4861\t770\t57\t0\r\n",
        "k61_4864\t227\t23\t0\r\n",
        "k61_4865\t347\t32\t0\r\n",
        "k61_4866\t290\t11\t0\r\n",
        "k61_4867\t206\t12\t0\r\n",
        "k61_4868\t279\t11\t0\r\n",
        "k61_4869\t202\t8\t0\r\n",
        "k61_4870\t211\t11\t0\r\n",
        "k61_4871\t819\t107\t0\r\n",
        "k61_4873\t210\t11\t0\r\n",
        "k61_4874\t407\t30\t0\r\n",
        "k61_4876\t209\t16\t0\r\n",
        "k61_4877\t590\t69\t0\r\n",
        "k61_4878\t310\t24\t0\r\n",
        "k61_4879\t391\t28\t0\r\n",
        "k61_4880\t343\t47\t0\r\n",
        "k61_4881\t478\t29\t0\r\n",
        "k61_4882\t465\t45\t0\r\n",
        "k61_4883\t286\t12\t0\r\n",
        "k61_4884\t218\t15\t0\r\n",
        "k61_4885\t528\t37\t0\r\n",
        "k61_4888\t893\t79\t0\r\n",
        "k61_4889\t230\t12\t0\r\n",
        "k61_4890\t207\t16\t0\r\n",
        "k61_4891\t348\t48\t0\r\n",
        "k61_4892\t511\t41\t0\r\n",
        "k61_4893\t207\t9\t0\r\n",
        "k61_4894\t295\t14\t0\r\n",
        "k61_4895\t316\t34\t0\r\n",
        "k61_4896\t252\t6\t0\r\n",
        "k61_4897\t237\t12\t0\r\n",
        "k61_4898\t211\t13\t0\r\n",
        "k61_4899\t347\t41\t0\r\n",
        "k61_4900\t349\t28\t0\r\n",
        "k61_4901\t323\t21\t0\r\n",
        "k61_4902\t312\t24\t0\r\n",
        "k61_4903\t775\t67\t0\r\n",
        "k61_4904\t456\t43\t0\r\n",
        "k61_4905\t201\t10\t0\r\n",
        "k61_4906\t429\t25\t0\r\n",
        "k61_4908\t764\t84\t0\r\n",
        "k61_4909\t2409\t230\t0\r\n",
        "k61_4910\t720\t59\t0\r\n",
        "k61_4911\t1031\t86\t0\r\n",
        "k61_4912\t259\t18\t0\r\n",
        "k61_4913\t470\t33\t0\r\n",
        "k61_4914\t462\t32\t0\r\n",
        "k61_4915\t214\t16\t0\r\n",
        "k61_4917\t221\t13\t0\r\n",
        "k61_4919\t851\t66\t0\r\n",
        "k61_4920\t302\t29\t0\r\n",
        "k61_4921\t549\t55\t0\r\n",
        "k61_4922\t209\t8\t0\r\n",
        "k61_4923\t268\t26\t0\r\n",
        "k61_4924\t605\t60\t0\r\n",
        "k61_4925\t436\t51\t0\r\n",
        "k61_4926\t236\t11\t0\r\n",
        "k61_4927\t320\t25\t0\r\n",
        "k61_4929\t387\t37\t0\r\n",
        "k61_4930\t319\t37\t0\r\n",
        "k61_4931\t358\t20\t0\r\n",
        "k61_4933\t212\t13\t0\r\n",
        "k61_4936\t208\t17\t0\r\n",
        "k61_4938\t403\t23\t0\r\n",
        "k61_4939\t450\t41\t0\r\n",
        "k61_4940\t408\t69\t0\r\n",
        "k61_4941\t208\t10\t0\r\n",
        "k61_4942\t959\t111\t0\r\n",
        "k61_4943\t513\t30\t0\r\n",
        "k61_4944\t914\t79\t0\r\n",
        "k61_4945\t245\t9\t0\r\n",
        "k61_4946\t923\t66\t0\r\n",
        "k61_4948\t396\t28\t0\r\n",
        "k61_4949\t491\t36\t0\r\n",
        "k61_4950\t262\t9\t0\r\n",
        "k61_4951\t320\t16\t0\r\n",
        "k61_4952\t389\t24\t0\r\n",
        "k61_4953\t271\t9\t0\r\n",
        "k61_4954\t271\t13\t0\r\n",
        "k61_4955\t273\t20\t0\r\n",
        "k61_4957\t528\t28\t0\r\n",
        "k61_4958\t409\t17\t0\r\n",
        "k61_4959\t415\t43\t0\r\n",
        "k61_4960\t434\t15\t0\r\n",
        "k61_4961\t287\t20\t0\r\n",
        "k61_4962\t323\t29\t0\r\n",
        "k61_4963\t333\t27\t0\r\n",
        "k61_4964\t294\t14\t0\r\n",
        "k61_4965\t1116\t118\t0\r\n",
        "k61_4966\t200\t15\t0\r\n",
        "k61_4967\t209\t9\t0\r\n",
        "k61_4968\t310\t18\t0\r\n",
        "k61_4969\t249\t13\t0\r\n",
        "k61_4970\t330\t21\t0\r\n",
        "k61_4971\t360\t24\t0\r\n",
        "k61_4972\t262\t26\t0\r\n",
        "k61_4974\t281\t16\t0\r\n",
        "k61_4975\t302\t16\t0\r\n",
        "k61_4977\t205\t9\t0\r\n",
        "k61_4978\t1030\t113\t0\r\n",
        "k61_4979\t240\t9\t0\r\n",
        "k61_4980\t218\t10\t0\r\n",
        "k61_4981\t908\t1091\t0\r\n",
        "k61_4982\t1484\t248\t0\r\n",
        "k61_4983\t210\t5\t0\r\n",
        "k61_4984\t393\t17\t0\r\n",
        "k61_4985\t291\t12\t0\r\n",
        "k61_4987\t234\t10\t0\r\n",
        "k61_4988\t709\t65\t0\r\n",
        "k61_4989\t296\t18\t0\r\n",
        "k61_4990\t308\t22\t0\r\n",
        "k61_4991\t653\t52\t0\r\n",
        "k61_4993\t264\t25\t0\r\n",
        "k61_4994\t204\t7\t0\r\n",
        "k61_4995\t989\t78\t0\r\n",
        "k61_4996\t507\t42\t0\r\n",
        "k61_4997\t236\t8\t0\r\n",
        "k61_4998\t212\t8\t0\r\n",
        "k61_4999\t699\t49\t0\r\n",
        "k61_5000\t1032\t96\t0\r\n",
        "k61_5001\t351\t32\t0\r\n",
        "k61_5004\t253\t11\t0\r\n",
        "k61_5006\t211\t12\t0\r\n",
        "k61_5007\t247\t12\t0\r\n",
        "k61_5008\t280\t13\t0\r\n",
        "k61_5009\t562\t39\t0\r\n",
        "k61_5010\t281\t17\t0\r\n",
        "k61_5012\t464\t46\t0\r\n",
        "k61_5013\t968\t71\t0\r\n",
        "k61_5015\t214\t17\t0\r\n",
        "k61_5016\t934\t101\t0\r\n",
        "k61_5017\t237\t9\t0\r\n",
        "k61_5018\t568\t51\t0\r\n",
        "k61_5019\t564\t63\t0\r\n",
        "k61_5021\t922\t79\t0\r\n",
        "k61_5022\t224\t12\t0\r\n",
        "k61_5023\t1354\t108\t0\r\n",
        "k61_5024\t312\t27\t0\r\n",
        "k61_5025\t651\t37\t0\r\n",
        "k61_5026\t400\t31\t0\r\n",
        "k61_5028\t285\t19\t0\r\n",
        "k61_5029\t205\t6\t0\r\n",
        "k61_5030\t274\t7\t0\r\n",
        "k61_5031\t373\t30\t0\r\n",
        "k61_5032\t225\t8\t0\r\n",
        "k61_5033\t354\t19\t0\r\n",
        "k61_5034\t356\t17\t0\r\n",
        "k61_5035\t392\t19\t0\r\n",
        "k61_5036\t362\t23\t0\r\n",
        "k61_5037\t258\t10\t0\r\n",
        "k61_5038\t202\t9\t0\r\n",
        "k61_5039\t246\t24\t0\r\n",
        "k61_5040\t257\t16\t0\r\n",
        "k61_5041\t604\t59\t0\r\n",
        "k61_5042\t332\t21\t0\r\n",
        "k61_5043\t215\t13\t0\r\n",
        "k61_5044\t736\t57\t0\r\n",
        "k61_5045\t260\t19\t0\r\n",
        "k61_5046\t241\t13\t0\r\n",
        "k61_5047\t278\t14\t0\r\n",
        "k61_5048\t396\t48\t0\r\n",
        "k61_5049\t207\t10\t0\r\n",
        "k61_5050\t288\t17\t0\r\n",
        "k61_5051\t1880\t2699\t0\r\n",
        "k61_5052\t217\t7\t0\r\n",
        "k61_5053\t408\t31\t0\r\n",
        "k61_5054\t548\t46\t0\r\n",
        "k61_5055\t207\t8\t0\r\n",
        "k61_5056\t303\t18\t0\r\n",
        "k61_5057\t201\t6\t0\r\n",
        "k61_5058\t249\t19\t0\r\n",
        "k61_5059\t495\t34\t0\r\n",
        "k61_5060\t306\t14\t0\r\n",
        "k61_5061\t229\t23\t0\r\n",
        "k61_5062\t265\t29\t0\r\n",
        "k61_5063\t200\t13\t0\r\n",
        "k61_5064\t282\t15\t0\r\n",
        "k61_5065\t935\t65\t0\r\n",
        "k61_5066\t386\t31\t0\r\n",
        "k61_5067\t513\t58\t0\r\n",
        "k61_5068\t201\t8\t0\r\n",
        "k61_5069\t234\t13\t0\r\n",
        "k61_5070\t203\t14\t0\r\n",
        "k61_5071\t206\t7\t0\r\n",
        "k61_5072\t429\t36\t0\r\n",
        "k61_5073\t211\t7\t0\r\n",
        "k61_5074\t275\t12\t0\r\n",
        "k61_5075\t201\t23\t0\r\n",
        "k61_5076\t827\t73\t0\r\n",
        "k61_5077\t288\t14\t0\r\n",
        "k61_5078\t971\t78\t0\r\n",
        "k61_5079\t421\t31\t0\r\n",
        "k61_5080\t295\t22\t0\r\n",
        "k61_5081\t298\t17\t0\r\n",
        "k61_5082\t216\t7\t0\r\n",
        "k61_5083\t280\t18\t0\r\n",
        "k61_5084\t292\t12\t0\r\n",
        "k61_5085\t272\t25\t0\r\n",
        "k61_5086\t336\t23\t0\r\n",
        "k61_5087\t281\t15\t0\r\n",
        "k61_5088\t465\t51\t0\r\n",
        "k61_5089\t227\t9\t0\r\n",
        "k61_5090\t393\t19\t0\r\n",
        "k61_5091\t344\t24\t0\r\n",
        "k61_5092\t420\t22\t0\r\n",
        "k61_5093\t464\t37\t0\r\n",
        "k61_5094\t312\t29\t0\r\n",
        "k61_5095\t777\t66\t0\r\n",
        "k61_5096\t320\t14\t0\r\n",
        "k61_5097\t270\t17\t0\r\n",
        "k61_5098\t232\t12\t0\r\n",
        "k61_5099\t573\t41\t0\r\n",
        "k61_5100\t321\t30\t0\r\n",
        "k61_5101\t309\t23\t0\r\n",
        "k61_5102\t429\t32\t0\r\n",
        "k61_5103\t410\t37\t0\r\n",
        "k61_5104\t1569\t171\t0\r\n",
        "k61_5105\t273\t23\t0\r\n",
        "k61_5107\t313\t17\t0\r\n",
        "k61_5108\t301\t22\t0\r\n",
        "k61_5109\t294\t167\t0\r\n",
        "k61_5110\t301\t18\t0\r\n",
        "k61_5111\t320\t21\t0\r\n",
        "k61_5112\t456\t45\t0\r\n",
        "k61_5113\t220\t14\t0\r\n",
        "k61_5114\t388\t32\t0\r\n",
        "k61_5115\t249\t15\t0\r\n",
        "k61_5116\t430\t41\t0\r\n",
        "k61_5117\t438\t31\t0\r\n",
        "k61_5119\t252\t7\t0\r\n",
        "k61_5120\t313\t13\t0\r\n",
        "k61_5121\t345\t34\t0\r\n",
        "k61_5122\t470\t35\t0\r\n",
        "k61_5123\t717\t92\t0\r\n",
        "k61_5124\t224\t16\t0\r\n",
        "k61_5125\t304\t21\t0\r\n",
        "k61_5126\t595\t43\t0\r\n",
        "k61_5128\t315\t24\t0\r\n",
        "k61_5129\t386\t21\t0\r\n",
        "k61_5130\t399\t25\t0\r\n",
        "k61_5131\t228\t17\t0\r\n",
        "k61_5133\t210\t11\t0\r\n",
        "k61_5134\t529\t50\t0\r\n",
        "k61_5135\t364\t17\t0\r\n",
        "k61_5136\t320\t23\t0\r\n",
        "k61_5137\t386\t33\t0\r\n",
        "k61_5138\t208\t18\t0\r\n",
        "k61_5139\t316\t20\t0\r\n",
        "k61_5140\t214\t16\t0\r\n",
        "k61_5141\t428\t32\t0\r\n",
        "k61_5142\t1227\t106\t0\r\n",
        "k61_5143\t324\t18\t0\r\n",
        "k61_5144\t341\t12\t0\r\n",
        "k61_5147\t442\t21\t0\r\n",
        "k61_5148\t208\t17\t0\r\n",
        "k61_5151\t441\t33\t0\r\n",
        "k61_5152\t299\t32\t0\r\n",
        "k61_5153\t447\t29\t0\r\n",
        "k61_5154\t212\t20\t0\r\n",
        "k61_5155\t216\t15\t0\r\n",
        "k61_5156\t773\t66\t0\r\n",
        "k61_5157\t200\t6\t0\r\n",
        "k61_5158\t413\t41\t0\r\n",
        "k61_5159\t759\t40\t0\r\n",
        "k61_5160\t471\t40\t0\r\n",
        "k61_5161\t315\t24\t0\r\n",
        "k61_5162\t1315\t1738\t0\r\n",
        "k61_5163\t725\t77\t0\r\n",
        "k61_5164\t883\t62\t0\r\n",
        "k61_5165\t247\t22\t0\r\n",
        "k61_5166\t458\t19\t0\r\n",
        "k61_5167\t2234\t185\t0\r\n",
        "k61_5168\t357\t18\t0\r\n",
        "k61_5169\t299\t14\t0\r\n",
        "k61_5170\t271\t12\t0\r\n",
        "k61_5171\t290\t23\t0\r\n",
        "k61_5172\t321\t48\t0\r\n",
        "k61_5173\t266\t22\t0\r\n",
        "k61_5174\t266\t16\t0\r\n",
        "k61_5175\t201\t8\t0\r\n",
        "k61_5176\t685\t56\t0\r\n",
        "k61_5177\t291\t19\t0\r\n",
        "k61_5178\t273\t11\t0\r\n",
        "k61_5179\t208\t12\t0\r\n",
        "k61_5180\t318\t32\t0\r\n",
        "k61_5181\t231\t11\t0\r\n",
        "k61_5182\t1195\t123\t0\r\n",
        "k61_5183\t1069\t91\t0\r\n",
        "k61_5185\t1217\t118\t0\r\n",
        "k61_5186\t322\t35\t0\r\n",
        "k61_5187\t242\t16\t0\r\n",
        "k61_5188\t222\t26\t0\r\n",
        "k61_5190\t448\t22\t0\r\n",
        "k61_5191\t553\t35\t0\r\n",
        "k61_5192\t334\t14\t0\r\n",
        "k61_5193\t243\t10\t0\r\n",
        "k61_5194\t251\t12\t0\r\n",
        "k61_5195\t210\t21\t0\r\n",
        "k61_5196\t251\t11\t0\r\n",
        "k61_5197\t364\t34\t0\r\n",
        "k61_5198\t1343\t124\t0\r\n",
        "k61_5200\t1093\t88\t0\r\n",
        "k61_5201\t275\t11\t0\r\n",
        "k61_5202\t341\t22\t0\r\n",
        "k61_5204\t312\t18\t0\r\n",
        "k61_5205\t217\t66\t0\r\n",
        "k61_5207\t543\t32\t0\r\n",
        "k61_5208\t1335\t134\t0\r\n",
        "k61_5209\t693\t59\t0\r\n",
        "k61_5211\t261\t25\t0\r\n",
        "k61_5212\t284\t19\t0\r\n",
        "k61_5213\t823\t61\t0\r\n",
        "k61_5214\t323\t22\t0\r\n",
        "k61_5215\t651\t30\t0\r\n",
        "k61_5216\t1275\t128\t0\r\n",
        "k61_5217\t205\t10\t0\r\n",
        "k61_5218\t373\t20\t0\r\n",
        "k61_5219\t268\t21\t0\r\n",
        "k61_5220\t756\t61\t0\r\n",
        "k61_5221\t362\t37\t0\r\n",
        "k61_5222\t506\t35\t0\r\n",
        "k61_5223\t638\t60\t0\r\n",
        "k61_5225\t491\t46\t0\r\n",
        "k61_5227\t522\t39\t0\r\n",
        "k61_5228\t601\t44\t0\r\n",
        "k61_5230\t603\t52\t0\r\n",
        "k61_5231\t815\t85\t0\r\n",
        "k61_5232\t260\t15\t0\r\n",
        "k61_5233\t288\t20\t0\r\n",
        "k61_5234\t710\t62\t0\r\n",
        "k61_5235\t227\t19\t0\r\n",
        "k61_5236\t481\t30\t0\r\n",
        "k61_5238\t292\t20\t0\r\n",
        "k61_5239\t996\t98\t0\r\n",
        "k61_5240\t300\t13\t0\r\n",
        "k61_5242\t276\t23\t0\r\n",
        "k61_5243\t367\t22\t0\r\n",
        "k61_5244\t518\t40\t0\r\n",
        "k61_5245\t208\t9\t0\r\n",
        "k61_5247\t218\t11\t0\r\n",
        "k61_5248\t494\t55\t0\r\n",
        "k61_5249\t501\t51\t0\r\n",
        "k61_5251\t851\t93\t0\r\n",
        "k61_5252\t221\t9\t0\r\n",
        "k61_5253\t1122\t152\t0\r\n",
        "k61_5254\t234\t14\t0\r\n",
        "k61_5255\t395\t38\t0\r\n",
        "k61_5256\t725\t72\t0\r\n",
        "k61_5258\t286\t23\t0\r\n",
        "k61_5259\t714\t48\t0\r\n",
        "k61_5260\t245\t18\t0\r\n",
        "k61_5261\t441\t21\t0\r\n",
        "k61_5263\t273\t13\t0\r\n",
        "k61_5264\t532\t52\t0\r\n",
        "k61_5265\t276\t21\t0\r\n",
        "k61_5267\t1003\t118\t0\r\n",
        "k61_5268\t891\t74\t0\r\n",
        "k61_5270\t547\t41\t0\r\n",
        "k61_5271\t1517\t159\t0\r\n",
        "k61_5273\t225\t26\t0\r\n",
        "k61_5274\t275\t17\t0\r\n",
        "k61_5275\t264\t10\t0\r\n",
        "k61_5276\t209\t9\t0\r\n",
        "k61_5277\t358\t27\t0\r\n",
        "k61_5279\t360\t26\t0\r\n",
        "k61_5280\t266\t9\t0\r\n",
        "k61_5281\t478\t35\t0\r\n",
        "k61_5282\t200\t9\t0\r\n",
        "k61_5283\t445\t20\t0\r\n",
        "k61_5284\t308\t17\t0\r\n",
        "k61_5285\t305\t15\t0\r\n",
        "k61_5286\t204\t11\t0\r\n",
        "k61_5287\t1476\t137\t0\r\n",
        "k61_5289\t581\t56\t0\r\n",
        "k61_5290\t265\t12\t0\r\n",
        "k61_5291\t501\t41\t0\r\n",
        "k61_5292\t201\t8\t0\r\n",
        "k61_5293\t423\t34\t0\r\n",
        "k61_5294\t727\t68\t0\r\n",
        "k61_5295\t221\t23\t0\r\n",
        "k61_5296\t365\t20\t0\r\n",
        "k61_5297\t234\t9\t0\r\n",
        "k61_5298\t361\t45\t0\r\n",
        "k61_5299\t923\t66\t0\r\n",
        "k61_5300\t227\t11\t0\r\n",
        "k61_5301\t577\t60\t0\r\n",
        "k61_5302\t460\t56\t0\r\n",
        "k61_5303\t521\t25\t0\r\n",
        "k61_5304\t789\t53\t0\r\n",
        "k61_5305\t529\t40\t0\r\n",
        "k61_5306\t1735\t181\t0\r\n",
        "k61_5307\t317\t17\t0\r\n",
        "k61_5308\t308\t20\t0\r\n",
        "k61_5309\t547\t53\t0\r\n",
        "k61_5310\t579\t50\t0\r\n",
        "k61_5311\t705\t84\t0\r\n",
        "k61_5312\t378\t37\t0\r\n",
        "k61_5313\t267\t19\t0\r\n",
        "k61_5314\t479\t38\t0\r\n",
        "k61_5315\t391\t36\t0\r\n",
        "k61_5316\t325\t24\t0\r\n",
        "k61_5318\t209\t9\t0\r\n",
        "k61_5319\t337\t23\t0\r\n",
        "k61_5320\t206\t11\t0\r\n",
        "k61_5321\t292\t10\t0\r\n",
        "k61_5322\t272\t16\t0\r\n",
        "k61_5323\t300\t29\t0\r\n",
        "k61_5324\t678\t49\t0\r\n",
        "k61_5325\t314\t13\t0\r\n",
        "k61_5326\t1018\t119\t0\r\n",
        "k61_5327\t220\t22\t0\r\n",
        "k61_5328\t246\t10\t0\r\n",
        "k61_5329\t560\t43\t0\r\n",
        "k61_5330\t300\t25\t0\r\n",
        "k61_5331\t318\t27\t0\r\n",
        "k61_5332\t274\t10\t0\r\n",
        "k61_5333\t303\t23\t0\r\n",
        "k61_5334\t250\t21\t0\r\n",
        "k61_5335\t348\t37\t0\r\n",
        "k61_5336\t300\t19\t0\r\n",
        "k61_5337\t265\t10\t0\r\n",
        "k61_5338\t827\t99\t0\r\n",
        "k61_5339\t895\t66\t0\r\n",
        "k61_5340\t520\t21\t0\r\n",
        "k61_5342\t515\t49\t0\r\n",
        "k61_5343\t204\t17\t0\r\n",
        "k61_5344\t361\t20\t0\r\n",
        "k61_5345\t223\t13\t0\r\n",
        "k61_5347\t1210\t119\t0\r\n",
        "k61_5348\t366\t25\t0\r\n",
        "k61_5349\t349\t32\t0\r\n",
        "k61_5350\t319\t15\t0\r\n",
        "k61_5351\t633\t43\t0\r\n",
        "k61_5352\t584\t75\t0\r\n",
        "k61_5353\t316\t24\t0\r\n",
        "k61_5354\t279\t35\t0\r\n",
        "k61_5355\t210\t7\t0\r\n",
        "k61_5357\t821\t67\t0\r\n",
        "k61_5358\t489\t63\t0\r\n",
        "k61_5359\t320\t15\t0\r\n",
        "k61_5361\t1034\t97\t0\r\n",
        "k61_5362\t287\t28\t0\r\n",
        "k61_5363\t494\t40\t0\r\n",
        "k61_5364\t221\t10\t0\r\n",
        "k61_5365\t320\t25\t0\r\n",
        "k61_5366\t371\t25\t0\r\n",
        "k61_5368\t604\t70\t0\r\n",
        "k61_5370\t289\t14\t0\r\n",
        "k61_5371\t427\t38\t0\r\n",
        "k61_5372\t430\t24\t0\r\n",
        "k61_5373\t243\t14\t0\r\n",
        "k61_5374\t830\t60\t0\r\n",
        "k61_5375\t218\t9\t0\r\n",
        "k61_5376\t298\t27\t0\r\n",
        "k61_5377\t239\t19\t0\r\n",
        "k61_5378\t206\t26\t0\r\n",
        "k61_5379\t309\t22\t0\r\n",
        "k61_5380\t447\t46\t0\r\n",
        "k61_5382\t658\t55\t0\r\n",
        "k61_5383\t520\t36\t0\r\n",
        "k61_5384\t617\t47\t0\r\n",
        "k61_5385\t230\t22\t0\r\n",
        "k61_5386\t311\t19\t0\r\n",
        "k61_5387\t572\t49\t0\r\n",
        "k61_5388\t477\t37\t0\r\n",
        "k61_5389\t218\t9\t0\r\n",
        "k61_5390\t226\t12\t0\r\n",
        "k61_5391\t569\t51\t0\r\n",
        "k61_5392\t365\t34\t0\r\n",
        "k61_5393\t354\t30\t0\r\n",
        "k61_5394\t329\t22\t0\r\n",
        "k61_5395\t380\t36\t0\r\n",
        "k61_5397\t433\t38\t0\r\n",
        "k61_5398\t265\t8\t0\r\n",
        "k61_5399\t376\t18\t0\r\n",
        "k61_5400\t436\t33\t0\r\n",
        "k61_5401\t232\t15\t0\r\n",
        "k61_5402\t265\t15\t0\r\n",
        "k61_5403\t294\t33\t0\r\n",
        "k61_5404\t254\t19\t0\r\n",
        "k61_5405\t250\t9\t0\r\n",
        "k61_5406\t297\t19\t0\r\n",
        "k61_5407\t201\t8\t0\r\n",
        "k61_5408\t427\t34\t0\r\n",
        "k61_5409\t497\t30\t0\r\n",
        "k61_5410\t259\t25\t0\r\n",
        "k61_5411\t251\t17\t0\r\n",
        "k61_5412\t511\t45\t0\r\n",
        "k61_5413\t299\t19\t0\r\n",
        "k61_5415\t200\t8\t0\r\n",
        "k61_5416\t1419\t157\t0\r\n",
        "k61_5417\t210\t14\t0\r\n",
        "k61_5418\t606\t49\t0\r\n",
        "k61_5420\t903\t58\t0\r\n",
        "k61_5421\t824\t105\t0\r\n",
        "k61_5422\t252\t16\t0\r\n",
        "k61_5423\t344\t32\t0\r\n",
        "k61_5424\t290\t15\t0\r\n",
        "k61_5425\t338\t22\t0\r\n",
        "k61_5426\t269\t8\t0\r\n",
        "k61_5428\t242\t18\t0\r\n",
        "k61_5429\t711\t87\t0\r\n",
        "k61_5430\t259\t18\t0\r\n",
        "k61_5431\t287\t11\t0\r\n",
        "k61_5432\t572\t57\t0\r\n",
        "k61_5433\t222\t9\t0\r\n",
        "k61_5434\t438\t27\t0\r\n",
        "k61_5435\t230\t14\t0\r\n",
        "k61_5436\t717\t77\t0\r\n",
        "k61_5437\t338\t12\t0\r\n",
        "k61_5438\t218\t10\t0\r\n",
        "k61_5439\t540\t52\t0\r\n",
        "k61_5440\t260\t24\t0\r\n",
        "k61_5441\t750\t54\t0\r\n",
        "k61_5442\t244\t11\t0\r\n",
        "k61_5443\t2829\t264\t0\r\n",
        "k61_5444\t254\t13\t0\r\n",
        "k61_5445\t543\t42\t0\r\n",
        "k61_5446\t514\t47\t0\r\n",
        "k61_5448\t247\t7\t0\r\n",
        "k61_5449\t387\t27\t0\r\n",
        "k61_5450\t740\t67\t0\r\n",
        "k61_5451\t292\t15\t0\r\n",
        "k61_5452\t669\t41\t0\r\n",
        "k61_5453\t565\t45\t0\r\n",
        "k61_5454\t217\t9\t0\r\n",
        "k61_5456\t488\t51\t0\r\n",
        "k61_5457\t324\t21\t0\r\n",
        "k61_5458\t514\t28\t0\r\n",
        "k61_5460\t478\t39\t0\r\n",
        "k61_5462\t399\t23\t0\r\n",
        "k61_5463\t612\t57\t0\r\n",
        "k61_5464\t241\t26\t0\r\n",
        "k61_5465\t209\t11\t0\r\n",
        "k61_5466\t602\t40\t0\r\n",
        "k61_5467\t238\t13\t0\r\n",
        "k61_5469\t308\t43\t0\r\n",
        "k61_5470\t597\t70\t0\r\n",
        "k61_5471\t370\t20\t0\r\n",
        "k61_5472\t272\t21\t0\r\n",
        "k61_5473\t295\t12\t0\r\n",
        "k61_5474\t350\t27\t0\r\n",
        "k61_5475\t346\t25\t0\r\n",
        "k61_5478\t325\t21\t0\r\n",
        "k61_5480\t441\t28\t0\r\n",
        "k61_5482\t706\t71\t0\r\n",
        "k61_5483\t618\t45\t0\r\n",
        "k61_5484\t226\t41\t0\r\n",
        "k61_5485\t262\t13\t0\r\n",
        "k61_5487\t298\t16\t0\r\n",
        "k61_5488\t227\t9\t0\r\n",
        "k61_5489\t608\t45\t0\r\n",
        "k61_5490\t418\t27\t0\r\n",
        "k61_5491\t344\t26\t0\r\n",
        "k61_5492\t1635\t187\t0\r\n",
        "k61_5493\t233\t19\t0\r\n",
        "k61_5494\t331\t23\t0\r\n",
        "k61_5495\t309\t24\t0\r\n",
        "k61_5496\t215\t6\t0\r\n",
        "k61_5497\t212\t14\t0\r\n",
        "k61_5498\t208\t5\t0\r\n",
        "k61_5499\t331\t20\t0\r\n",
        "k61_5500\t518\t39\t0\r\n",
        "k61_5501\t260\t18\t0\r\n",
        "k61_5502\t804\t79\t0\r\n",
        "k61_5503\t296\t20\t0\r\n",
        "k61_5504\t288\t14\t0\r\n",
        "k61_5505\t649\t70\t0\r\n",
        "k61_5506\t333\t17\t0\r\n",
        "k61_5507\t312\t29\t0\r\n",
        "k61_5508\t322\t28\t0\r\n",
        "k61_5510\t247\t9\t0\r\n",
        "k61_5511\t561\t42\t0\r\n",
        "k61_5512\t380\t28\t0\r\n",
        "k61_5513\t237\t12\t0\r\n",
        "k61_5514\t754\t56\t0\r\n",
        "k61_5515\t515\t47\t0\r\n",
        "k61_5516\t274\t29\t0\r\n",
        "k61_5518\t375\t37\t0\r\n",
        "k61_5519\t214\t10\t0\r\n",
        "k61_5520\t527\t47\t0\r\n",
        "k61_5521\t256\t20\t0\r\n",
        "k61_5522\t222\t13\t0\r\n",
        "k61_5523\t302\t17\t0\r\n",
        "k61_5524\t216\t12\t0\r\n",
        "k61_5525\t328\t23\t0\r\n",
        "k61_5526\t229\t13\t0\r\n",
        "k61_5527\t439\t35\t0\r\n",
        "k61_5528\t1089\t111\t0\r\n",
        "k61_5529\t250\t17\t0\r\n",
        "k61_5530\t242\t8\t0\r\n",
        "k61_5531\t202\t11\t0\r\n",
        "k61_5532\t289\t30\t0\r\n",
        "k61_5533\t926\t72\t0\r\n",
        "k61_5535\t319\t22\t0\r\n",
        "k61_5536\t335\t12\t0\r\n",
        "k61_5537\t1236\t111\t0\r\n",
        "k61_5538\t522\t48\t0\r\n",
        "k61_5539\t895\t105\t0\r\n",
        "k61_5540\t313\t15\t0\r\n",
        "k61_5541\t271\t28\t0\r\n",
        "k61_5542\t259\t7\t0\r\n",
        "k61_5543\t775\t50\t0\r\n",
        "k61_5544\t454\t49\t0\r\n",
        "k61_5545\t1354\t113\t0\r\n",
        "k61_5546\t273\t20\t0\r\n",
        "k61_5547\t248\t10\t0\r\n",
        "k61_5548\t1355\t138\t0\r\n",
        "k61_5549\t207\t9\t0\r\n",
        "k61_5550\t947\t92\t0\r\n",
        "k61_5551\t430\t38\t0\r\n",
        "k61_5552\t216\t13\t0\r\n",
        "k61_5553\t216\t6\t0\r\n",
        "k61_5554\t221\t7\t0\r\n",
        "k61_5555\t2510\t274\t0\r\n",
        "k61_5556\t618\t51\t0\r\n",
        "k61_5557\t372\t28\t0\r\n",
        "k61_5558\t491\t32\t0\r\n",
        "k61_5559\t389\t32\t0\r\n",
        "k61_5560\t433\t55\t0\r\n",
        "k61_5562\t262\t16\t0\r\n",
        "k61_5563\t375\t38\t0\r\n",
        "k61_5564\t244\t15\t0\r\n",
        "k61_5565\t544\t45\t0\r\n",
        "k61_5566\t491\t34\t0\r\n",
        "k61_5567\t256\t18\t0\r\n",
        "k61_5568\t375\t24\t0\r\n",
        "k61_5569\t402\t23\t0\r\n",
        "k61_5570\t288\t21\t0\r\n",
        "k61_5571\t345\t27\t0\r\n",
        "k61_5572\t398\t17\t0\r\n",
        "k61_5573\t234\t8\t0\r\n",
        "k61_5574\t260\t10\t0\r\n",
        "k61_5575\t635\t53\t0\r\n",
        "k61_5576\t385\t32\t0\r\n",
        "k61_5577\t413\t26\t0\r\n",
        "k61_5578\t354\t21\t0\r\n",
        "k61_5579\t500\t50\t0\r\n",
        "k61_5580\t219\t6\t0\r\n",
        "k61_5582\t367\t23\t0\r\n",
        "k61_5583\t625\t49\t0\r\n",
        "k61_5585\t286\t16\t0\r\n",
        "k61_5586\t411\t20\t0\r\n",
        "k61_5587\t288\t20\t0\r\n",
        "k61_5588\t520\t35\t0\r\n",
        "k61_5589\t260\t10\t0\r\n",
        "k61_5590\t588\t24\t0\r\n",
        "k61_5591\t371\t27\t0\r\n",
        "k61_5592\t343\t25\t0\r\n",
        "k61_5593\t347\t19\t0\r\n",
        "k61_5594\t559\t50\t0\r\n",
        "k61_5596\t208\t11\t0\r\n",
        "k61_5597\t967\t103\t0\r\n",
        "k61_5598\t900\t83\t0\r\n",
        "k61_5599\t767\t63\t0\r\n",
        "k61_5600\t940\t93\t0\r\n",
        "k61_5601\t376\t21\t0\r\n",
        "k61_5602\t2963\t401\t0\r\n",
        "k61_5603\t882\t81\t0\r\n",
        "k61_5604\t218\t12\t0\r\n",
        "k61_5605\t430\t22\t0\r\n",
        "k61_5606\t312\t23\t0\r\n",
        "k61_5607\t224\t14\t0\r\n",
        "k61_5608\t217\t13\t0\r\n",
        "k61_5610\t238\t9\t0\r\n",
        "k61_5611\t1325\t139\t0\r\n",
        "k61_5612\t215\t8\t0\r\n",
        "k61_5613\t234\t8\t0\r\n",
        "k61_5614\t213\t8\t0\r\n",
        "k61_5615\t931\t136\t0\r\n",
        "k61_5616\t211\t7\t0\r\n",
        "k61_5617\t289\t28\t0\r\n",
        "k61_5618\t312\t22\t0\r\n",
        "k61_5619\t816\t49\t0\r\n",
        "k61_5620\t252\t20\t0\r\n",
        "k61_5621\t431\t43\t0\r\n",
        "k61_5622\t483\t30\t0\r\n",
        "k61_5623\t955\t78\t0\r\n",
        "k61_5624\t221\t10\t0\r\n",
        "k61_5625\t271\t15\t0\r\n",
        "k61_5626\t326\t14\t0\r\n",
        "k61_5627\t655\t62\t0\r\n",
        "k61_5628\t275\t13\t0\r\n",
        "k61_5629\t214\t10\t0\r\n",
        "k61_5630\t253\t14\t0\r\n",
        "k61_5632\t270\t21\t0\r\n",
        "k61_5633\t567\t46\t0\r\n",
        "k61_5634\t234\t15\t0\r\n",
        "k61_5636\t225\t18\t0\r\n",
        "k61_5637\t297\t28\t0\r\n",
        "k61_5639\t1327\t115\t0\r\n",
        "k61_5640\t230\t20\t0\r\n",
        "k61_5641\t474\t47\t0\r\n",
        "k61_5642\t369\t30\t0\r\n",
        "k61_5643\t840\t102\t0\r\n",
        "k61_5644\t271\t22\t0\r\n",
        "k61_5645\t1148\t112\t0\r\n",
        "k61_5646\t229\t6\t0\r\n",
        "k61_5647\t356\t20\t0\r\n",
        "k61_5648\t380\t27\t0\r\n",
        "k61_5649\t235\t16\t0\r\n",
        "k61_5650\t652\t60\t0\r\n",
        "k61_5651\t332\t29\t0\r\n",
        "k61_5652\t782\t58\t0\r\n",
        "k61_5653\t272\t24\t0\r\n",
        "k61_5654\t279\t25\t0\r\n",
        "k61_5656\t401\t34\t0\r\n",
        "k61_5657\t352\t24\t0\r\n",
        "k61_5659\t346\t28\t0\r\n",
        "k61_5660\t469\t47\t0\r\n",
        "k61_5661\t318\t19\t0\r\n",
        "k61_5662\t921\t101\t0\r\n",
        "k61_5663\t261\t12\t0\r\n",
        "k61_5664\t220\t14\t0\r\n",
        "k61_5665\t289\t18\t0\r\n",
        "k61_5667\t234\t16\t0\r\n",
        "k61_5668\t230\t22\t0\r\n",
        "k61_5669\t309\t16\t0\r\n",
        "k61_5670\t379\t17\t0\r\n",
        "k61_5671\t885\t87\t0\r\n",
        "k61_5674\t496\t31\t0\r\n",
        "k61_5675\t453\t20\t0\r\n",
        "k61_5676\t422\t23\t0\r\n",
        "k61_5677\t371\t35\t0\r\n",
        "k61_5678\t227\t20\t0\r\n",
        "k61_5680\t404\t21\t0\r\n",
        "k61_5681\t1121\t1092\t0\r\n",
        "k61_5683\t200\t18\t0\r\n",
        "k61_5684\t202\t7\t0\r\n",
        "k61_5685\t438\t29\t0\r\n",
        "k61_5687\t203\t8\t0\r\n",
        "k61_5688\t518\t49\t0\r\n",
        "k61_5689\t245\t23\t0\r\n",
        "k61_5690\t664\t68\t0\r\n",
        "k61_5691\t454\t52\t0\r\n",
        "k61_5692\t251\t19\t0\r\n",
        "k61_5693\t467\t38\t0\r\n",
        "k61_5694\t330\t19\t0\r\n",
        "k61_5695\t313\t29\t0\r\n",
        "k61_5696\t200\t10\t0\r\n",
        "k61_5697\t266\t33\t0\r\n",
        "k61_5698\t267\t36\t0\r\n",
        "k61_5700\t326\t30\t0\r\n",
        "k61_5701\t259\t10\t0\r\n",
        "k61_5702\t233\t19\t0\r\n",
        "k61_5703\t718\t53\t0\r\n",
        "k61_5704\t377\t43\t0\r\n",
        "k61_5705\t319\t28\t0\r\n",
        "k61_5707\t230\t9\t0\r\n",
        "k61_5708\t216\t11\t0\r\n",
        "k61_5709\t571\t44\t0\r\n",
        "k61_5710\t277\t22\t0\r\n",
        "k61_5711\t1198\t86\t0\r\n",
        "k61_5712\t319\t21\t0\r\n",
        "k61_5713\t526\t26\t0\r\n",
        "k61_5714\t478\t40\t0\r\n",
        "k61_5715\t457\t49\t0\r\n",
        "k61_5716\t218\t8\t0\r\n",
        "k61_5717\t634\t54\t0\r\n",
        "k61_5718\t347\t24\t0\r\n",
        "k61_5719\t399\t28\t0\r\n",
        "k61_5720\t268\t29\t0\r\n",
        "k61_5721\t392\t25\t0\r\n",
        "k61_5722\t514\t35\t0\r\n",
        "k61_5723\t1332\t108\t0\r\n",
        "k61_5724\t505\t64\t0\r\n",
        "k61_5725\t307\t26\t0\r\n",
        "k61_5726\t397\t26\t0\r\n",
        "k61_5727\t736\t50\t0\r\n",
        "k61_5728\t801\t74\t0\r\n",
        "k61_5729\t622\t53\t0\r\n",
        "k61_5730\t267\t14\t0\r\n",
        "k61_5731\t359\t23\t0\r\n",
        "k61_5732\t309\t33\t0\r\n",
        "k61_5733\t283\t10\t0\r\n",
        "k61_5735\t286\t14\t0\r\n",
        "k61_5736\t839\t65\t0\r\n",
        "k61_5739\t2471\t920\t0\r\n",
        "k61_5740\t233\t16\t0\r\n",
        "k61_5742\t243\t10\t0\r\n",
        "k61_5743\t546\t44\t0\r\n",
        "k61_5744\t502\t41\t0\r\n",
        "k61_5745\t517\t30\t0\r\n",
        "k61_5746\t391\t24\t0\r\n",
        "k61_5747\t372\t29\t0\r\n",
        "k61_5748\t1211\t104\t0\r\n",
        "k61_5749\t370\t16\t0\r\n",
        "k61_5751\t265\t20\t0\r\n",
        "k61_5752\t698\t64\t0\r\n",
        "k61_5753\t223\t21\t0\r\n",
        "k61_5754\t211\t9\t0\r\n",
        "k61_5755\t393\t21\t0\r\n",
        "k61_5756\t265\t12\t0\r\n",
        "k61_5757\t230\t22\t0\r\n",
        "k61_5758\t202\t6\t0\r\n",
        "k61_5759\t620\t51\t0\r\n",
        "k61_5760\t229\t17\t0\r\n",
        "k61_5761\t498\t40\t0\r\n",
        "k61_5762\t203\t9\t0\r\n",
        "k61_5763\t409\t38\t0\r\n",
        "k61_5764\t510\t52\t0\r\n",
        "k61_5765\t235\t20\t0\r\n",
        "k61_5766\t375\t27\t0\r\n",
        "k61_5767\t258\t17\t0\r\n",
        "k61_5768\t1087\t118\t0\r\n",
        "k61_5769\t302\t26\t0\r\n",
        "k61_5770\t677\t64\t0\r\n",
        "k61_5771\t269\t22\t0\r\n",
        "k61_5773\t205\t11\t0\r\n",
        "k61_5774\t444\t30\t0\r\n",
        "k61_5775\t225\t33\t0\r\n",
        "k61_5776\t610\t51\t0\r\n",
        "k61_5777\t279\t23\t0\r\n",
        "k61_5778\t277\t19\t0\r\n",
        "k61_5779\t287\t30\t0\r\n",
        "k61_5780\t298\t19\t0\r\n",
        "k61_5781\t212\t13\t0\r\n",
        "k61_5782\t587\t36\t0\r\n",
        "k61_5783\t767\t76\t0\r\n",
        "k61_5784\t547\t51\t0\r\n",
        "k61_5785\t253\t13\t0\r\n",
        "k61_5786\t258\t12\t0\r\n",
        "k61_5787\t311\t19\t0\r\n",
        "k61_5789\t429\t29\t0\r\n",
        "k61_5790\t205\t16\t0\r\n",
        "k61_5791\t631\t48\t0\r\n",
        "k61_5792\t299\t16\t0\r\n",
        "k61_5793\t438\t28\t0\r\n",
        "k61_5794\t217\t9\t0\r\n",
        "k61_5796\t255\t29\t0\r\n",
        "k61_5797\t200\t14\t0\r\n",
        "k61_5798\t285\t26\t0\r\n",
        "k61_5799\t415\t21\t0\r\n",
        "k61_5800\t247\t19\t0\r\n",
        "k61_5801\t284\t13\t0\r\n",
        "k61_5802\t329\t16\t0\r\n",
        "k61_5803\t220\t14\t0\r\n",
        "k61_5804\t207\t7\t0\r\n",
        "k61_5805\t1143\t99\t0\r\n",
        "k61_5806\t492\t46\t0\r\n",
        "k61_5807\t571\t34\t0\r\n",
        "k61_5808\t241\t16\t0\r\n",
        "k61_5809\t206\t20\t0\r\n",
        "k61_5811\t1228\t140\t0\r\n",
        "k61_5812\t242\t12\t0\r\n",
        "k61_5813\t322\t12\t0\r\n",
        "k61_5814\t269\t23\t0\r\n",
        "k61_5815\t281\t25\t0\r\n",
        "k61_5816\t439\t44\t0\r\n",
        "k61_5817\t952\t86\t0\r\n",
        "k61_5818\t255\t21\t0\r\n",
        "k61_5819\t383\t29\t0\r\n",
        "k61_5820\t889\t81\t0\r\n",
        "k61_5821\t454\t38\t0\r\n",
        "k61_5822\t240\t16\t0\r\n",
        "k61_5823\t380\t28\t0\r\n",
        "k61_5824\t1793\t196\t0\r\n",
        "k61_5825\t344\t15\t0\r\n",
        "k61_5826\t382\t36\t0\r\n",
        "k61_5827\t214\t8\t0\r\n",
        "k61_5828\t207\t12\t0\r\n",
        "k61_5829\t254\t29\t0\r\n",
        "k61_5830\t230\t17\t0\r\n",
        "k61_5831\t360\t46\t0\r\n",
        "k61_5832\t238\t11\t0\r\n",
        "k61_5833\t371\t23\t0\r\n",
        "k61_5834\t1091\t177\t0\r\n",
        "k61_5835\t315\t16\t0\r\n",
        "k61_5836\t809\t67\t0\r\n",
        "k61_5837\t234\t21\t0\r\n",
        "k61_5838\t725\t56\t0\r\n",
        "k61_5839\t323\t35\t0\r\n",
        "k61_5840\t229\t9\t0\r\n",
        "k61_5841\t2423\t448\t0\r\n",
        "k61_5842\t460\t39\t0\r\n",
        "k61_5843\t329\t20\t0\r\n",
        "k61_5844\t300\t34\t0\r\n",
        "k61_5845\t238\t14\t0\r\n",
        "k61_5847\t229\t17\t0\r\n",
        "k61_5848\t341\t27\t0\r\n",
        "k61_5849\t332\t21\t0\r\n",
        "k61_5851\t203\t12\t0\r\n",
        "k61_5852\t685\t62\t0\r\n",
        "k61_5853\t249\t23\t0\r\n",
        "k61_5854\t232\t19\t0\r\n",
        "k61_5855\t270\t17\t0\r\n",
        "k61_5856\t378\t18\t0\r\n",
        "k61_5857\t215\t16\t0\r\n",
        "k61_5858\t527\t33\t0\r\n",
        "k61_5859\t223\t13\t0\r\n",
        "k61_5861\t249\t21\t0\r\n",
        "k61_5862\t255\t18\t0\r\n",
        "k61_5863\t692\t55\t0\r\n",
        "k61_5864\t340\t18\t0\r\n",
        "k61_5865\t269\t25\t0\r\n",
        "k61_5866\t973\t91\t0\r\n",
        "k61_5867\t599\t42\t0\r\n",
        "k61_5868\t216\t9\t0\r\n",
        "k61_5869\t396\t19\t0\r\n",
        "k61_5870\t398\t28\t0\r\n",
        "k61_5872\t331\t31\t0\r\n",
        "k61_5873\t1538\t210\t0\r\n",
        "k61_5874\t417\t27\t0\r\n",
        "k61_5875\t257\t27\t0\r\n",
        "k61_5877\t233\t14\t0\r\n",
        "k61_5878\t332\t22\t0\r\n",
        "k61_5879\t503\t50\t0\r\n",
        "k61_5880\t236\t11\t0\r\n",
        "k61_5881\t408\t40\t0\r\n",
        "k61_5882\t262\t26\t0\r\n",
        "k61_5883\t281\t28\t0\r\n",
        "k61_5884\t1173\t104\t0\r\n",
        "k61_5885\t217\t75\t0\r\n",
        "k61_5886\t499\t36\t0\r\n",
        "k61_5887\t577\t41\t0\r\n",
        "k61_5888\t810\t75\t0\r\n",
        "k61_5889\t368\t28\t0\r\n",
        "k61_5890\t237\t9\t0\r\n",
        "k61_5891\t294\t15\t0\r\n",
        "k61_5892\t265\t13\t0\r\n",
        "k61_5893\t563\t51\t0\r\n",
        "k61_5894\t217\t16\t0\r\n",
        "k61_5895\t767\t58\t0\r\n",
        "k61_5896\t277\t16\t0\r\n",
        "k61_5897\t1432\t92\t0\r\n",
        "k61_5898\t400\t22\t0\r\n",
        "k61_5899\t483\t23\t0\r\n",
        "k61_5900\t297\t32\t0\r\n",
        "k61_5901\t246\t16\t0\r\n",
        "k61_5902\t202\t9\t0\r\n",
        "k61_5903\t1125\t95\t0\r\n",
        "k61_5904\t221\t13\t0\r\n",
        "k61_5905\t676\t58\t0\r\n",
        "k61_5906\t689\t57\t0\r\n",
        "k61_5907\t292\t16\t0\r\n",
        "k61_5908\t806\t69\t0\r\n",
        "k61_5909\t561\t49\t0\r\n",
        "k61_5911\t773\t51\t0\r\n",
        "k61_5912\t251\t32\t0\r\n",
        "k61_5913\t418\t31\t0\r\n",
        "k61_5914\t237\t12\t0\r\n",
        "k61_5915\t231\t18\t0\r\n",
        "k61_5916\t237\t10\t0\r\n",
        "k61_5917\t265\t13\t0\r\n",
        "k61_5918\t290\t17\t0\r\n",
        "k61_5919\t218\t6\t0\r\n",
        "k61_5920\t360\t29\t0\r\n",
        "k61_5921\t299\t18\t0\r\n",
        "k61_5922\t550\t70\t0\r\n",
        "k61_5923\t214\t9\t0\r\n",
        "k61_5924\t537\t50\t0\r\n",
        "k61_5925\t401\t24\t0\r\n",
        "k61_5926\t688\t70\t0\r\n",
        "k61_5927\t252\t11\t0\r\n",
        "k61_5928\t424\t36\t0\r\n",
        "k61_5929\t324\t11\t0\r\n",
        "k61_5930\t334\t30\t0\r\n",
        "k61_5931\t1696\t189\t0\r\n",
        "k61_5933\t599\t45\t0\r\n",
        "k61_5934\t798\t65\t0\r\n",
        "k61_5935\t299\t28\t0\r\n",
        "k61_5936\t524\t57\t0\r\n",
        "k61_5937\t207\t8\t0\r\n",
        "k61_5938\t275\t31\t0\r\n",
        "k61_5939\t204\t6\t0\r\n",
        "k61_5940\t233\t13\t0\r\n",
        "k61_5941\t1258\t108\t0\r\n",
        "k61_5942\t489\t46\t0\r\n",
        "k61_5943\t301\t35\t0\r\n",
        "k61_5944\t244\t22\t0\r\n",
        "k61_5945\t260\t5\t0\r\n",
        "k61_5946\t1329\t131\t0\r\n",
        "k61_5947\t665\t70\t0\r\n",
        "k61_5948\t420\t29\t0\r\n",
        "k61_5949\t302\t16\t0\r\n",
        "k61_5950\t283\t20\t0\r\n",
        "k61_5951\t679\t69\t0\r\n",
        "k61_5952\t216\t16\t0\r\n",
        "k61_5953\t1583\t152\t0\r\n",
        "k61_5954\t201\t14\t0\r\n",
        "k61_5955\t893\t69\t0\r\n",
        "k61_5956\t240\t16\t0\r\n",
        "k61_5957\t644\t41\t0\r\n",
        "k61_5958\t510\t33\t0\r\n",
        "k61_5959\t226\t15\t0\r\n",
        "k61_5960\t1578\t126\t0\r\n",
        "k61_5961\t306\t15\t0\r\n",
        "k61_5963\t908\t87\t0\r\n",
        "k61_5964\t208\t4\t0\r\n",
        "k61_5965\t233\t14\t0\r\n",
        "k61_5966\t363\t39\t0\r\n",
        "k61_5967\t203\t8\t0\r\n",
        "k61_5968\t265\t19\t0\r\n",
        "k61_5969\t301\t18\t0\r\n",
        "k61_5970\t464\t38\t0\r\n",
        "k61_5971\t357\t25\t0\r\n",
        "k61_5972\t261\t11\t0\r\n",
        "k61_5973\t628\t61\t0\r\n",
        "k61_5974\t334\t32\t0\r\n",
        "k61_5975\t222\t20\t0\r\n",
        "k61_5976\t598\t42\t0\r\n",
        "k61_5977\t835\t74\t0\r\n",
        "k61_5978\t343\t28\t0\r\n",
        "k61_5979\t309\t18\t0\r\n",
        "k61_5980\t467\t39\t0\r\n",
        "k61_5981\t235\t15\t0\r\n",
        "k61_5983\t485\t40\t0\r\n",
        "k61_5984\t559\t50\t0\r\n",
        "k61_5985\t211\t11\t0\r\n",
        "k61_5986\t262\t11\t0\r\n",
        "k61_5987\t235\t11\t0\r\n",
        "k61_5988\t238\t21\t0\r\n",
        "k61_5989\t315\t16\t0\r\n",
        "k61_5990\t724\t54\t0\r\n",
        "k61_5991\t244\t14\t0\r\n",
        "k61_5992\t253\t21\t0\r\n",
        "k61_5993\t501\t45\t0\r\n",
        "k61_5994\t1404\t194\t0\r\n",
        "k61_5995\t437\t31\t0\r\n",
        "k61_5996\t267\t16\t0\r\n",
        "k61_5997\t479\t37\t0\r\n",
        "k61_5998\t689\t58\t0\r\n",
        "k61_5999\t502\t45\t0\r\n",
        "k61_6000\t688\t77\t0\r\n",
        "k61_6002\t466\t37\t0\r\n",
        "k61_6003\t236\t24\t0\r\n",
        "k61_6004\t3124\t719\t0\r\n",
        "k61_6005\t639\t53\t0\r\n",
        "k61_6006\t248\t8\t0\r\n",
        "k61_6007\t226\t13\t0\r\n",
        "k61_6008\t349\t26\t0\r\n",
        "k61_6009\t351\t31\t0\r\n",
        "k61_6010\t569\t46\t0\r\n",
        "k61_6012\t1231\t113\t0\r\n",
        "k61_6013\t294\t17\t0\r\n",
        "k61_6014\t243\t9\t0\r\n",
        "k61_6015\t252\t19\t0\r\n",
        "k61_6016\t984\t83\t0\r\n",
        "k61_6017\t421\t40\t0\r\n",
        "k61_6018\t324\t17\t0\r\n",
        "k61_6019\t313\t23\t0\r\n",
        "k61_6020\t268\t16\t0\r\n",
        "k61_6021\t318\t22\t0\r\n",
        "k61_6022\t284\t23\t0\r\n",
        "k61_6023\t1378\t148\t0\r\n",
        "k61_6024\t287\t18\t0\r\n",
        "k61_6025\t224\t9\t0\r\n",
        "k61_6026\t616\t45\t0\r\n",
        "k61_6027\t527\t38\t0\r\n",
        "k61_6028\t518\t47\t0\r\n",
        "k61_6030\t481\t34\t0\r\n",
        "k61_6031\t302\t12\t0\r\n",
        "k61_6032\t274\t14\t0\r\n",
        "k61_6033\t227\t11\t0\r\n",
        "k61_6034\t435\t28\t0\r\n",
        "k61_6035\t320\t20\t0\r\n",
        "k61_6036\t310\t23\t0\r\n",
        "k61_6037\t261\t16\t0\r\n",
        "k61_6038\t523\t61\t0\r\n",
        "k61_6040\t284\t29\t0\r\n",
        "k61_6041\t990\t86\t0\r\n",
        "k61_6042\t210\t7\t0\r\n",
        "k61_6043\t222\t13\t0\r\n",
        "k61_6044\t231\t8\t0\r\n",
        "k61_6045\t689\t61\t0\r\n",
        "k61_6046\t482\t35\t0\r\n",
        "k61_6047\t250\t26\t0\r\n",
        "k61_6048\t233\t15\t0\r\n",
        "k61_6050\t1728\t198\t0\r\n",
        "k61_6051\t318\t23\t0\r\n",
        "k61_6052\t292\t30\t0\r\n",
        "k61_6054\t484\t43\t0\r\n",
        "k61_6055\t270\t18\t0\r\n",
        "k61_6056\t705\t30\t0\r\n",
        "k61_6057\t260\t10\t0\r\n",
        "k61_6058\t230\t12\t0\r\n",
        "k61_6059\t395\t29\t0\r\n",
        "k61_6060\t402\t41\t0\r\n",
        "k61_6061\t414\t30\t0\r\n",
        "k61_6062\t389\t38\t0\r\n",
        "k61_6065\t912\t68\t0\r\n",
        "k61_6066\t420\t42\t0\r\n",
        "k61_6067\t886\t82\t0\r\n",
        "k61_6068\t390\t16\t0\r\n",
        "k61_6069\t202\t5\t0\r\n",
        "k61_6070\t221\t16\t0\r\n",
        "k61_6071\t261\t19\t0\r\n",
        "k61_6072\t276\t18\t0\r\n",
        "k61_6073\t290\t17\t0\r\n",
        "k61_6074\t222\t19\t0\r\n",
        "k61_6075\t282\t9\t0\r\n",
        "k61_6076\t276\t15\t0\r\n",
        "k61_6077\t262\t13\t0\r\n",
        "k61_6078\t1509\t152\t0\r\n",
        "k61_6079\t533\t32\t0\r\n",
        "k61_6081\t248\t17\t0\r\n",
        "k61_6082\t291\t27\t0\r\n",
        "k61_6083\t251\t11\t0\r\n",
        "k61_6084\t627\t57\t0\r\n",
        "k61_6085\t220\t11\t0\r\n",
        "k61_6087\t234\t12\t0\r\n",
        "k61_6088\t209\t19\t0\r\n",
        "k61_6089\t287\t11\t0\r\n",
        "k61_6090\t499\t31\t0\r\n",
        "k61_6091\t278\t12\t0\r\n",
        "k61_6092\t1717\t158\t0\r\n",
        "k61_6094\t384\t15\t0\r\n",
        "k61_6095\t628\t46\t0\r\n",
        "k61_6096\t223\t7\t0\r\n",
        "k61_6097\t293\t17\t0\r\n",
        "k61_6098\t349\t29\t0\r\n",
        "k61_6099\t272\t17\t0\r\n",
        "k61_6101\t238\t24\t0\r\n",
        "k61_6102\t352\t17\t0\r\n",
        "k61_6103\t213\t9\t0\r\n",
        "k61_6105\t201\t14\t0\r\n",
        "k61_6106\t447\t30\t0\r\n",
        "k61_6107\t412\t35\t0\r\n",
        "k61_6108\t263\t18\t0\r\n",
        "k61_6109\t453\t29\t0\r\n",
        "k61_6110\t334\t27\t0\r\n",
        "k61_6111\t202\t7\t0\r\n",
        "k61_6113\t478\t47\t0\r\n",
        "k61_6114\t730\t86\t0\r\n",
        "k61_6115\t321\t34\t0\r\n",
        "k61_6116\t256\t26\t0\r\n",
        "k61_6117\t240\t10\t0\r\n",
        "k61_6118\t503\t37\t0\r\n",
        "k61_6119\t379\t34\t0\r\n",
        "k61_6120\t1704\t147\t0\r\n",
        "k61_6122\t1622\t160\t0\r\n",
        "k61_6124\t200\t14\t0\r\n",
        "k61_6125\t266\t16\t0\r\n",
        "k61_6126\t333\t23\t0\r\n",
        "k61_6127\t786\t67\t0\r\n",
        "k61_6128\t363\t29\t0\r\n",
        "k61_6129\t263\t13\t0\r\n",
        "k61_6130\t260\t27\t0\r\n",
        "k61_6131\t233\t13\t0\r\n",
        "k61_6132\t239\t12\t0\r\n",
        "k61_6134\t576\t57\t0\r\n",
        "k61_6135\t267\t13\t0\r\n",
        "k61_6136\t536\t53\t0\r\n",
        "k61_6137\t574\t45\t0\r\n",
        "k61_6138\t498\t38\t0\r\n",
        "k61_6139\t400\t35\t0\r\n",
        "k61_6140\t629\t55\t0\r\n",
        "k61_6141\t376\t22\t0\r\n",
        "k61_6142\t250\t17\t0\r\n",
        "k61_6143\t222\t17\t0\r\n",
        "k61_6144\t325\t27\t0\r\n",
        "k61_6146\t387\t38\t0\r\n",
        "k61_6148\t904\t75\t0\r\n",
        "k61_6149\t464\t41\t0\r\n",
        "k61_6150\t248\t9\t0\r\n",
        "k61_6151\t309\t25\t0\r\n",
        "k61_6152\t1193\t132\t0\r\n",
        "k61_6153\t871\t43\t0\r\n",
        "k61_6154\t297\t14\t0\r\n",
        "k61_6155\t229\t6\t0\r\n",
        "k61_6156\t562\t44\t0\r\n",
        "k61_6157\t256\t16\t0\r\n",
        "k61_6158\t407\t43\t0\r\n",
        "k61_6159\t403\t34\t0\r\n",
        "k61_6161\t236\t13\t0\r\n",
        "k61_6162\t371\t28\t0\r\n",
        "k61_6163\t363\t30\t0\r\n",
        "k61_6164\t303\t12\t0\r\n",
        "k61_6165\t900\t67\t0\r\n",
        "k61_6166\t276\t19\t0\r\n",
        "k61_6167\t403\t22\t0\r\n",
        "k61_6168\t281\t18\t0\r\n",
        "k61_6169\t300\t15\t0\r\n",
        "k61_6170\t512\t29\t0\r\n",
        "k61_6171\t310\t21\t0\r\n",
        "k61_6172\t447\t18\t0\r\n",
        "k61_6173\t252\t8\t0\r\n",
        "k61_6174\t1198\t125\t0\r\n",
        "k61_6175\t229\t8\t0\r\n",
        "k61_6176\t497\t46\t0\r\n",
        "k61_6177\t208\t10\t0\r\n",
        "k61_6178\t603\t44\t0\r\n",
        "k61_6179\t756\t81\t0\r\n",
        "k61_6180\t536\t41\t0\r\n",
        "k61_6183\t548\t25\t0\r\n",
        "k61_6184\t201\t8\t0\r\n",
        "k61_6185\t475\t37\t0\r\n",
        "k61_6186\t248\t9\t0\r\n",
        "k61_6187\t453\t32\t0\r\n",
        "k61_6188\t215\t15\t0\r\n",
        "k61_6189\t1028\t101\t0\r\n",
        "k61_6190\t314\t21\t0\r\n",
        "k61_6191\t216\t25\t0\r\n",
        "k61_6192\t297\t31\t0\r\n",
        "k61_6193\t632\t43\t0\r\n",
        "k61_6194\t595\t50\t0\r\n",
        "k61_6195\t1086\t85\t0\r\n",
        "k61_6196\t285\t18\t0\r\n",
        "k61_6197\t586\t44\t0\r\n",
        "k61_6198\t202\t7\t0\r\n",
        "k61_6199\t382\t26\t0\r\n",
        "k61_6200\t231\t16\t0\r\n",
        "k61_6201\t370\t14\t0\r\n",
        "k61_6202\t503\t40\t0\r\n",
        "k61_6203\t245\t14\t0\r\n",
        "k61_6204\t1255\t134\t0\r\n",
        "k61_6205\t524\t45\t0\r\n",
        "k61_6206\t256\t13\t0\r\n",
        "k61_6207\t543\t61\t0\r\n",
        "k61_6209\t938\t101\t0\r\n",
        "k61_6210\t368\t29\t0\r\n",
        "k61_6212\t232\t9\t0\r\n",
        "k61_6213\t319\t16\t0\r\n",
        "k61_6214\t275\t12\t0\r\n",
        "k61_6216\t320\t22\t0\r\n",
        "k61_6217\t368\t22\t0\r\n",
        "k61_6218\t298\t12\t0\r\n",
        "k61_6219\t694\t76\t0\r\n",
        "k61_6220\t299\t21\t0\r\n",
        "k61_6221\t709\t54\t0\r\n",
        "k61_6222\t336\t14\t0\r\n",
        "k61_6223\t235\t13\t0\r\n",
        "k61_6224\t260\t16\t0\r\n",
        "k61_6225\t396\t28\t0\r\n",
        "k61_6226\t259\t19\t0\r\n",
        "k61_6227\t786\t60\t0\r\n",
        "k61_6228\t876\t62\t0\r\n",
        "k61_6230\t374\t36\t0\r\n",
        "k61_6231\t331\t26\t0\r\n",
        "k61_6232\t309\t23\t0\r\n",
        "k61_6233\t414\t41\t0\r\n",
        "k61_6234\t440\t42\t0\r\n",
        "k61_6235\t386\t19\t0\r\n",
        "k61_6236\t712\t37\t0\r\n",
        "k61_6237\t871\t59\t0\r\n",
        "k61_6238\t275\t22\t0\r\n",
        "k61_6239\t290\t12\t0\r\n",
        "k61_6240\t245\t18\t0\r\n",
        "k61_6241\t235\t10\t0\r\n",
        "k61_6242\t350\t31\t0\r\n",
        "k61_6243\t586\t42\t0\r\n",
        "k61_6244\t619\t44\t0\r\n",
        "k61_6245\t211\t6\t0\r\n",
        "k61_6246\t351\t27\t0\r\n",
        "k61_6247\t415\t29\t0\r\n",
        "k61_6248\t278\t18\t0\r\n",
        "k61_6249\t576\t56\t0\r\n",
        "k61_6250\t202\t12\t0\r\n",
        "k61_6251\t221\t11\t0\r\n",
        "k61_6252\t702\t61\t0\r\n",
        "k61_6253\t597\t68\t0\r\n",
        "k61_6254\t605\t74\t0\r\n",
        "k61_6255\t208\t9\t0\r\n",
        "k61_6256\t230\t13\t0\r\n",
        "k61_6258\t570\t64\t0\r\n",
        "k61_6259\t266\t11\t0\r\n",
        "k61_6260\t479\t32\t0\r\n",
        "k61_6261\t411\t20\t0\r\n",
        "k61_6262\t251\t16\t0\r\n",
        "k61_6263\t296\t26\t0\r\n",
        "k61_6264\t1084\t101\t0\r\n",
        "k61_6266\t308\t32\t0\r\n",
        "k61_6267\t685\t64\t0\r\n",
        "k61_6268\t298\t28\t0\r\n",
        "k61_6269\t693\t69\t0\r\n",
        "k61_6270\t231\t22\t0\r\n",
        "k61_6271\t585\t52\t0\r\n",
        "k61_6272\t229\t15\t0\r\n",
        "k61_6273\t214\t8\t0\r\n",
        "k61_6274\t274\t16\t0\r\n",
        "k61_6275\t215\t8\t0\r\n",
        "k61_6276\t539\t56\t0\r\n",
        "k61_6277\t428\t33\t0\r\n",
        "k61_6278\t254\t10\t0\r\n",
        "k61_6279\t359\t16\t0\r\n",
        "k61_6280\t208\t21\t0\r\n",
        "k61_6281\t647\t48\t0\r\n",
        "k61_6282\t549\t45\t0\r\n",
        "k61_6283\t321\t16\t0\r\n",
        "k61_6284\t242\t8\t0\r\n",
        "k61_6285\t655\t59\t0\r\n",
        "k61_6286\t561\t48\t0\r\n",
        "k61_6287\t378\t26\t0\r\n",
        "k61_6288\t269\t18\t0\r\n",
        "k61_6289\t240\t7\t0\r\n",
        "k61_6290\t333\t18\t0\r\n",
        "k61_6291\t732\t62\t0\r\n",
        "k61_6292\t462\t44\t0\r\n",
        "k61_6293\t202\t8\t0\r\n",
        "k61_6294\t229\t26\t0\r\n",
        "k61_6296\t318\t18\t0\r\n",
        "k61_6297\t762\t63\t0\r\n",
        "k61_6298\t414\t30\t0\r\n",
        "k61_6299\t640\t64\t0\r\n",
        "k61_6300\t409\t36\t0\r\n",
        "k61_6301\t217\t12\t0\r\n",
        "k61_6302\t389\t24\t0\r\n",
        "k61_6303\t235\t11\t0\r\n",
        "k61_6304\t234\t11\t0\r\n",
        "k61_6305\t571\t47\t0\r\n",
        "k61_6306\t279\t18\t0\r\n",
        "k61_6307\t637\t61\t0\r\n",
        "k61_6308\t293\t18\t0\r\n",
        "k61_6309\t404\t22\t0\r\n",
        "k61_6310\t345\t25\t0\r\n",
        "k61_6312\t1071\t99\t0\r\n",
        "k61_6313\t214\t11\t0\r\n",
        "k61_6314\t229\t18\t0\r\n",
        "k61_6315\t206\t13\t0\r\n",
        "k61_6316\t651\t77\t0\r\n",
        "k61_6317\t857\t84\t0\r\n",
        "k61_6318\t748\t75\t0\r\n",
        "k61_6319\t477\t29\t0\r\n",
        "k61_6320\t920\t109\t0\r\n",
        "k61_6322\t353\t26\t0\r\n",
        "k61_6323\t227\t10\t0\r\n",
        "k61_6324\t608\t49\t0\r\n",
        "k61_6326\t226\t16\t0\r\n",
        "k61_6327\t429\t36\t0\r\n",
        "k61_6328\t724\t61\t0\r\n",
        "k61_6331\t536\t48\t0\r\n",
        "k61_6332\t272\t21\t0\r\n",
        "k61_6333\t271\t19\t0\r\n",
        "k61_6334\t343\t22\t0\r\n",
        "k61_6335\t470\t30\t0\r\n",
        "k61_6336\t803\t78\t0\r\n",
        "k61_6337\t279\t16\t0\r\n",
        "k61_6338\t249\t9\t0\r\n",
        "k61_6339\t216\t6\t0\r\n",
        "k61_6340\t601\t44\t0\r\n",
        "k61_6341\t230\t10\t0\r\n",
        "k61_6342\t245\t15\t0\r\n",
        "k61_6345\t205\t7\t0\r\n",
        "k61_6346\t881\t94\t0\r\n",
        "k61_6348\t366\t20\t0\r\n",
        "k61_6349\t216\t13\t0\r\n",
        "k61_6350\t237\t19\t0\r\n",
        "k61_6351\t254\t9\t0\r\n",
        "k61_6353\t537\t61\t0\r\n",
        "k61_6354\t578\t52\t0\r\n",
        "k61_6355\t364\t25\t0\r\n",
        "k61_6356\t335\t34\t0\r\n",
        "k61_6357\t225\t6\t0\r\n",
        "k61_6358\t215\t10\t0\r\n",
        "k61_6359\t241\t10\t0\r\n",
        "k61_6360\t268\t17\t0\r\n",
        "k61_6361\t207\t13\t0\r\n",
        "k61_6362\t250\t12\t0\r\n",
        "k61_6363\t324\t19\t0\r\n",
        "k61_6366\t217\t8\t0\r\n",
        "k61_6367\t212\t12\t0\r\n",
        "k61_6368\t247\t12\t0\r\n",
        "k61_6369\t232\t16\t0\r\n",
        "k61_6370\t292\t18\t0\r\n",
        "k61_6371\t210\t10\t0\r\n",
        "k61_6372\t1048\t69\t0\r\n",
        "k61_6373\t727\t57\t0\r\n",
        "k61_6374\t1064\t141\t0\r\n",
        "k61_6375\t258\t18\t0\r\n",
        "k61_6376\t296\t25\t0\r\n",
        "k61_6377\t205\t10\t0\r\n",
        "k61_6378\t262\t7\t0\r\n",
        "k61_6379\t317\t19\t0\r\n",
        "k61_6380\t463\t42\t0\r\n",
        "k61_6381\t501\t57\t0\r\n",
        "k61_6382\t1087\t114\t0\r\n",
        "k61_6383\t243\t7\t0\r\n",
        "k61_6384\t474\t43\t0\r\n",
        "k61_6385\t312\t31\t0\r\n",
        "k61_6386\t202\t16\t0\r\n",
        "k61_6387\t490\t44\t0\r\n",
        "k61_6390\t379\t31\t0\r\n",
        "k61_6391\t394\t31\t0\r\n",
        "k61_6392\t325\t35\t0\r\n",
        "k61_6394\t393\t36\t0\r\n",
        "k61_6395\t543\t37\t0\r\n",
        "k61_6396\t2072\t259\t0\r\n",
        "k61_6397\t676\t73\t0\r\n",
        "k61_6398\t316\t19\t0\r\n",
        "k61_6399\t230\t11\t0\r\n",
        "k61_6400\t262\t24\t0\r\n",
        "k61_6401\t389\t27\t0\r\n",
        "k61_6402\t412\t22\t0\r\n",
        "k61_6403\t247\t13\t0\r\n",
        "k61_6405\t448\t32\t0\r\n",
        "k61_6406\t240\t37\t0\r\n",
        "k61_6407\t708\t53\t0\r\n",
        "k61_6409\t458\t56\t0\r\n",
        "k61_6412\t483\t36\t0\r\n",
        "k61_6413\t833\t86\t0\r\n",
        "k61_6415\t663\t75\t0\r\n",
        "k61_6416\t369\t31\t0\r\n",
        "k61_6418\t704\t55\t0\r\n",
        "k61_6419\t261\t13\t0\r\n",
        "k61_6420\t1748\t192\t0\r\n",
        "k61_6421\t247\t14\t0\r\n",
        "k61_6422\t239\t17\t0\r\n",
        "k61_6423\t207\t16\t0\r\n",
        "k61_6424\t291\t31\t0\r\n",
        "k61_6425\t256\t29\t0\r\n",
        "k61_6426\t224\t12\t0\r\n",
        "k61_6427\t1311\t130\t0\r\n",
        "k61_6428\t278\t23\t0\r\n",
        "k61_6429\t465\t29\t0\r\n",
        "k61_6430\t855\t71\t0\r\n",
        "k61_6431\t338\t21\t0\r\n",
        "k61_6432\t856\t88\t0\r\n",
        "k61_6433\t970\t84\t0\r\n",
        "k61_6434\t664\t72\t0\r\n",
        "k61_6435\t380\t18\t0\r\n",
        "k61_6436\t453\t35\t0\r\n",
        "k61_6437\t503\t39\t0\r\n",
        "k61_6438\t218\t13\t0\r\n",
        "k61_6439\t345\t25\t0\r\n",
        "k61_6440\t201\t21\t0\r\n",
        "k61_6441\t391\t21\t0\r\n",
        "k61_6442\t333\t17\t0\r\n",
        "k61_6444\t222\t11\t0\r\n",
        "k61_6445\t228\t16\t0\r\n",
        "k61_6446\t647\t58\t0\r\n",
        "k61_6447\t331\t22\t0\r\n",
        "k61_6449\t218\t10\t0\r\n",
        "k61_6450\t216\t28\t0\r\n",
        "k61_6452\t289\t26\t0\r\n",
        "k61_6453\t578\t42\t0\r\n",
        "k61_6454\t873\t107\t0\r\n",
        "k61_6456\t521\t49\t0\r\n",
        "k61_6457\t293\t17\t0\r\n",
        "k61_6458\t255\t19\t0\r\n",
        "k61_6459\t258\t15\t0\r\n",
        "k61_6461\t220\t12\t0\r\n",
        "k61_6462\t234\t13\t0\r\n",
        "k61_6463\t841\t76\t0\r\n",
        "k61_6464\t239\t53\t0\r\n",
        "k61_6465\t406\t22\t0\r\n",
        "k61_6466\t222\t9\t0\r\n",
        "k61_6469\t224\t24\t0\r\n",
        "k61_6470\t1051\t82\t0\r\n",
        "k61_6471\t263\t21\t0\r\n",
        "k61_6473\t1128\t96\t0\r\n",
        "k61_6474\t385\t22\t0\r\n",
        "k61_6475\t346\t16\t0\r\n",
        "k61_6476\t454\t24\t0\r\n",
        "k61_6477\t599\t72\t0\r\n",
        "k61_6478\t570\t49\t0\r\n",
        "k61_6479\t256\t13\t0\r\n",
        "k61_6480\t372\t32\t0\r\n",
        "k61_6481\t273\t18\t0\r\n",
        "k61_6482\t392\t16\t0\r\n",
        "k61_6483\t879\t73\t0\r\n",
        "k61_6484\t1206\t100\t0\r\n",
        "k61_6485\t622\t85\t0\r\n",
        "k61_6486\t376\t19\t0\r\n",
        "k61_6487\t209\t12\t0\r\n",
        "k61_6488\t209\t11\t0\r\n",
        "k61_6489\t277\t13\t0\r\n",
        "k61_6491\t211\t7\t0\r\n",
        "k61_6492\t456\t35\t0\r\n",
        "k61_6493\t1076\t116\t0\r\n",
        "k61_6494\t1052\t94\t0\r\n",
        "k61_6495\t448\t49\t0\r\n",
        "k61_6496\t230\t5\t0\r\n",
        "k61_6497\t212\t8\t0\r\n",
        "k61_6498\t584\t51\t0\r\n",
        "k61_6499\t248\t10\t0\r\n",
        "k61_6500\t859\t97\t0\r\n",
        "k61_6501\t329\t27\t0\r\n",
        "k61_6502\t1000\t85\t0\r\n",
        "k61_6503\t232\t17\t0\r\n",
        "k61_6504\t1162\t134\t0\r\n",
        "k61_6505\t253\t27\t0\r\n",
        "k61_6506\t210\t7\t0\r\n",
        "k61_6507\t680\t43\t0\r\n",
        "k61_6508\t540\t49\t0\r\n",
        "k61_6509\t298\t18\t0\r\n",
        "k61_6510\t360\t23\t0\r\n",
        "k61_6511\t648\t41\t0\r\n",
        "k61_6512\t735\t61\t0\r\n",
        "k61_6513\t364\t36\t0\r\n",
        "k61_6514\t365\t27\t0\r\n",
        "k61_6515\t713\t59\t0\r\n",
        "k61_6516\t224\t13\t0\r\n",
        "k61_6517\t284\t18\t0\r\n",
        "k61_6518\t425\t36\t0\r\n",
        "k61_6519\t202\t12\t0\r\n",
        "k61_6520\t269\t17\t0\r\n",
        "k61_6521\t542\t52\t0\r\n",
        "k61_6522\t1021\t71\t0\r\n",
        "k61_6523\t257\t16\t0\r\n",
        "k61_6525\t214\t6\t0\r\n",
        "k61_6526\t664\t42\t0\r\n",
        "k61_6527\t396\t25\t0\r\n",
        "k61_6530\t220\t14\t0\r\n",
        "k61_6532\t403\t19\t0\r\n",
        "k61_6533\t376\t23\t0\r\n",
        "k61_6534\t257\t8\t0\r\n",
        "k61_6535\t250\t19\t0\r\n",
        "k61_6537\t227\t20\t0\r\n",
        "k61_6538\t370\t20\t0\r\n",
        "k61_6539\t248\t15\t0\r\n",
        "k61_6540\t310\t22\t0\r\n",
        "k61_6541\t282\t9\t0\r\n",
        "k61_6542\t589\t45\t0\r\n",
        "k61_6543\t447\t43\t0\r\n",
        "k61_6544\t248\t6\t0\r\n",
        "k61_6545\t709\t60\t0\r\n",
        "k61_6546\t251\t12\t0\r\n",
        "k61_6547\t231\t10\t0\r\n",
        "k61_6548\t471\t52\t0\r\n",
        "k61_6549\t392\t25\t0\r\n",
        "k61_6550\t333\t35\t0\r\n",
        "k61_6551\t464\t26\t0\r\n",
        "k61_6552\t471\t25\t0\r\n",
        "k61_6553\t604\t47\t0\r\n",
        "k61_6555\t400\t39\t0\r\n",
        "k61_6556\t226\t24\t0\r\n",
        "k61_6557\t444\t23\t0\r\n",
        "k61_6559\t243\t20\t0\r\n",
        "k61_6560\t607\t50\t0\r\n",
        "k61_6561\t685\t49\t0\r\n",
        "k61_6563\t203\t6\t0\r\n",
        "k61_6564\t649\t56\t0\r\n",
        "k61_6565\t219\t12\t0\r\n",
        "k61_6566\t232\t13\t0\r\n",
        "k61_6567\t263\t28\t0\r\n",
        "k61_6568\t330\t14\t0\r\n",
        "k61_6569\t399\t15\t0\r\n",
        "k61_6570\t681\t65\t0\r\n",
        "k61_6571\t295\t10\t0\r\n",
        "k61_6572\t319\t19\t0\r\n",
        "k61_6573\t222\t13\t0\r\n",
        "k61_6574\t378\t25\t0\r\n",
        "k61_6575\t211\t21\t0\r\n",
        "k61_6576\t287\t25\t0\r\n",
        "k61_6577\t239\t6\t0\r\n",
        "k61_6578\t216\t17\t0\r\n",
        "k61_6579\t650\t55\t0\r\n",
        "k61_6581\t283\t26\t0\r\n",
        "k61_6582\t529\t45\t0\r\n",
        "k61_6583\t770\t48\t0\r\n",
        "k61_6584\t555\t35\t0\r\n",
        "k61_6585\t653\t102\t0\r\n",
        "k61_6586\t544\t42\t0\r\n",
        "k61_6588\t313\t22\t0\r\n",
        "k61_6589\t234\t23\t0\r\n",
        "k61_6590\t526\t42\t0\r\n",
        "k61_6591\t240\t6\t0\r\n",
        "k61_6592\t526\t47\t0\r\n",
        "k61_6593\t1110\t104\t0\r\n",
        "k61_6594\t367\t16\t0\r\n",
        "k61_6595\t349\t16\t0\r\n",
        "k61_6596\t248\t11\t0\r\n",
        "k61_6597\t473\t31\t0\r\n",
        "k61_6598\t406\t25\t0\r\n",
        "k61_6599\t634\t65\t0\r\n",
        "k61_6600\t368\t25\t0\r\n",
        "k61_6601\t1054\t124\t0\r\n",
        "k61_6602\t392\t32\t0\r\n",
        "k61_6603\t453\t43\t0\r\n",
        "k61_6604\t340\t28\t0\r\n",
        "k61_6605\t3018\t797\t0\r\n",
        "k61_6606\t561\t31\t0\r\n",
        "k61_6607\t214\t18\t0\r\n",
        "k61_6608\t260\t20\t0\r\n",
        "k61_6609\t785\t53\t0\r\n",
        "k61_6610\t245\t9\t0\r\n",
        "k61_6612\t284\t14\t0\r\n",
        "k61_6613\t3069\t301\t0\r\n",
        "k61_6614\t360\t29\t0\r\n",
        "k61_6617\t327\t23\t0\r\n",
        "k61_6618\t343\t30\t0\r\n",
        "k61_6619\t889\t48\t0\r\n",
        "k61_6620\t542\t50\t0\r\n",
        "k61_6621\t275\t26\t0\r\n",
        "k61_6622\t426\t19\t0\r\n",
        "k61_6623\t537\t49\t0\r\n",
        "k61_6625\t231\t12\t0\r\n",
        "k61_6628\t582\t58\t0\r\n",
        "k61_6629\t784\t70\t0\r\n",
        "k61_6630\t203\t12\t0\r\n",
        "k61_6631\t435\t31\t0\r\n",
        "k61_6632\t344\t30\t0\r\n",
        "k61_6634\t496\t46\t0\r\n",
        "k61_6635\t338\t31\t0\r\n",
        "k61_6636\t350\t29\t0\r\n",
        "k61_6637\t225\t12\t0\r\n",
        "k61_6638\t259\t22\t0\r\n",
        "k61_6639\t347\t24\t0\r\n",
        "k61_6640\t1008\t92\t0\r\n",
        "k61_6642\t374\t36\t0\r\n",
        "k61_6643\t208\t13\t0\r\n",
        "k61_6646\t321\t25\t0\r\n",
        "k61_6647\t334\t26\t0\r\n",
        "k61_6648\t512\t38\t0\r\n",
        "k61_6649\t419\t36\t0\r\n",
        "k61_6650\t672\t48\t0\r\n",
        "k61_6651\t353\t15\t0\r\n",
        "k61_6653\t458\t39\t0\r\n",
        "k61_6654\t760\t75\t0\r\n",
        "k61_6655\t236\t15\t0\r\n",
        "k61_6656\t658\t54\t0\r\n",
        "k61_6657\t230\t7\t0\r\n",
        "k61_6658\t232\t7\t0\r\n",
        "k61_6659\t349\t14\t0\r\n",
        "k61_6660\t216\t11\t0\r\n",
        "k61_6661\t321\t14\t0\r\n",
        "k61_6662\t1139\t113\t0\r\n",
        "k61_6664\t284\t20\t0\r\n",
        "k61_6665\t382\t38\t0\r\n",
        "k61_6666\t204\t11\t0\r\n",
        "k61_6667\t752\t33\t0\r\n",
        "k61_6668\t231\t7\t0\r\n",
        "k61_6669\t285\t26\t0\r\n",
        "k61_6670\t286\t21\t0\r\n",
        "k61_6671\t222\t19\t0\r\n",
        "k61_6672\t219\t9\t0\r\n",
        "k61_6673\t270\t25\t0\r\n",
        "k61_6674\t240\t12\t0\r\n",
        "k61_6675\t327\t25\t0\r\n",
        "k61_6676\t574\t50\t0\r\n",
        "k61_6677\t481\t46\t0\r\n",
        "k61_6678\t380\t25\t0\r\n",
        "k61_6679\t458\t32\t0\r\n",
        "k61_6680\t846\t88\t0\r\n",
        "k61_6681\t206\t10\t0\r\n",
        "k61_6682\t204\t8\t0\r\n",
        "k61_6684\t298\t21\t0\r\n",
        "k61_6687\t387\t16\t0\r\n",
        "k61_6688\t224\t10\t0\r\n",
        "k61_6689\t248\t26\t0\r\n",
        "k61_6690\t245\t8\t0\r\n",
        "k61_6691\t786\t81\t0\r\n",
        "k61_6692\t310\t26\t0\r\n",
        "k61_6693\t212\t16\t0\r\n",
        "k61_6694\t202\t18\t0\r\n",
        "k61_6695\t974\t109\t0\r\n",
        "k61_6696\t214\t13\t0\r\n",
        "k61_6697\t656\t66\t0\r\n",
        "k61_6698\t764\t72\t0\r\n",
        "k61_6700\t563\t50\t0\r\n",
        "k61_6701\t438\t24\t0\r\n",
        "k61_6702\t535\t52\t0\r\n",
        "k61_6704\t327\t21\t0\r\n",
        "k61_6705\t1601\t240\t0\r\n",
        "k61_6706\t640\t70\t0\r\n",
        "k61_6708\t301\t13\t0\r\n",
        "k61_6709\t796\t79\t0\r\n",
        "k61_6710\t220\t9\t0\r\n",
        "k61_6711\t378\t25\t0\r\n",
        "k61_6712\t387\t26\t0\r\n",
        "k61_6713\t611\t75\t0\r\n",
        "k61_6714\t523\t31\t0\r\n",
        "k61_6715\t491\t55\t0\r\n",
        "k61_6716\t427\t30\t0\r\n",
        "k61_6717\t465\t45\t0\r\n",
        "k61_6718\t282\t18\t0\r\n",
        "k61_6719\t798\t43\t0\r\n",
        "k61_6720\t215\t14\t0\r\n",
        "k61_6722\t361\t18\t0\r\n",
        "k61_6723\t1658\t185\t0\r\n",
        "k61_6724\t361\t27\t0\r\n",
        "k61_6726\t532\t40\t0\r\n",
        "k61_6727\t439\t31\t0\r\n",
        "k61_6729\t203\t9\t0\r\n",
        "k61_6730\t638\t50\t0\r\n",
        "k61_6732\t268\t16\t0\r\n",
        "k61_6734\t456\t45\t0\r\n",
        "k61_6735\t832\t55\t0\r\n",
        "k61_6736\t688\t56\t0\r\n",
        "k61_6737\t2317\t298\t0\r\n",
        "k61_6738\t229\t11\t0\r\n",
        "k61_6739\t253\t26\t0\r\n",
        "k61_6740\t308\t24\t0\r\n",
        "k61_6741\t517\t36\t0\r\n",
        "k61_6742\t203\t8\t0\r\n",
        "k61_6743\t770\t79\t0\r\n",
        "k61_6744\t277\t23\t0\r\n",
        "k61_6745\t745\t60\t0\r\n",
        "k61_6746\t328\t28\t0\r\n",
        "k61_6747\t283\t22\t0\r\n",
        "k61_6748\t206\t11\t0\r\n",
        "k61_6749\t228\t6\t0\r\n",
        "k61_6750\t249\t9\t0\r\n",
        "k61_6751\t222\t29\t0\r\n",
        "k61_6753\t206\t16\t0\r\n",
        "k61_6754\t224\t13\t0\r\n",
        "k61_6755\t245\t20\t0\r\n",
        "k61_6756\t223\t8\t0\r\n",
        "k61_6757\t233\t13\t0\r\n",
        "k61_6758\t310\t13\t0\r\n",
        "k61_6759\t302\t13\t0\r\n",
        "k61_6760\t854\t70\t0\r\n",
        "k61_6761\t230\t15\t0\r\n",
        "k61_6763\t232\t12\t0\r\n",
        "k61_6764\t726\t93\t0\r\n",
        "k61_6766\t306\t43\t0\r\n",
        "k61_6767\t572\t42\t0\r\n",
        "k61_6768\t586\t55\t0\r\n",
        "k61_6769\t213\t22\t0\r\n",
        "k61_6770\t712\t35\t0\r\n",
        "k61_6771\t402\t29\t0\r\n",
        "k61_6772\t278\t20\t0\r\n",
        "k61_6773\t326\t29\t0\r\n",
        "k61_6774\t574\t40\t0\r\n",
        "k61_6775\t236\t8\t0\r\n",
        "k61_6776\t260\t13\t0\r\n",
        "k61_6777\t479\t58\t0\r\n",
        "k61_6778\t447\t49\t0\r\n",
        "k61_6779\t253\t31\t0\r\n",
        "k61_6780\t209\t12\t0\r\n",
        "k61_6781\t408\t40\t0\r\n",
        "k61_6782\t240\t17\t0\r\n",
        "k61_6783\t705\t55\t0\r\n",
        "k61_6784\t562\t54\t0\r\n",
        "k61_6785\t616\t60\t0\r\n",
        "k61_6786\t460\t47\t0\r\n",
        "k61_6788\t494\t34\t0\r\n",
        "k61_6789\t1707\t181\t0\r\n",
        "k61_6790\t448\t41\t0\r\n",
        "k61_6791\t276\t22\t0\r\n",
        "k61_6792\t507\t36\t0\r\n",
        "k61_6793\t1184\t98\t0\r\n",
        "k61_6794\t381\t23\t0\r\n",
        "k61_6795\t331\t26\t0\r\n",
        "k61_6796\t338\t31\t0\r\n",
        "k61_6797\t845\t69\t0\r\n",
        "k61_6798\t249\t17\t0\r\n",
        "k61_6799\t458\t28\t0\r\n",
        "k61_6800\t374\t28\t0\r\n",
        "k61_6801\t238\t11\t0\r\n",
        "k61_6802\t326\t19\t0\r\n",
        "k61_6803\t561\t46\t0\r\n",
        "k61_6804\t426\t53\t0\r\n",
        "k61_6806\t276\t31\t0\r\n",
        "k61_6807\t793\t58\t0\r\n",
        "k61_6808\t227\t13\t0\r\n",
        "k61_6809\t219\t10\t0\r\n",
        "k61_6810\t335\t30\t0\r\n",
        "k61_6813\t365\t27\t0\r\n",
        "k61_6814\t361\t27\t0\r\n",
        "k61_6815\t777\t61\t0\r\n",
        "k61_6817\t209\t8\t0\r\n",
        "k61_6818\t216\t12\t0\r\n",
        "k61_6819\t216\t14\t0\r\n",
        "k61_6820\t985\t65\t0\r\n",
        "k61_6821\t216\t15\t0\r\n",
        "k61_6823\t1306\t122\t0\r\n",
        "k61_6824\t916\t74\t0\r\n",
        "k61_6825\t470\t37\t0\r\n",
        "k61_6826\t329\t23\t0\r\n",
        "k61_6827\t464\t24\t0\r\n",
        "k61_6828\t257\t22\t0\r\n",
        "k61_6829\t207\t8\t0\r\n",
        "k61_6830\t1347\t153\t0\r\n",
        "k61_6831\t285\t22\t0\r\n",
        "k61_6832\t420\t30\t0\r\n",
        "k61_6833\t275\t26\t0\r\n",
        "k61_6834\t399\t37\t0\r\n",
        "k61_6835\t1202\t109\t0\r\n",
        "k61_6836\t221\t11\t0\r\n",
        "k61_6837\t495\t37\t0\r\n",
        "k61_6838\t241\t8\t0\r\n",
        "k61_6839\t228\t25\t0\r\n",
        "k61_6840\t305\t31\t0\r\n",
        "k61_6842\t294\t16\t0\r\n",
        "k61_6843\t229\t20\t0\r\n",
        "k61_6844\t462\t38\t0\r\n",
        "k61_6845\t298\t13\t0\r\n",
        "k61_6846\t224\t18\t0\r\n",
        "k61_6847\t262\t12\t0\r\n",
        "k61_6848\t299\t20\t0\r\n",
        "k61_6849\t203\t9\t0\r\n",
        "k61_6850\t332\t19\t0\r\n",
        "k61_6851\t381\t32\t0\r\n",
        "k61_6852\t299\t29\t0\r\n",
        "k61_6853\t304\t20\t0\r\n",
        "k61_6854\t283\t14\t0\r\n",
        "k61_6855\t514\t33\t0\r\n",
        "k61_6856\t217\t21\t0\r\n",
        "k61_6858\t1162\t142\t0\r\n",
        "k61_6859\t565\t45\t0\r\n",
        "k61_6860\t472\t38\t0\r\n",
        "k61_6861\t218\t9\t0\r\n",
        "k61_6863\t335\t13\t0\r\n",
        "k61_6864\t229\t11\t0\r\n",
        "k61_6865\t540\t34\t0\r\n",
        "k61_6866\t501\t30\t0\r\n",
        "k61_6867\t211\t10\t0\r\n",
        "k61_6868\t302\t20\t0\r\n",
        "k61_6869\t260\t23\t0\r\n",
        "k61_6870\t208\t10\t0\r\n",
        "k61_6872\t276\t17\t0\r\n",
        "k61_6873\t224\t9\t0\r\n",
        "k61_6874\t478\t46\t0\r\n",
        "k61_6875\t707\t50\t0\r\n",
        "k61_6876\t749\t59\t0\r\n",
        "k61_6877\t530\t39\t0\r\n",
        "k61_6878\t389\t25\t0\r\n",
        "k61_6880\t321\t17\t0\r\n",
        "k61_6881\t753\t83\t0\r\n",
        "k61_6882\t462\t38\t0\r\n",
        "k61_6883\t962\t120\t0\r\n",
        "k61_6885\t214\t8\t0\r\n",
        "k61_6886\t320\t19\t0\r\n",
        "k61_6889\t395\t22\t0\r\n",
        "k61_6890\t375\t35\t0\r\n",
        "k61_6891\t268\t21\t0\r\n",
        "k61_6892\t416\t35\t0\r\n",
        "k61_6893\t482\t97\t0\r\n",
        "k61_6894\t1291\t146\t0\r\n",
        "k61_6895\t242\t15\t0\r\n",
        "k61_6896\t209\t7\t0\r\n",
        "k61_6897\t328\t29\t0\r\n",
        "k61_6898\t210\t12\t0\r\n",
        "k61_6899\t955\t84\t0\r\n",
        "k61_6900\t233\t11\t0\r\n",
        "k61_6901\t805\t55\t0\r\n",
        "k61_6903\t1061\t92\t0\r\n",
        "k61_6904\t382\t28\t0\r\n",
        "k61_6906\t2153\t2560\t0\r\n",
        "k61_6908\t242\t8\t0\r\n",
        "k61_6909\t353\t25\t0\r\n",
        "k61_6910\t348\t27\t0\r\n",
        "k61_6911\t507\t36\t0\r\n",
        "k61_6912\t434\t43\t0\r\n",
        "k61_6913\t280\t16\t0\r\n",
        "k61_6914\t382\t21\t0\r\n",
        "k61_6915\t495\t35\t0\r\n",
        "k61_6916\t443\t52\t0\r\n",
        "k61_6917\t536\t28\t0\r\n",
        "k61_6918\t222\t9\t0\r\n",
        "k61_6919\t381\t37\t0\r\n",
        "k61_6920\t346\t35\t0\r\n",
        "k61_6921\t251\t15\t0\r\n",
        "k61_6922\t384\t25\t0\r\n",
        "k61_6923\t229\t12\t0\r\n",
        "k61_6924\t281\t16\t0\r\n",
        "k61_6925\t878\t84\t0\r\n",
        "k61_6926\t1015\t105\t0\r\n",
        "k61_6927\t478\t90\t0\r\n",
        "k61_6928\t692\t423\t0\r\n",
        "k61_6929\t755\t42\t0\r\n",
        "k61_6930\t352\t29\t0\r\n",
        "k61_6931\t280\t24\t0\r\n",
        "k61_6932\t388\t23\t0\r\n",
        "k61_6933\t234\t9\t0\r\n",
        "k61_6934\t284\t30\t0\r\n",
        "k61_6935\t630\t58\t0\r\n",
        "k61_6936\t540\t48\t0\r\n",
        "k61_6937\t239\t12\t0\r\n",
        "k61_6938\t469\t27\t0\r\n",
        "k61_6939\t300\t20\t0\r\n",
        "k61_6940\t684\t71\t0\r\n",
        "k61_6941\t261\t27\t0\r\n",
        "k61_6942\t272\t18\t0\r\n",
        "k61_6943\t994\t91\t0\r\n",
        "k61_6944\t1002\t107\t0\r\n",
        "k61_6945\t340\t26\t0\r\n",
        "k61_6946\t705\t72\t0\r\n",
        "k61_6947\t396\t36\t0\r\n",
        "k61_6948\t243\t16\t0\r\n",
        "k61_6949\t940\t77\t0\r\n",
        "k61_6950\t401\t32\t0\r\n",
        "k61_6951\t688\t74\t0\r\n",
        "k61_6952\t309\t23\t0\r\n",
        "k61_6953\t221\t14\t0\r\n",
        "k61_6954\t203\t7\t0\r\n",
        "k61_6955\t252\t29\t0\r\n",
        "k61_6956\t2366\t269\t0\r\n",
        "k61_6958\t375\t24\t0\r\n",
        "k61_6959\t874\t97\t0\r\n",
        "k61_6960\t214\t12\t0\r\n",
        "k61_6961\t744\t71\t0\r\n",
        "k61_6962\t541\t32\t0\r\n",
        "k61_6963\t687\t63\t0\r\n",
        "k61_6964\t278\t13\t0\r\n",
        "k61_6965\t210\t14\t0\r\n",
        "k61_6966\t240\t10\t0\r\n",
        "k61_6967\t740\t71\t0\r\n",
        "k61_6968\t251\t13\t0\r\n",
        "k61_6969\t238\t16\t0\r\n",
        "k61_6970\t498\t26\t0\r\n",
        "k61_6971\t715\t78\t0\r\n",
        "k61_6972\t1037\t115\t0\r\n",
        "k61_6974\t636\t53\t0\r\n",
        "k61_6975\t215\t12\t0\r\n",
        "k61_6976\t206\t7\t0\r\n",
        "k61_6977\t490\t33\t0\r\n",
        "k61_6978\t446\t33\t0\r\n",
        "k61_6980\t808\t101\t0\r\n",
        "k61_6981\t439\t25\t0\r\n",
        "k61_6982\t390\t31\t0\r\n",
        "k61_6983\t349\t22\t0\r\n",
        "k61_6984\t217\t9\t0\r\n",
        "k61_6985\t641\t48\t0\r\n",
        "k61_6986\t1495\t182\t0\r\n",
        "k61_6987\t370\t21\t0\r\n",
        "k61_6988\t248\t19\t0\r\n",
        "k61_6989\t330\t20\t0\r\n",
        "k61_6990\t282\t31\t0\r\n",
        "k61_6991\t328\t21\t0\r\n",
        "k61_6992\t302\t16\t0\r\n",
        "k61_6993\t202\t14\t0\r\n",
        "k61_6994\t558\t41\t0\r\n",
        "k61_6995\t226\t12\t0\r\n",
        "k61_6997\t716\t55\t0\r\n",
        "k61_6998\t1595\t602\t0\r\n",
        "k61_6999\t317\t18\t0\r\n",
        "k61_7000\t361\t28\t0\r\n",
        "k61_7002\t283\t20\t0\r\n",
        "k61_7003\t695\t43\t0\r\n",
        "k61_7004\t508\t48\t0\r\n",
        "k61_7005\t211\t10\t0\r\n",
        "k61_7006\t1101\t110\t0\r\n",
        "k61_7007\t314\t33\t0\r\n",
        "k61_7008\t865\t56\t0\r\n",
        "k61_7009\t319\t18\t0\r\n",
        "k61_7010\t349\t18\t0\r\n",
        "k61_7011\t396\t39\t0\r\n",
        "k61_7012\t770\t73\t0\r\n",
        "k61_7013\t290\t14\t0\r\n",
        "k61_7014\t233\t15\t0\r\n",
        "k61_7015\t329\t24\t0\r\n",
        "k61_7016\t243\t16\t0\r\n",
        "k61_7017\t292\t16\t0\r\n",
        "k61_7018\t410\t46\t0\r\n",
        "k61_7019\t858\t1007\t0\r\n",
        "k61_7021\t270\t16\t0\r\n",
        "k61_7022\t466\t55\t0\r\n",
        "k61_7023\t395\t30\t0\r\n",
        "k61_7024\t406\t32\t0\r\n",
        "k61_7025\t283\t127\t0\r\n",
        "k61_7026\t503\t61\t0\r\n",
        "k61_7027\t576\t49\t0\r\n",
        "k61_7028\t235\t7\t0\r\n",
        "k61_7029\t699\t99\t0\r\n",
        "k61_7030\t388\t37\t0\r\n",
        "k61_7031\t456\t28\t0\r\n",
        "k61_7032\t322\t12\t0\r\n",
        "k61_7033\t314\t12\t0\r\n",
        "k61_7034\t262\t17\t0\r\n",
        "k61_7037\t1433\t221\t0\r\n",
        "k61_7038\t817\t63\t0\r\n",
        "k61_7039\t372\t14\t0\r\n",
        "k61_7040\t212\t12\t0\r\n",
        "k61_7041\t233\t11\t0\r\n",
        "k61_7042\t210\t7\t0\r\n",
        "k61_7043\t228\t14\t0\r\n",
        "k61_7044\t427\t27\t0\r\n",
        "k61_7045\t212\t12\t0\r\n",
        "k61_7046\t274\t11\t0\r\n",
        "k61_7047\t673\t66\t0\r\n",
        "k61_7048\t538\t38\t0\r\n",
        "k61_7049\t359\t18\t0\r\n",
        "k61_7051\t334\t19\t0\r\n",
        "k61_7052\t339\t15\t0\r\n",
        "k61_7054\t582\t45\t0\r\n",
        "k61_7055\t393\t26\t0\r\n",
        "k61_7056\t392\t21\t0\r\n",
        "k61_7057\t284\t16\t0\r\n",
        "k61_7058\t717\t66\t0\r\n",
        "k61_7059\t814\t82\t0\r\n",
        "k61_7060\t245\t21\t0\r\n",
        "k61_7061\t242\t14\t0\r\n",
        "k61_7062\t1513\t134\t0\r\n",
        "k61_7063\t950\t86\t0\r\n",
        "k61_7064\t206\t16\t0\r\n",
        "k61_7065\t392\t20\t0\r\n",
        "k61_7067\t458\t23\t0\r\n",
        "k61_7068\t253\t22\t0\r\n",
        "k61_7069\t648\t59\t0\r\n",
        "k61_7071\t995\t79\t0\r\n",
        "k61_7072\t493\t49\t0\r\n",
        "k61_7073\t306\t27\t0\r\n",
        "k61_7074\t222\t10\t0\r\n",
        "k61_7075\t313\t23\t0\r\n",
        "k61_7076\t881\t63\t0\r\n",
        "k61_7077\t290\t13\t0\r\n",
        "k61_7078\t205\t5\t0\r\n",
        "k61_7079\t294\t20\t0\r\n",
        "k61_7080\t408\t48\t0\r\n",
        "k61_7081\t387\t26\t0\r\n",
        "k61_7082\t341\t25\t0\r\n",
        "k61_7083\t242\t21\t0\r\n",
        "k61_7085\t515\t35\t0\r\n",
        "k61_7086\t400\t21\t0\r\n",
        "k61_7087\t433\t26\t0\r\n",
        "k61_7088\t261\t12\t0\r\n",
        "k61_7089\t471\t29\t0\r\n",
        "k61_7090\t241\t5\t0\r\n",
        "k61_7091\t230\t8\t0\r\n",
        "k61_7092\t245\t5\t0\r\n",
        "k61_7093\t1297\t128\t0\r\n",
        "k61_7095\t553\t42\t0\r\n",
        "k61_7096\t280\t17\t0\r\n",
        "k61_7097\t1047\t85\t0\r\n",
        "k61_7098\t375\t26\t0\r\n",
        "k61_7099\t712\t68\t0\r\n",
        "k61_7100\t276\t17\t0\r\n",
        "k61_7101\t244\t20\t0\r\n",
        "k61_7102\t244\t12\t0\r\n",
        "k61_7103\t320\t24\t0\r\n",
        "k61_7104\t339\t19\t0\r\n",
        "k61_7105\t998\t89\t0\r\n",
        "k61_7107\t776\t62\t0\r\n",
        "k61_7108\t329\t21\t0\r\n",
        "k61_7109\t1348\t116\t0\r\n",
        "k61_7110\t3825\t6512\t0\r\n",
        "k61_7111\t323\t21\t0\r\n",
        "k61_7112\t592\t47\t0\r\n",
        "k61_7113\t433\t35\t0\r\n",
        "k61_7114\t1598\t175\t0\r\n",
        "k61_7115\t303\t26\t0\r\n",
        "k61_7117\t596\t45\t0\r\n",
        "k61_7118\t560\t50\t0\r\n",
        "k61_7119\t488\t56\t0\r\n",
        "k61_7120\t453\t38\t0\r\n",
        "k61_7121\t250\t13\t0\r\n",
        "k61_7122\t329\t21\t0\r\n",
        "k61_7123\t201\t14\t0\r\n",
        "k61_7124\t311\t13\t0\r\n",
        "k61_7125\t1392\t156\t0\r\n",
        "k61_7126\t231\t10\t0\r\n",
        "k61_7127\t526\t56\t0\r\n",
        "k61_7128\t229\t13\t0\r\n",
        "k61_7129\t221\t6\t0\r\n",
        "k61_7130\t420\t21\t0\r\n",
        "k61_7131\t268\t30\t0\r\n",
        "k61_7132\t205\t7\t0\r\n",
        "k61_7133\t246\t19\t0\r\n",
        "k61_7134\t848\t91\t0\r\n",
        "k61_7135\t334\t19\t0\r\n",
        "k61_7136\t278\t18\t0\r\n",
        "k61_7138\t410\t25\t0\r\n",
        "k61_7139\t214\t10\t0\r\n",
        "k61_7140\t225\t17\t0\r\n",
        "k61_7141\t626\t75\t0\r\n",
        "k61_7142\t219\t17\t0\r\n",
        "k61_7144\t256\t12\t0\r\n",
        "k61_7145\t378\t42\t0\r\n",
        "k61_7146\t201\t7\t0\r\n",
        "k61_7147\t270\t7\t0\r\n",
        "k61_7148\t620\t52\t0\r\n",
        "k61_7149\t390\t22\t0\r\n",
        "k61_7150\t410\t20\t0\r\n",
        "k61_7151\t215\t10\t0\r\n",
        "k61_7152\t510\t44\t0\r\n",
        "k61_7153\t529\t33\t0\r\n",
        "k61_7154\t269\t9\t0\r\n",
        "k61_7155\t2528\t306\t0\r\n",
        "k61_7156\t272\t13\t0\r\n",
        "k61_7157\t432\t32\t0\r\n",
        "k61_7158\t536\t39\t0\r\n",
        "k61_7159\t526\t38\t0\r\n",
        "k61_7160\t441\t36\t0\r\n",
        "k61_7161\t936\t85\t0\r\n",
        "k61_7162\t259\t16\t0\r\n",
        "k61_7163\t585\t41\t0\r\n",
        "k61_7164\t2248\t248\t0\r\n",
        "k61_7165\t243\t12\t0\r\n",
        "k61_7166\t446\t45\t0\r\n",
        "k61_7167\t681\t75\t0\r\n",
        "k61_7168\t449\t45\t0\r\n",
        "k61_7169\t449\t51\t0\r\n",
        "k61_7170\t210\t12\t0\r\n",
        "k61_7171\t228\t6\t0\r\n",
        "k61_7172\t784\t75\t0\r\n",
        "k61_7173\t461\t38\t0\r\n",
        "k61_7174\t267\t20\t0\r\n",
        "k61_7175\t1390\t130\t0\r\n",
        "k61_7176\t475\t29\t0\r\n",
        "k61_7178\t650\t49\t0\r\n",
        "k61_7179\t346\t25\t0\r\n",
        "k61_7180\t282\t18\t0\r\n",
        "k61_7181\t658\t60\t0\r\n",
        "k61_7182\t376\t19\t0\r\n",
        "k61_7183\t412\t36\t0\r\n",
        "k61_7184\t297\t25\t0\r\n",
        "k61_7185\t1365\t147\t0\r\n",
        "k61_7187\t334\t18\t0\r\n",
        "k61_7188\t661\t64\t0\r\n",
        "k61_7190\t396\t25\t0\r\n",
        "k61_7192\t741\t72\t0\r\n",
        "k61_7193\t218\t12\t0\r\n",
        "k61_7194\t253\t22\t0\r\n",
        "k61_7195\t664\t53\t0\r\n",
        "k61_7196\t512\t53\t0\r\n",
        "k61_7197\t230\t18\t0\r\n",
        "k61_7198\t224\t12\t0\r\n",
        "k61_7199\t241\t26\t0\r\n",
        "k61_7200\t450\t58\t0\r\n",
        "k61_7201\t208\t17\t0\r\n",
        "k61_7202\t807\t51\t0\r\n",
        "k61_7203\t1327\t133\t0\r\n",
        "k61_7204\t991\t109\t0\r\n",
        "k61_7205\t406\t35\t0\r\n",
        "k61_7206\t205\t7\t0\r\n",
        "k61_7207\t412\t34\t0\r\n",
        "k61_7208\t695\t53\t0\r\n",
        "k61_7209\t444\t34\t0\r\n",
        "k61_7210\t268\t18\t0\r\n",
        "k61_7211\t278\t9\t0\r\n",
        "k61_7212\t840\t68\t0\r\n",
        "k61_7213\t417\t36\t0\r\n",
        "k61_7214\t254\t28\t0\r\n",
        "k61_7215\t956\t90\t0\r\n",
        "k61_7216\t349\t27\t0\r\n",
        "k61_7217\t269\t15\t0\r\n",
        "k61_7218\t383\t30\t0\r\n",
        "k61_7219\t206\t10\t0\r\n",
        "k61_7220\t371\t32\t0\r\n",
        "k61_7221\t606\t43\t0\r\n",
        "k61_7222\t421\t32\t0\r\n",
        "k61_7223\t494\t43\t0\r\n",
        "k61_7224\t327\t24\t0\r\n",
        "k61_7225\t220\t12\t0\r\n",
        "k61_7226\t241\t15\t0\r\n",
        "k61_7227\t554\t54\t0\r\n",
        "k61_7228\t646\t43\t0\r\n",
        "k61_7229\t246\t14\t0\r\n",
        "k61_7230\t205\t7\t0\r\n",
        "k61_7231\t1021\t73\t0\r\n",
        "k61_7232\t367\t23\t0\r\n",
        "k61_7233\t256\t17\t0\r\n",
        "k61_7234\t1705\t142\t0\r\n",
        "k61_7235\t272\t15\t0\r\n",
        "k61_7237\t335\t22\t0\r\n",
        "k61_7238\t385\t32\t0\r\n",
        "k61_7240\t207\t16\t0\r\n",
        "k61_7241\t255\t11\t0\r\n",
        "k61_7242\t551\t39\t0\r\n",
        "k61_7243\t532\t39\t0\r\n",
        "k61_7244\t853\t106\t0\r\n",
        "k61_7245\t267\t11\t0\r\n",
        "k61_7246\t463\t34\t0\r\n",
        "k61_7247\t366\t25\t0\r\n",
        "k61_7248\t264\t22\t0\r\n",
        "k61_7249\t216\t6\t0\r\n",
        "k61_7250\t637\t50\t0\r\n",
        "k61_7251\t482\t37\t0\r\n",
        "k61_7252\t1668\t158\t0\r\n",
        "k61_7253\t205\t19\t0\r\n",
        "k61_7255\t210\t24\t0\r\n",
        "k61_7256\t259\t15\t0\r\n",
        "k61_7258\t229\t20\t0\r\n",
        "k61_7259\t239\t9\t0\r\n",
        "k61_7260\t681\t57\t0\r\n",
        "k61_7262\t210\t12\t0\r\n",
        "k61_7263\t246\t16\t0\r\n",
        "k61_7264\t351\t29\t0\r\n",
        "k61_7265\t205\t11\t0\r\n",
        "k61_7266\t555\t41\t0\r\n",
        "k61_7267\t365\t39\t0\r\n",
        "k61_7268\t326\t27\t0\r\n",
        "k61_7269\t485\t47\t0\r\n",
        "k61_7270\t572\t48\t0\r\n",
        "k61_7271\t200\t8\t0\r\n",
        "k61_7272\t382\t28\t0\r\n",
        "k61_7273\t484\t55\t0\r\n",
        "k61_7274\t256\t25\t0\r\n",
        "k61_7275\t240\t16\t0\r\n",
        "k61_7276\t425\t29\t0\r\n",
        "k61_7277\t208\t8\t0\r\n",
        "k61_7278\t270\t17\t0\r\n",
        "k61_7279\t354\t25\t0\r\n",
        "k61_7280\t206\t8\t0\r\n",
        "k61_7281\t200\t13\t0\r\n",
        "k61_7282\t244\t9\t0\r\n",
        "k61_7283\t391\t35\t0\r\n",
        "k61_7284\t209\t17\t0\r\n",
        "k61_7285\t487\t30\t0\r\n",
        "k61_7286\t533\t45\t0\r\n",
        "k61_7287\t312\t30\t0\r\n",
        "k61_7288\t315\t26\t0\r\n",
        "k61_7289\t269\t21\t0\r\n",
        "k61_7290\t300\t15\t0\r\n",
        "k61_7291\t874\t77\t0\r\n",
        "k61_7292\t1300\t130\t0\r\n",
        "k61_7293\t459\t45\t0\r\n",
        "k61_7295\t664\t76\t0\r\n",
        "k61_7296\t272\t11\t0\r\n",
        "k61_7298\t257\t12\t0\r\n",
        "k61_7299\t1319\t125\t0\r\n",
        "k61_7300\t446\t56\t0\r\n",
        "k61_7301\t220\t20\t0\r\n",
        "k61_7302\t923\t89\t0\r\n",
        "k61_7303\t323\t20\t0\r\n",
        "k61_7304\t227\t17\t0\r\n",
        "k61_7305\t658\t51\t0\r\n",
        "k61_7306\t1066\t102\t0\r\n",
        "k61_7307\t207\t20\t0\r\n",
        "k61_7308\t338\t15\t0\r\n",
        "k61_7309\t610\t60\t0\r\n",
        "k61_7310\t255\t19\t0\r\n",
        "k61_7311\t310\t24\t0\r\n",
        "k61_7312\t380\t29\t0\r\n",
        "k61_7313\t414\t16\t0\r\n",
        "k61_7314\t382\t15\t0\r\n",
        "k61_7315\t1035\t89\t0\r\n",
        "k61_7316\t798\t69\t0\r\n",
        "k61_7317\t201\t7\t0\r\n",
        "k61_7318\t281\t16\t0\r\n",
        "k61_7319\t254\t18\t0\r\n",
        "k61_7320\t296\t11\t0\r\n",
        "k61_7321\t519\t58\t0\r\n",
        "k61_7322\t260\t8\t0\r\n",
        "k61_7323\t406\t44\t0\r\n",
        "k61_7324\t256\t24\t0\r\n",
        "k61_7325\t359\t29\t0\r\n",
        "k61_7326\t408\t24\t0\r\n",
        "k61_7328\t298\t12\t0\r\n",
        "k61_7329\t419\t25\t0\r\n",
        "k61_7330\t519\t40\t0\r\n",
        "k61_7331\t268\t24\t0\r\n",
        "k61_7332\t473\t39\t0\r\n",
        "k61_7334\t392\t30\t0\r\n",
        "k61_7335\t276\t22\t0\r\n",
        "k61_7337\t777\t88\t0\r\n",
        "k61_7338\t620\t53\t0\r\n",
        "k61_7339\t435\t43\t0\r\n",
        "k61_7340\t208\t7\t0\r\n",
        "k61_7341\t928\t97\t0\r\n",
        "k61_7343\t296\t36\t0\r\n",
        "k61_7344\t1135\t96\t0\r\n",
        "k61_7345\t327\t69\t0\r\n",
        "k61_7346\t246\t10\t0\r\n",
        "k61_7347\t501\t43\t0\r\n",
        "k61_7348\t379\t26\t0\r\n",
        "k61_7349\t525\t48\t0\r\n",
        "k61_7350\t203\t14\t0\r\n",
        "k61_7351\t361\t15\t0\r\n",
        "k61_7352\t223\t5\t0\r\n",
        "k61_7353\t357\t18\t0\r\n",
        "k61_7355\t252\t12\t0\r\n",
        "k61_7356\t251\t18\t0\r\n",
        "k61_7358\t227\t9\t0\r\n",
        "k61_7359\t255\t26\t0\r\n",
        "k61_7360\t352\t18\t0\r\n",
        "k61_7361\t375\t23\t0\r\n",
        "k61_7362\t209\t12\t0\r\n",
        "k61_7363\t1233\t108\t0\r\n",
        "k61_7364\t355\t31\t0\r\n",
        "k61_7365\t943\t74\t0\r\n",
        "k61_7366\t1630\t151\t0\r\n",
        "k61_7367\t296\t10\t0\r\n",
        "k61_7368\t275\t21\t0\r\n",
        "k61_7369\t398\t27\t0\r\n",
        "k61_7371\t351\t35\t0\r\n",
        "k61_7372\t551\t48\t0\r\n",
        "k61_7374\t299\t18\t0\r\n",
        "k61_7375\t297\t30\t0\r\n",
        "k61_7376\t219\t23\t0\r\n",
        "k61_7377\t259\t16\t0\r\n",
        "k61_7378\t665\t48\t0\r\n",
        "k61_7379\t293\t21\t0\r\n",
        "k61_7380\t444\t28\t0\r\n",
        "k61_7381\t237\t8\t0\r\n",
        "k61_7382\t229\t9\t0\r\n",
        "k61_7383\t212\t8\t0\r\n",
        "k61_7384\t305\t28\t0\r\n",
        "k61_7385\t512\t36\t0\r\n",
        "k61_7386\t208\t21\t0\r\n",
        "k61_7387\t544\t48\t0\r\n",
        "k61_7388\t666\t43\t0\r\n",
        "k61_7389\t512\t44\t0\r\n",
        "k61_7391\t254\t22\t0\r\n",
        "k61_7392\t1007\t84\t0\r\n",
        "k61_7394\t229\t9\t0\r\n",
        "k61_7395\t1445\t164\t0\r\n",
        "k61_7396\t225\t16\t0\r\n",
        "k61_7397\t1451\t125\t0\r\n",
        "k61_7398\t320\t20\t0\r\n",
        "k61_7399\t330\t27\t0\r\n",
        "k61_7400\t246\t7\t0\r\n",
        "k61_7401\t649\t54\t0\r\n",
        "k61_7402\t384\t22\t0\r\n",
        "k61_7403\t816\t65\t0\r\n",
        "k61_7405\t533\t58\t0\r\n",
        "k61_7407\t201\t8\t0\r\n",
        "k61_7408\t1215\t130\t0\r\n",
        "k61_7409\t318\t23\t0\r\n",
        "k61_7411\t291\t28\t0\r\n",
        "k61_7412\t200\t9\t0\r\n",
        "k61_7413\t674\t66\t0\r\n",
        "k61_7414\t651\t59\t0\r\n",
        "k61_7415\t299\t17\t0\r\n",
        "k61_7416\t753\t83\t0\r\n",
        "k61_7417\t261\t20\t0\r\n",
        "k61_7418\t592\t73\t0\r\n",
        "k61_7420\t245\t15\t0\r\n",
        "k61_7421\t203\t38\t0\r\n",
        "k61_7422\t428\t34\t0\r\n",
        "k61_7423\t281\t16\t0\r\n",
        "k61_7424\t578\t46\t0\r\n",
        "k61_7425\t201\t15\t0\r\n",
        "k61_7426\t225\t20\t0\r\n",
        "k61_7427\t556\t34\t0\r\n",
        "k61_7428\t271\t19\t0\r\n",
        "k61_7429\t348\t23\t0\r\n",
        "k61_7431\t214\t9\t0\r\n",
        "k61_7432\t579\t64\t0\r\n",
        "k61_7433\t229\t15\t0\r\n",
        "k61_7434\t272\t27\t0\r\n",
        "k61_7435\t2170\t219\t0\r\n",
        "k61_7436\t203\t6\t0\r\n",
        "k61_7438\t250\t8\t0\r\n",
        "k61_7439\t366\t20\t0\r\n",
        "k61_7440\t737\t55\t0\r\n",
        "k61_7441\t539\t40\t0\r\n",
        "k61_7442\t211\t14\t0\r\n",
        "k61_7443\t278\t14\t0\r\n",
        "k61_7444\t229\t19\t0\r\n",
        "k61_7445\t295\t15\t0\r\n",
        "k61_7447\t616\t32\t0\r\n",
        "k61_7448\t387\t31\t0\r\n",
        "k61_7449\t680\t52\t0\r\n",
        "k61_7450\t236\t22\t0\r\n",
        "k61_7451\t449\t32\t0\r\n",
        "k61_7452\t333\t28\t0\r\n",
        "k61_7453\t344\t19\t0\r\n",
        "k61_7454\t466\t42\t0\r\n",
        "k61_7456\t304\t15\t0\r\n",
        "k61_7457\t242\t15\t0\r\n",
        "k61_7458\t933\t102\t0\r\n",
        "k61_7459\t500\t56\t0\r\n",
        "k61_7460\t351\t22\t0\r\n",
        "k61_7461\t399\t25\t0\r\n",
        "k61_7462\t577\t51\t0\r\n",
        "k61_7463\t486\t32\t0\r\n",
        "k61_7464\t489\t41\t0\r\n",
        "k61_7465\t749\t62\t0\r\n",
        "k61_7466\t261\t18\t0\r\n",
        "k61_7467\t201\t10\t0\r\n",
        "k61_7468\t720\t67\t0\r\n",
        "k61_7469\t458\t32\t0\r\n",
        "k61_7470\t689\t45\t0\r\n",
        "k61_7471\t248\t9\t0\r\n",
        "k61_7472\t328\t17\t0\r\n",
        "k61_7474\t441\t86\t0\r\n",
        "k61_7476\t248\t35\t0\r\n",
        "k61_7477\t633\t56\t0\r\n",
        "k61_7478\t218\t10\t0\r\n",
        "k61_7479\t305\t16\t0\r\n",
        "k61_7480\t267\t26\t0\r\n",
        "k61_7481\t249\t7\t0\r\n",
        "k61_7483\t760\t64\t0\r\n",
        "k61_7484\t774\t57\t0\r\n",
        "k61_7486\t406\t31\t0\r\n",
        "k61_7487\t479\t21\t0\r\n",
        "k61_7488\t290\t16\t0\r\n",
        "k61_7489\t216\t8\t0\r\n",
        "k61_7490\t435\t26\t0\r\n",
        "k61_7491\t322\t25\t0\r\n",
        "k61_7492\t232\t9\t0\r\n",
        "k61_7493\t772\t69\t0\r\n",
        "k61_7494\t308\t20\t0\r\n",
        "k61_7496\t236\t11\t0\r\n",
        "k61_7497\t228\t23\t0\r\n",
        "k61_7498\t314\t13\t0\r\n",
        "k61_7499\t1316\t110\t0\r\n",
        "k61_7500\t313\t13\t0\r\n",
        "k61_7502\t208\t10\t0\r\n",
        "k61_7503\t210\t8\t0\r\n",
        "k61_7504\t552\t69\t0\r\n",
        "k61_7505\t606\t71\t0\r\n",
        "k61_7506\t275\t27\t0\r\n",
        "k61_7507\t813\t51\t0\r\n",
        "k61_7508\t1460\t136\t0\r\n",
        "k61_7510\t210\t8\t0\r\n",
        "k61_7511\t265\t20\t0\r\n",
        "k61_7512\t533\t48\t0\r\n",
        "k61_7513\t220\t14\t0\r\n",
        "k61_7514\t403\t37\t0\r\n",
        "k61_7515\t223\t13\t0\r\n",
        "k61_7516\t508\t44\t0\r\n",
        "k61_7517\t302\t28\t0\r\n",
        "k61_7518\t427\t33\t0\r\n",
        "k61_7519\t465\t35\t0\r\n",
        "k61_7520\t245\t24\t0\r\n",
        "k61_7521\t779\t84\t0\r\n",
        "k61_7522\t1921\t215\t0\r\n",
        "k61_7523\t313\t27\t0\r\n",
        "k61_7525\t631\t73\t0\r\n",
        "k61_7526\t736\t47\t0\r\n",
        "k61_7527\t360\t18\t0\r\n",
        "k61_7528\t244\t9\t0\r\n",
        "k61_7529\t249\t17\t0\r\n",
        "k61_7530\t208\t9\t0\r\n",
        "k61_7531\t227\t7\t0\r\n",
        "k61_7532\t279\t27\t0\r\n",
        "k61_7533\t851\t69\t0\r\n",
        "k61_7534\t328\t16\t0\r\n",
        "k61_7535\t528\t45\t0\r\n",
        "k61_7536\t520\t53\t0\r\n",
        "k61_7537\t528\t32\t0\r\n",
        "k61_7538\t323\t15\t0\r\n",
        "k61_7539\t1094\t109\t0\r\n",
        "k61_7540\t443\t37\t0\r\n",
        "k61_7541\t217\t8\t0\r\n",
        "k61_7542\t273\t25\t0\r\n",
        "k61_7543\t250\t16\t0\r\n",
        "k61_7544\t205\t13\t0\r\n",
        "k61_7545\t238\t6\t0\r\n",
        "k61_7546\t458\t49\t0\r\n",
        "k61_7547\t257\t10\t0\r\n",
        "k61_7548\t242\t30\t0\r\n",
        "k61_7549\t418\t44\t0\r\n",
        "k61_7550\t287\t15\t0\r\n",
        "k61_7551\t1147\t93\t0\r\n",
        "k61_7552\t299\t17\t0\r\n",
        "k61_7553\t221\t9\t0\r\n",
        "k61_7554\t206\t5\t0\r\n",
        "k61_7555\t221\t11\t0\r\n",
        "k61_7556\t1204\t129\t0\r\n",
        "k61_7557\t860\t92\t0\r\n",
        "k61_7558\t1166\t102\t0\r\n",
        "k61_7559\t304\t20\t0\r\n",
        "k61_7560\t389\t38\t0\r\n",
        "k61_7561\t254\t13\t0\r\n",
        "k61_7562\t954\t77\t0\r\n",
        "k61_7563\t537\t37\t0\r\n",
        "k61_7564\t338\t36\t0\r\n",
        "k61_7566\t208\t6\t0\r\n",
        "k61_7567\t241\t15\t0\r\n",
        "k61_7568\t294\t28\t0\r\n",
        "k61_7569\t389\t17\t0\r\n",
        "k61_7570\t296\t20\t0\r\n",
        "k61_7571\t267\t22\t0\r\n",
        "k61_7572\t380\t43\t0\r\n",
        "k61_7573\t583\t45\t0\r\n",
        "k61_7574\t258\t14\t0\r\n",
        "k61_7575\t265\t15\t0\r\n",
        "k61_7577\t315\t34\t0\r\n",
        "k61_7579\t409\t25\t0\r\n",
        "k61_7580\t346\t18\t0\r\n",
        "k61_7581\t305\t17\t0\r\n",
        "k61_7583\t408\t47\t0\r\n",
        "k61_7584\t310\t11\t0\r\n",
        "k61_7585\t727\t66\t0\r\n",
        "k61_7586\t452\t28\t0\r\n",
        "k61_7588\t316\t23\t0\r\n",
        "k61_7589\t219\t9\t0\r\n",
        "k61_7591\t1268\t111\t0\r\n",
        "k61_7592\t248\t13\t0\r\n",
        "k61_7593\t359\t26\t0\r\n",
        "k61_7594\t225\t15\t0\r\n",
        "k61_7595\t956\t99\t0\r\n",
        "k61_7596\t243\t11\t0\r\n",
        "k61_7597\t4518\t1003\t0\r\n",
        "k61_7598\t366\t34\t0\r\n",
        "k61_7599\t403\t31\t0\r\n",
        "k61_7600\t228\t7\t0\r\n",
        "k61_7601\t304\t18\t0\r\n",
        "k61_7602\t362\t10\t0\r\n",
        "k61_7603\t306\t17\t0\r\n",
        "k61_7604\t881\t78\t0\r\n",
        "k61_7605\t470\t33\t0\r\n",
        "k61_7606\t552\t37\t0\r\n",
        "k61_7608\t734\t74\t0\r\n",
        "k61_7609\t464\t46\t0\r\n",
        "k61_7610\t213\t12\t0\r\n",
        "k61_7611\t359\t22\t0\r\n",
        "k61_7612\t276\t20\t0\r\n",
        "k61_7613\t203\t7\t0\r\n",
        "k61_7615\t267\t16\t0\r\n",
        "k61_7616\t712\t66\t0\r\n",
        "k61_7617\t1929\t210\t0\r\n",
        "k61_7618\t278\t16\t0\r\n",
        "k61_7619\t460\t39\t0\r\n",
        "k61_7620\t390\t18\t0\r\n",
        "k61_7621\t908\t84\t0\r\n",
        "k61_7622\t315\t29\t0\r\n",
        "k61_7625\t388\t31\t0\r\n",
        "k61_7626\t630\t78\t0\r\n",
        "k61_7627\t505\t43\t0\r\n",
        "k61_7628\t299\t38\t0\r\n",
        "k61_7630\t201\t13\t0\r\n",
        "k61_7631\t388\t31\t0\r\n",
        "k61_7632\t501\t57\t0\r\n",
        "k61_7633\t253\t18\t0\r\n",
        "k61_7634\t321\t26\t0\r\n",
        "k61_7636\t916\t110\t0\r\n",
        "k61_7637\t255\t33\t0\r\n",
        "k61_7638\t308\t22\t0\r\n",
        "k61_7639\t422\t22\t0\r\n",
        "k61_7640\t330\t21\t0\r\n",
        "k61_7641\t210\t17\t0\r\n",
        "k61_7643\t289\t12\t0\r\n",
        "k61_7645\t416\t47\t0\r\n",
        "k61_7647\t458\t44\t0\r\n",
        "k61_7648\t218\t16\t0\r\n",
        "k61_7649\t412\t49\t0\r\n",
        "k61_7650\t947\t79\t0\r\n",
        "k61_7651\t259\t18\t0\r\n",
        "k61_7652\t350\t18\t0\r\n",
        "k61_7653\t250\t10\t0\r\n",
        "k61_7654\t684\t63\t0\r\n",
        "k61_7655\t215\t17\t0\r\n",
        "k61_7656\t584\t38\t0\r\n",
        "k61_7657\t205\t15\t0\r\n",
        "k61_7658\t245\t19\t0\r\n",
        "k61_7659\t226\t12\t0\r\n",
        "k61_7660\t204\t12\t0\r\n",
        "k61_7661\t200\t8\t0\r\n",
        "k61_7662\t662\t60\t0\r\n",
        "k61_7663\t291\t20\t0\r\n",
        "k61_7664\t322\t12\t0\r\n",
        "k61_7665\t404\t52\t0\r\n",
        "k61_7668\t246\t10\t0\r\n",
        "k61_7669\t376\t15\t0\r\n",
        "k61_7670\t701\t59\t0\r\n",
        "k61_7671\t1326\t112\t0\r\n",
        "k61_7672\t302\t16\t0\r\n",
        "k61_7673\t259\t10\t0\r\n",
        "k61_7675\t235\t9\t0\r\n",
        "k61_7676\t414\t31\t0\r\n",
        "k61_7677\t420\t34\t0\r\n",
        "k61_7678\t317\t13\t0\r\n",
        "k61_7679\t202\t8\t0\r\n",
        "k61_7680\t256\t12\t0\r\n",
        "k61_7681\t275\t21\t0\r\n",
        "k61_7682\t203\t15\t0\r\n",
        "k61_7683\t911\t110\t0\r\n",
        "k61_7684\t1383\t229\t0\r\n",
        "k61_7685\t312\t23\t0\r\n",
        "k61_7686\t535\t56\t0\r\n",
        "k61_7687\t265\t8\t0\r\n",
        "k61_7688\t708\t69\t0\r\n",
        "k61_7689\t355\t20\t0\r\n",
        "k61_7690\t223\t8\t0\r\n",
        "k61_7691\t909\t73\t0\r\n",
        "k61_7692\t236\t14\t0\r\n",
        "k61_7693\t564\t46\t0\r\n",
        "k61_7694\t1569\t344\t0\r\n",
        "k61_7696\t209\t10\t0\r\n",
        "k61_7698\t216\t10\t0\r\n",
        "k61_7699\t215\t8\t0\r\n",
        "k61_7701\t414\t35\t0\r\n",
        "k61_7702\t317\t29\t0\r\n",
        "k61_7703\t1357\t157\t0\r\n",
        "k61_7704\t552\t58\t0\r\n",
        "k61_7706\t387\t21\t0\r\n",
        "k61_7707\t511\t37\t0\r\n",
        "k61_7708\t592\t38\t0\r\n",
        "k61_7709\t798\t94\t0\r\n",
        "k61_7710\t448\t30\t0\r\n",
        "k61_7711\t239\t20\t0\r\n",
        "k61_7712\t331\t25\t0\r\n",
        "k61_7713\t309\t17\t0\r\n",
        "k61_7714\t1020\t81\t0\r\n",
        "k61_7715\t551\t54\t0\r\n",
        "k61_7717\t252\t30\t0\r\n",
        "k61_7718\t564\t42\t0\r\n",
        "k61_7719\t456\t47\t0\r\n",
        "k61_7720\t963\t70\t0\r\n",
        "k61_7721\t305\t11\t0\r\n",
        "k61_7722\t320\t22\t0\r\n",
        "k61_7723\t1237\t128\t0\r\n",
        "k61_7725\t314\t26\t0\r\n",
        "k61_7726\t308\t28\t0\r\n",
        "k61_7727\t235\t22\t0\r\n",
        "k61_7728\t253\t23\t0\r\n",
        "k61_7729\t624\t52\t0\r\n",
        "k61_7730\t220\t11\t0\r\n",
        "k61_7731\t394\t24\t0\r\n",
        "k61_7733\t401\t25\t0\r\n",
        "k61_7734\t292\t10\t0\r\n",
        "k61_7736\t372\t22\t0\r\n",
        "k61_7738\t497\t52\t0\r\n",
        "k61_7739\t404\t33\t0\r\n",
        "k61_7741\t390\t25\t0\r\n",
        "k61_7742\t204\t7\t0\r\n",
        "k61_7743\t352\t25\t0\r\n",
        "k61_7744\t206\t14\t0\r\n",
        "k61_7745\t354\t18\t0\r\n",
        "k61_7746\t262\t21\t0\r\n",
        "k61_7747\t448\t19\t0\r\n",
        "k61_7749\t426\t12\t0\r\n",
        "k61_7750\t571\t61\t0\r\n",
        "k61_7751\t720\t54\t0\r\n",
        "k61_7752\t291\t13\t0\r\n",
        "k61_7754\t454\t37\t0\r\n",
        "k61_7755\t615\t44\t0\r\n",
        "k61_7756\t410\t26\t0\r\n",
        "k61_7758\t221\t12\t0\r\n",
        "k61_7760\t1087\t80\t0\r\n",
        "k61_7761\t484\t39\t0\r\n",
        "k61_7762\t276\t18\t0\r\n",
        "k61_7763\t410\t24\t0\r\n",
        "k61_7764\t263\t25\t0\r\n",
        "k61_7765\t353\t20\t0\r\n",
        "k61_7766\t204\t6\t0\r\n",
        "k61_7767\t246\t12\t0\r\n",
        "k61_7768\t671\t72\t0\r\n",
        "k61_7770\t537\t43\t0\r\n",
        "k61_7772\t938\t107\t0\r\n",
        "k61_7774\t801\t47\t0\r\n",
        "k61_7775\t362\t46\t0\r\n",
        "k61_7776\t227\t20\t0\r\n",
        "k61_7777\t707\t52\t0\r\n",
        "k61_7778\t527\t40\t0\r\n",
        "k61_7779\t339\t15\t0\r\n",
        "k61_7780\t292\t12\t0\r\n",
        "k61_7781\t234\t13\t0\r\n",
        "k61_7782\t403\t22\t0\r\n",
        "k61_7783\t430\t32\t0\r\n",
        "k61_7784\t834\t86\t0\r\n",
        "k61_7786\t2991\t345\t0\r\n",
        "k61_7787\t656\t59\t0\r\n",
        "k61_7788\t306\t10\t0\r\n",
        "k61_7790\t320\t16\t0\r\n",
        "k61_7791\t240\t22\t0\r\n",
        "k61_7793\t413\t37\t0\r\n",
        "k61_7794\t240\t11\t0\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "k61_7796\t333\t19\t0\r\n",
        "k61_7799\t400\t85\t0\r\n",
        "k61_7800\t432\t44\t0\r\n",
        "k61_7801\t438\t38\t0\r\n",
        "k61_7802\t214\t5\t0\r\n",
        "k61_7803\t479\t28\t0\r\n",
        "k61_7804\t232\t20\t0\r\n",
        "k61_7805\t256\t20\t0\r\n",
        "k61_7806\t774\t78\t0\r\n",
        "k61_7807\t332\t15\t0\r\n",
        "k61_7808\t235\t11\t0\r\n",
        "k61_7809\t1199\t107\t0\r\n",
        "k61_7810\t796\t60\t0\r\n",
        "k61_7812\t896\t72\t0\r\n",
        "k61_7813\t212\t9\t0\r\n",
        "k61_7814\t237\t14\t0\r\n",
        "k61_7816\t221\t11\t0\r\n",
        "k61_7817\t239\t9\t0\r\n",
        "k61_7818\t346\t36\t0\r\n",
        "k61_7819\t355\t23\t0\r\n",
        "k61_7820\t418\t31\t0\r\n",
        "k61_7821\t362\t18\t0\r\n",
        "k61_7822\t253\t9\t0\r\n",
        "k61_7824\t316\t20\t0\r\n",
        "k61_7825\t471\t39\t0\r\n",
        "k61_7826\t205\t13\t0\r\n",
        "k61_7828\t295\t22\t0\r\n",
        "k61_7830\t736\t65\t0\r\n",
        "k61_7831\t1139\t73\t0\r\n",
        "k61_7832\t217\t14\t0\r\n",
        "k61_7833\t472\t45\t0\r\n",
        "k61_7834\t426\t49\t0\r\n",
        "k61_7835\t412\t38\t0\r\n",
        "k61_7836\t351\t21\t0\r\n",
        "k61_7837\t698\t60\t0\r\n",
        "k61_7838\t324\t24\t0\r\n",
        "k61_7839\t284\t21\t0\r\n",
        "k61_7840\t256\t23\t0\r\n",
        "k61_7841\t311\t20\t0\r\n",
        "k61_7842\t312\t31\t0\r\n",
        "k61_7843\t253\t9\t0\r\n",
        "k61_7845\t343\t19\t0\r\n",
        "k61_7846\t656\t49\t0\r\n",
        "k61_7847\t207\t11\t0\r\n",
        "k61_7849\t326\t29\t0\r\n",
        "k61_7851\t219\t18\t0\r\n",
        "k61_7852\t1200\t121\t0\r\n",
        "k61_7853\t941\t78\t0\r\n",
        "k61_7854\t389\t21\t0\r\n",
        "k61_7855\t268\t16\t0\r\n",
        "k61_7856\t352\t23\t0\r\n",
        "k61_7857\t300\t13\t0\r\n",
        "k61_7858\t237\t9\t0\r\n",
        "k61_7859\t300\t20\t0\r\n",
        "k61_7860\t296\t27\t0\r\n",
        "k61_7861\t202\t19\t0\r\n",
        "k61_7862\t974\t75\t0\r\n",
        "k61_7863\t478\t37\t0\r\n",
        "k61_7865\t904\t59\t0\r\n",
        "k61_7866\t335\t28\t0\r\n",
        "k61_7867\t212\t23\t0\r\n",
        "k61_7868\t390\t37\t0\r\n",
        "k61_7869\t1385\t137\t0\r\n",
        "k61_7870\t275\t22\t0\r\n",
        "k61_7871\t365\t34\t0\r\n",
        "k61_7872\t863\t88\t0\r\n",
        "k61_7873\t277\t17\t0\r\n",
        "k61_7874\t838\t87\t0\r\n",
        "k61_7875\t317\t26\t0\r\n",
        "k61_7876\t308\t19\t0\r\n",
        "k61_7877\t974\t111\t0\r\n",
        "k61_7878\t494\t33\t0\r\n",
        "k61_7879\t264\t11\t0\r\n",
        "k61_7880\t238\t8\t0\r\n",
        "k61_7881\t229\t18\t0\r\n",
        "k61_7882\t1559\t122\t0\r\n",
        "k61_7883\t222\t11\t0\r\n",
        "k61_7884\t1200\t122\t0\r\n",
        "k61_7885\t1043\t102\t0\r\n",
        "k61_7886\t601\t70\t0\r\n",
        "k61_7887\t240\t13\t0\r\n",
        "k61_7888\t368\t32\t0\r\n",
        "k61_7889\t340\t24\t0\r\n",
        "k61_7890\t256\t20\t0\r\n",
        "k61_7891\t256\t17\t0\r\n",
        "k61_7892\t2134\t283\t0\r\n",
        "k61_7893\t486\t42\t0\r\n",
        "k61_7894\t589\t41\t0\r\n",
        "k61_7895\t402\t39\t0\r\n",
        "k61_7896\t204\t25\t0\r\n",
        "k61_7897\t267\t15\t0\r\n",
        "k61_7898\t295\t15\t0\r\n",
        "k61_7899\t292\t15\t0\r\n",
        "k61_7900\t542\t45\t0\r\n",
        "k61_7901\t202\t10\t0\r\n",
        "k61_7902\t205\t8\t0\r\n",
        "k61_7903\t201\t7\t0\r\n",
        "k61_7904\t219\t17\t0\r\n",
        "k61_7905\t229\t12\t0\r\n",
        "k61_7906\t466\t36\t0\r\n",
        "k61_7907\t365\t33\t0\r\n",
        "k61_7908\t248\t24\t0\r\n",
        "k61_7909\t235\t16\t0\r\n",
        "k61_7910\t412\t36\t0\r\n",
        "k61_7911\t219\t35\t0\r\n",
        "k61_7914\t609\t57\t0\r\n",
        "k61_7915\t220\t11\t0\r\n",
        "k61_7916\t424\t30\t0\r\n",
        "k61_7917\t228\t12\t0\r\n",
        "k61_7918\t291\t26\t0\r\n",
        "k61_7919\t644\t59\t0\r\n",
        "k61_7920\t318\t20\t0\r\n",
        "k61_7921\t227\t13\t0\r\n",
        "k61_7922\t335\t18\t0\r\n",
        "k61_7923\t204\t5\t0\r\n",
        "k61_7924\t653\t64\t0\r\n",
        "k61_7925\t298\t25\t0\r\n",
        "k61_7926\t283\t21\t0\r\n",
        "k61_7927\t229\t9\t0\r\n",
        "k61_7928\t256\t21\t0\r\n",
        "k61_7929\t250\t20\t0\r\n",
        "k61_7930\t222\t12\t0\r\n",
        "k61_7931\t281\t17\t0\r\n",
        "k61_7933\t201\t9\t0\r\n",
        "k61_7934\t264\t23\t0\r\n",
        "k61_7935\t1014\t68\t0\r\n",
        "k61_7936\t232\t7\t0\r\n",
        "k61_7937\t209\t14\t0\r\n",
        "k61_7939\t427\t24\t0\r\n",
        "k61_7940\t608\t51\t0\r\n",
        "k61_7941\t639\t79\t0\r\n",
        "k61_7942\t409\t41\t0\r\n",
        "k61_7943\t634\t34\t0\r\n",
        "k61_7944\t216\t12\t0\r\n",
        "k61_7945\t292\t28\t0\r\n",
        "k61_7946\t912\t83\t0\r\n",
        "k61_7947\t284\t9\t0\r\n",
        "k61_7948\t395\t28\t0\r\n",
        "k61_7949\t1484\t140\t0\r\n",
        "k61_7950\t775\t73\t0\r\n",
        "k61_7951\t255\t35\t0\r\n",
        "k61_7952\t301\t13\t0\r\n",
        "k61_7953\t284\t14\t0\r\n",
        "k61_7954\t334\t30\t0\r\n",
        "k61_7955\t444\t30\t0\r\n",
        "k61_7956\t290\t8\t0\r\n",
        "k61_7957\t276\t15\t0\r\n",
        "k61_7958\t327\t26\t0\r\n",
        "k61_7959\t430\t30\t0\r\n",
        "k61_7960\t553\t47\t0\r\n",
        "k61_7961\t759\t63\t0\r\n",
        "k61_7962\t343\t19\t0\r\n",
        "k61_7964\t242\t22\t0\r\n",
        "k61_7965\t412\t35\t0\r\n",
        "k61_7966\t494\t61\t0\r\n",
        "k61_7967\t285\t22\t0\r\n",
        "k61_7968\t267\t23\t0\r\n",
        "k61_7969\t277\t14\t0\r\n",
        "k61_7970\t351\t26\t0\r\n",
        "k61_7971\t208\t19\t0\r\n",
        "k61_7972\t203\t12\t0\r\n",
        "k61_7973\t402\t32\t0\r\n",
        "k61_7974\t464\t44\t0\r\n",
        "k61_7975\t273\t20\t0\r\n",
        "k61_7976\t269\t24\t0\r\n",
        "k61_7977\t383\t26\t0\r\n",
        "k61_7978\t306\t21\t0\r\n",
        "k61_7980\t243\t16\t0\r\n",
        "k61_7981\t494\t41\t0\r\n",
        "k61_7982\t276\t22\t0\r\n",
        "k61_7983\t234\t14\t0\r\n",
        "k61_7984\t352\t24\t0\r\n",
        "k61_7985\t899\t84\t0\r\n",
        "k61_7987\t417\t37\t0\r\n",
        "k61_7988\t353\t30\t0\r\n",
        "k61_7990\t646\t59\t0\r\n",
        "k61_7991\t279\t20\t0\r\n",
        "k61_7992\t385\t38\t0\r\n",
        "k61_7993\t492\t34\t0\r\n",
        "k61_7994\t1435\t144\t0\r\n",
        "k61_7995\t576\t50\t0\r\n",
        "k61_7996\t761\t51\t0\r\n",
        "k61_7997\t421\t36\t0\r\n",
        "k61_7998\t210\t8\t0\r\n",
        "k61_8000\t360\t37\t0\r\n",
        "k61_8001\t254\t11\t0\r\n",
        "k61_8002\t378\t52\t0\r\n",
        "k61_8003\t908\t79\t0\r\n",
        "k61_8004\t626\t58\t0\r\n",
        "k61_8005\t274\t24\t0\r\n",
        "k61_8006\t836\t71\t0\r\n",
        "k61_8007\t394\t34\t0\r\n",
        "k61_8008\t894\t72\t0\r\n",
        "k61_8009\t520\t44\t0\r\n",
        "k61_8010\t431\t42\t0\r\n",
        "k61_8011\t234\t15\t0\r\n",
        "k61_8012\t339\t16\t0\r\n",
        "k61_8014\t335\t39\t0\r\n",
        "k61_8015\t269\t22\t0\r\n",
        "k61_8016\t284\t10\t0\r\n",
        "k61_8017\t212\t10\t0\r\n",
        "k61_8018\t435\t33\t0\r\n",
        "k61_8019\t248\t14\t0\r\n",
        "k61_8020\t466\t29\t0\r\n",
        "k61_8021\t394\t23\t0\r\n",
        "k61_8022\t828\t108\t0\r\n",
        "k61_8023\t548\t41\t0\r\n",
        "k61_8024\t395\t22\t0\r\n",
        "k61_8025\t528\t42\t0\r\n",
        "k61_8026\t231\t7\t0\r\n",
        "k61_8027\t455\t35\t0\r\n",
        "k61_8028\t263\t9\t0\r\n",
        "k61_8029\t508\t45\t0\r\n",
        "k61_8030\t285\t13\t0\r\n",
        "k61_8031\t290\t17\t0\r\n",
        "k61_8032\t331\t12\t0\r\n",
        "k61_8033\t677\t61\t0\r\n",
        "k61_8034\t239\t11\t0\r\n",
        "k61_8035\t1277\t99\t0\r\n",
        "k61_8036\t613\t58\t0\r\n",
        "k61_8037\t488\t44\t0\r\n",
        "k61_8038\t227\t10\t0\r\n",
        "k61_8039\t408\t29\t0\r\n",
        "k61_8040\t254\t17\t0\r\n",
        "k61_8041\t244\t24\t0\r\n",
        "k61_8042\t274\t10\t0\r\n",
        "k61_8043\t230\t14\t0\r\n",
        "k61_8044\t224\t8\t0\r\n",
        "k61_8045\t261\t14\t0\r\n",
        "k61_8046\t300\t44\t0\r\n",
        "k61_8047\t1172\t97\t0\r\n",
        "k61_8048\t337\t26\t0\r\n",
        "k61_8049\t1620\t190\t0\r\n",
        "k61_8050\t436\t26\t0\r\n",
        "k61_8051\t1138\t108\t0\r\n",
        "k61_8052\t214\t19\t0\r\n",
        "k61_8053\t266\t28\t0\r\n",
        "k61_8054\t350\t15\t0\r\n",
        "k61_8055\t394\t23\t0\r\n",
        "k61_8058\t283\t22\t0\r\n",
        "k61_8059\t313\t17\t0\r\n",
        "k61_8060\t206\t7\t0\r\n",
        "k61_8061\t876\t62\t0\r\n",
        "k61_8062\t734\t66\t0\r\n",
        "k61_8064\t200\t6\t0\r\n",
        "k61_8065\t232\t11\t0\r\n",
        "k61_8067\t289\t15\t0\r\n",
        "k61_8069\t245\t10\t0\r\n",
        "k61_8070\t460\t22\t0\r\n",
        "k61_8073\t304\t11\t0\r\n",
        "k61_8074\t298\t17\t0\r\n",
        "k61_8075\t231\t16\t0\r\n",
        "k61_8076\t400\t24\t0\r\n",
        "k61_8077\t302\t27\t0\r\n",
        "k61_8078\t475\t43\t0\r\n",
        "k61_8079\t1256\t112\t0\r\n",
        "k61_8080\t224\t15\t0\r\n",
        "k61_8082\t309\t11\t0\r\n",
        "k61_8083\t677\t63\t0\r\n",
        "k61_8084\t900\t94\t0\r\n",
        "k61_8085\t332\t27\t0\r\n",
        "k61_8086\t378\t23\t0\r\n",
        "k61_8087\t280\t23\t0\r\n",
        "k61_8088\t328\t16\t0\r\n",
        "k61_8089\t1533\t138\t0\r\n",
        "k61_8090\t224\t7\t0\r\n",
        "k61_8092\t293\t15\t0\r\n",
        "k61_8093\t232\t12\t0\r\n",
        "k61_8094\t218\t18\t0\r\n",
        "k61_8095\t224\t7\t0\r\n",
        "k61_8096\t451\t50\t0\r\n",
        "k61_8098\t670\t58\t0\r\n",
        "k61_8099\t639\t66\t0\r\n",
        "k61_8101\t446\t33\t0\r\n",
        "k61_8102\t261\t14\t0\r\n",
        "k61_8103\t502\t46\t0\r\n",
        "k61_8105\t286\t17\t0\r\n",
        "k61_8106\t503\t65\t0\r\n",
        "k61_8107\t228\t6\t0\r\n",
        "k61_8108\t209\t8\t0\r\n",
        "k61_8110\t498\t40\t0\r\n",
        "k61_8111\t232\t12\t0\r\n",
        "k61_8112\t330\t19\t0\r\n",
        "k61_8113\t432\t31\t0\r\n",
        "k61_8114\t309\t25\t0\r\n",
        "k61_8115\t568\t52\t0\r\n",
        "k61_8116\t420\t25\t0\r\n",
        "k61_8117\t429\t17\t0\r\n",
        "k61_8118\t936\t72\t0\r\n",
        "k61_8119\t391\t29\t0\r\n",
        "k61_8121\t204\t10\t0\r\n",
        "k61_8122\t459\t33\t0\r\n",
        "k61_8123\t283\t15\t0\r\n",
        "k61_8124\t1080\t110\t0\r\n",
        "k61_8125\t473\t43\t0\r\n",
        "k61_8128\t267\t17\t0\r\n",
        "k61_8129\t218\t8\t0\r\n",
        "k61_8130\t372\t26\t0\r\n",
        "k61_8131\t448\t32\t0\r\n",
        "k61_8132\t258\t15\t0\r\n",
        "k61_8133\t235\t20\t0\r\n",
        "k61_8134\t210\t6\t0\r\n",
        "k61_8135\t234\t26\t0\r\n",
        "k61_8136\t211\t5\t0\r\n",
        "k61_8137\t311\t17\t0\r\n",
        "k61_8138\t229\t11\t0\r\n",
        "k61_8139\t498\t37\t0\r\n",
        "k61_8140\t432\t50\t0\r\n",
        "k61_8141\t221\t12\t0\r\n",
        "k61_8142\t1001\t80\t0\r\n",
        "k61_8143\t1179\t100\t0\r\n",
        "k61_8144\t245\t10\t0\r\n",
        "k61_8145\t202\t9\t0\r\n",
        "k61_8146\t220\t8\t0\r\n",
        "k61_8147\t316\t28\t0\r\n",
        "k61_8148\t1161\t129\t0\r\n",
        "k61_8149\t256\t23\t0\r\n",
        "k61_8152\t422\t31\t0\r\n",
        "k61_8153\t354\t19\t0\r\n",
        "k61_8154\t265\t13\t0\r\n",
        "k61_8155\t350\t24\t0\r\n",
        "k61_8156\t374\t27\t0\r\n",
        "k61_8157\t679\t44\t0\r\n",
        "k61_8158\t573\t52\t0\r\n",
        "k61_8159\t481\t37\t0\r\n",
        "k61_8160\t254\t15\t0\r\n",
        "k61_8161\t340\t41\t0\r\n",
        "k61_8162\t398\t37\t0\r\n",
        "k61_8163\t240\t20\t0\r\n",
        "k61_8164\t403\t28\t0\r\n",
        "k61_8165\t205\t8\t0\r\n",
        "k61_8166\t209\t8\t0\r\n",
        "k61_8167\t329\t49\t0\r\n",
        "k61_8168\t349\t18\t0\r\n",
        "k61_8169\t1310\t104\t0\r\n",
        "k61_8170\t277\t14\t0\r\n",
        "k61_8171\t203\t8\t0\r\n",
        "k61_8172\t438\t20\t0\r\n",
        "k61_8173\t206\t8\t0\r\n",
        "k61_8174\t238\t10\t0\r\n",
        "k61_8175\t569\t49\t0\r\n",
        "k61_8176\t401\t39\t0\r\n",
        "k61_8177\t339\t21\t0\r\n",
        "k61_8178\t251\t13\t0\r\n",
        "k61_8179\t405\t22\t0\r\n",
        "k61_8180\t222\t18\t0\r\n",
        "k61_8181\t257\t20\t0\r\n",
        "k61_8182\t286\t12\t0\r\n",
        "k61_8183\t460\t56\t0\r\n",
        "k61_8184\t293\t38\t0\r\n",
        "k61_8185\t322\t36\t0\r\n",
        "k61_8186\t313\t20\t0\r\n",
        "k61_8187\t501\t38\t0\r\n",
        "k61_8188\t373\t39\t0\r\n",
        "k61_8189\t462\t40\t0\r\n",
        "k61_8190\t331\t21\t0\r\n",
        "k61_8191\t559\t46\t0\r\n",
        "k61_8192\t551\t44\t0\r\n",
        "k61_8193\t414\t41\t0\r\n",
        "k61_8194\t419\t39\t0\r\n",
        "k61_8195\t220\t7\t0\r\n",
        "k61_8197\t252\t8\t0\r\n",
        "k61_8198\t1544\t147\t0\r\n",
        "k61_8199\t237\t16\t0\r\n",
        "k61_8200\t306\t20\t0\r\n",
        "k61_8201\t588\t46\t0\r\n",
        "k61_8203\t1093\t124\t0\r\n",
        "k61_8204\t241\t8\t0\r\n",
        "k61_8205\t894\t115\t0\r\n",
        "k61_8206\t2130\t231\t0\r\n",
        "k61_8207\t214\t10\t0\r\n",
        "k61_8208\t316\t29\t0\r\n",
        "k61_8209\t375\t23\t0\r\n",
        "k61_8210\t426\t34\t0\r\n",
        "k61_8212\t266\t24\t0\r\n",
        "k61_8213\t235\t13\t0\r\n",
        "k61_8214\t1140\t123\t0\r\n",
        "k61_8218\t272\t19\t0\r\n",
        "k61_8219\t407\t32\t0\r\n",
        "k61_8220\t389\t32\t0\r\n",
        "k61_8221\t364\t137\t0\r\n",
        "k61_8222\t289\t32\t0\r\n",
        "k61_8223\t245\t16\t0\r\n",
        "k61_8224\t204\t23\t0\r\n",
        "k61_8226\t600\t40\t0\r\n",
        "k61_8227\t904\t77\t0\r\n",
        "k61_8228\t259\t17\t0\r\n",
        "k61_8229\t550\t63\t0\r\n",
        "k61_8230\t617\t65\t0\r\n",
        "k61_8231\t1573\t256\t0\r\n",
        "k61_8232\t340\t26\t0\r\n",
        "k61_8234\t692\t62\t0\r\n",
        "k61_8236\t251\t11\t0\r\n",
        "k61_8237\t495\t38\t0\r\n",
        "k61_8238\t213\t6\t0\r\n",
        "k61_8239\t268\t22\t0\r\n",
        "k61_8240\t575\t211\t0\r\n",
        "k61_8241\t405\t34\t0\r\n",
        "k61_8242\t337\t24\t0\r\n",
        "k61_8243\t257\t8\t0\r\n",
        "k61_8244\t635\t45\t0\r\n",
        "k61_8245\t223\t8\t0\r\n",
        "k61_8246\t214\t16\t0\r\n",
        "k61_8247\t264\t16\t0\r\n",
        "k61_8248\t287\t16\t0\r\n",
        "k61_8249\t202\t6\t0\r\n",
        "k61_8250\t394\t25\t0\r\n",
        "k61_8252\t404\t29\t0\r\n",
        "k61_8253\t451\t38\t0\r\n",
        "k61_8254\t450\t22\t0\r\n",
        "k61_8255\t985\t95\t0\r\n",
        "k61_8256\t1025\t112\t0\r\n",
        "k61_8257\t234\t8\t0\r\n",
        "k61_8258\t211\t12\t0\r\n",
        "k61_8259\t556\t40\t0\r\n",
        "k61_8260\t207\t17\t0\r\n",
        "k61_8261\t212\t16\t0\r\n",
        "k61_8263\t329\t28\t0\r\n",
        "k61_8265\t2015\t232\t0\r\n",
        "k61_8266\t338\t15\t0\r\n",
        "k61_8267\t361\t29\t0\r\n",
        "k61_8268\t1033\t89\t0\r\n",
        "k61_8269\t441\t42\t0\r\n",
        "k61_8270\t457\t33\t0\r\n",
        "k61_8271\t474\t41\t0\r\n",
        "k61_8272\t371\t22\t0\r\n",
        "k61_8273\t683\t40\t0\r\n",
        "k61_8274\t236\t11\t0\r\n",
        "k61_8275\t271\t11\t0\r\n",
        "k61_8276\t1059\t93\t0\r\n",
        "k61_8278\t211\t9\t0\r\n",
        "k61_8280\t320\t26\t0\r\n",
        "k61_8281\t349\t19\t0\r\n",
        "k61_8282\t240\t16\t0\r\n",
        "k61_8283\t711\t89\t0\r\n",
        "k61_8284\t1068\t105\t0\r\n",
        "k61_8285\t1034\t115\t0\r\n",
        "k61_8286\t1544\t145\t0\r\n",
        "k61_8287\t7999\t4036\t0\r\n",
        "k61_8288\t753\t64\t0\r\n",
        "k61_8289\t551\t37\t0\r\n",
        "k61_8290\t493\t35\t0\r\n",
        "k61_8291\t232\t9\t0\r\n",
        "k61_8292\t296\t11\t0\r\n",
        "k61_8293\t320\t20\t0\r\n",
        "k61_8294\t326\t32\t0\r\n",
        "k61_8295\t560\t44\t0\r\n",
        "k61_8296\t502\t27\t0\r\n",
        "k61_8297\t372\t35\t0\r\n",
        "k61_8299\t453\t35\t0\r\n",
        "k61_8300\t214\t16\t0\r\n",
        "k61_8301\t721\t84\t0\r\n",
        "k61_8302\t252\t16\t0\r\n",
        "k61_8303\t212\t10\t0\r\n",
        "k61_8304\t287\t18\t0\r\n",
        "k61_8305\t370\t17\t0\r\n",
        "k61_8306\t261\t19\t0\r\n",
        "k61_8307\t991\t87\t0\r\n",
        "k61_8308\t466\t32\t0\r\n",
        "k61_8309\t453\t59\t0\r\n",
        "k61_8310\t755\t74\t0\r\n",
        "k61_8311\t645\t76\t0\r\n",
        "k61_8312\t714\t60\t0\r\n",
        "k61_8314\t693\t64\t0\r\n",
        "k61_8315\t555\t54\t0\r\n",
        "k61_8316\t497\t58\t0\r\n",
        "k61_8317\t234\t17\t0\r\n",
        "k61_8318\t482\t28\t0\r\n",
        "k61_8319\t217\t12\t0\r\n",
        "k61_8320\t766\t49\t0\r\n",
        "k61_8321\t245\t22\t0\r\n",
        "k61_8322\t430\t25\t0\r\n",
        "k61_8324\t867\t57\t0\r\n",
        "k61_8325\t501\t67\t0\r\n",
        "k61_8326\t226\t16\t0\r\n",
        "k61_8327\t226\t6\t0\r\n",
        "k61_8328\t239\t23\t0\r\n",
        "k61_8329\t327\t25\t0\r\n",
        "k61_8330\t243\t23\t0\r\n",
        "k61_8331\t524\t34\t0\r\n",
        "k61_8332\t567\t49\t0\r\n",
        "k61_8333\t214\t9\t0\r\n",
        "k61_8334\t249\t10\t0\r\n",
        "k61_8335\t313\t26\t0\r\n",
        "k61_8336\t248\t16\t0\r\n",
        "k61_8337\t261\t16\t0\r\n",
        "k61_8338\t211\t5\t0\r\n",
        "k61_8339\t439\t30\t0\r\n",
        "k61_8340\t691\t42\t0\r\n",
        "k61_8341\t211\t14\t0\r\n",
        "k61_8342\t571\t46\t0\r\n",
        "k61_8343\t448\t46\t0\r\n",
        "k61_8345\t265\t14\t0\r\n",
        "k61_8346\t258\t17\t0\r\n",
        "k61_8347\t386\t24\t0\r\n",
        "k61_8348\t458\t38\t0\r\n",
        "k61_8350\t857\t69\t0\r\n",
        "k61_8351\t317\t47\t0\r\n",
        "k61_8352\t306\t17\t0\r\n",
        "k61_8353\t305\t20\t0\r\n",
        "k61_8354\t276\t12\t0\r\n",
        "k61_8355\t255\t20\t0\r\n",
        "k61_8356\t256\t23\t0\r\n",
        "k61_8357\t250\t15\t0\r\n",
        "k61_8358\t599\t45\t0\r\n",
        "k61_8359\t238\t9\t0\r\n",
        "k61_8360\t264\t17\t0\r\n",
        "k61_8361\t281\t15\t0\r\n",
        "k61_8362\t798\t138\t0\r\n",
        "k61_8363\t200\t17\t0\r\n",
        "k61_8364\t299\t38\t0\r\n",
        "k61_8365\t221\t23\t0\r\n",
        "k61_8366\t294\t16\t0\r\n",
        "k61_8367\t506\t41\t0\r\n",
        "k61_8368\t414\t36\t0\r\n",
        "k61_8369\t347\t25\t0\r\n",
        "k61_8370\t216\t14\t0\r\n",
        "k61_8371\t226\t11\t0\r\n",
        "k61_8372\t227\t20\t0\r\n",
        "k61_8373\t485\t30\t0\r\n",
        "k61_8374\t200\t9\t0\r\n",
        "k61_8375\t211\t16\t0\r\n",
        "k61_8376\t1198\t130\t0\r\n",
        "k61_8377\t218\t15\t0\r\n",
        "k61_8378\t235\t22\t0\r\n",
        "k61_8379\t932\t93\t0\r\n",
        "k61_8380\t864\t82\t0\r\n",
        "k61_8381\t228\t17\t0\r\n",
        "k61_8382\t576\t36\t0\r\n",
        "k61_8383\t311\t18\t0\r\n",
        "k61_8384\t426\t42\t0\r\n",
        "k61_8385\t433\t35\t0\r\n",
        "k61_8386\t478\t35\t0\r\n",
        "k61_8387\t291\t24\t0\r\n",
        "k61_8388\t737\t46\t0\r\n",
        "k61_8389\t559\t46\t0\r\n",
        "k61_8390\t298\t15\t0\r\n",
        "k61_8391\t211\t15\t0\r\n",
        "k61_8392\t208\t21\t0\r\n",
        "k61_8393\t335\t15\t0\r\n",
        "k61_8394\t927\t69\t0\r\n",
        "k61_8395\t511\t47\t0\r\n",
        "k61_8396\t227\t16\t0\r\n",
        "k61_8397\t350\t22\t0\r\n",
        "k61_8398\t396\t23\t0\r\n",
        "k61_8399\t241\t13\t0\r\n",
        "k61_8400\t244\t17\t0\r\n",
        "k61_8401\t230\t14\t0\r\n",
        "k61_8402\t618\t60\t0\r\n",
        "k61_8403\t596\t53\t0\r\n",
        "k61_8404\t775\t67\t0\r\n",
        "k61_8405\t1369\t160\t0\r\n",
        "k61_8406\t1081\t123\t0\r\n",
        "k61_8407\t410\t25\t0\r\n",
        "k61_8408\t238\t17\t0\r\n",
        "k61_8409\t626\t62\t0\r\n",
        "k61_8410\t353\t24\t0\r\n",
        "k61_8411\t236\t13\t0\r\n",
        "k61_8412\t471\t24\t0\r\n",
        "k61_8413\t505\t23\t0\r\n",
        "k61_8414\t711\t69\t0\r\n",
        "k61_8415\t258\t24\t0\r\n",
        "k61_8416\t1186\t123\t0\r\n",
        "k61_8417\t978\t73\t0\r\n",
        "k61_8418\t214\t10\t0\r\n",
        "k61_8420\t605\t61\t0\r\n",
        "k61_8421\t324\t19\t0\r\n",
        "k61_8422\t401\t34\t0\r\n",
        "k61_8423\t723\t54\t0\r\n",
        "k61_8424\t545\t48\t0\r\n",
        "k61_8425\t485\t36\t0\r\n",
        "k61_8426\t354\t27\t0\r\n",
        "k61_8427\t312\t21\t0\r\n",
        "k61_8428\t492\t51\t0\r\n",
        "k61_8429\t555\t43\t0\r\n",
        "k61_8430\t472\t41\t0\r\n",
        "k61_8431\t258\t14\t0\r\n",
        "k61_8432\t302\t21\t0\r\n",
        "k61_8433\t315\t26\t0\r\n",
        "k61_8434\t253\t23\t0\r\n",
        "k61_8435\t392\t56\t0\r\n",
        "k61_8436\t278\t14\t0\r\n",
        "k61_8437\t207\t14\t0\r\n",
        "k61_8438\t589\t64\t0\r\n",
        "k61_8439\t531\t47\t0\r\n",
        "k61_8440\t247\t8\t0\r\n",
        "k61_8441\t201\t18\t0\r\n",
        "k61_8442\t1057\t80\t0\r\n",
        "k61_8443\t296\t14\t0\r\n",
        "k61_8444\t385\t36\t0\r\n",
        "k61_8445\t405\t21\t0\r\n",
        "k61_8446\t230\t15\t0\r\n",
        "k61_8447\t1246\t98\t0\r\n",
        "k61_8448\t200\t14\t0\r\n",
        "k61_8449\t568\t47\t0\r\n",
        "k61_8450\t540\t47\t0\r\n",
        "k61_8452\t233\t17\t0\r\n",
        "k61_8454\t827\t83\t0\r\n",
        "k61_8455\t1247\t129\t0\r\n",
        "k61_8456\t468\t44\t0\r\n",
        "k61_8458\t583\t51\t0\r\n",
        "k61_8459\t200\t12\t0\r\n",
        "k61_8460\t460\t35\t0\r\n",
        "k61_8461\t357\t23\t0\r\n",
        "k61_8462\t942\t66\t0\r\n",
        "k61_8463\t343\t23\t0\r\n",
        "k61_8464\t426\t34\t0\r\n",
        "k61_8465\t410\t27\t0\r\n",
        "k61_8467\t202\t13\t0\r\n",
        "k61_8468\t930\t85\t0\r\n",
        "k61_8469\t349\t22\t0\r\n",
        "k61_8470\t381\t26\t0\r\n",
        "k61_8471\t302\t16\t0\r\n",
        "k61_8472\t552\t47\t0\r\n",
        "k61_8473\t258\t12\t0\r\n",
        "k61_8474\t337\t23\t0\r\n",
        "k61_8475\t245\t20\t0\r\n",
        "k61_8476\t219\t18\t0\r\n",
        "k61_8477\t265\t14\t0\r\n",
        "k61_8478\t462\t43\t0\r\n",
        "k61_8479\t436\t39\t0\r\n",
        "k61_8480\t223\t11\t0\r\n",
        "k61_8481\t509\t42\t0\r\n",
        "k61_8482\t538\t63\t0\r\n",
        "k61_8483\t489\t44\t0\r\n",
        "k61_8485\t231\t26\t0\r\n",
        "k61_8487\t388\t32\t0\r\n",
        "k61_8488\t248\t16\t0\r\n",
        "k61_8489\t217\t7\t0\r\n",
        "k61_8490\t707\t45\t0\r\n",
        "k61_8491\t491\t27\t0\r\n",
        "k61_8492\t204\t7\t0\r\n",
        "k61_8493\t214\t10\t0\r\n",
        "k61_8494\t446\t25\t0\r\n",
        "k61_8495\t352\t30\t0\r\n",
        "k61_8496\t228\t12\t0\r\n",
        "k61_8497\t616\t69\t0\r\n",
        "k61_8498\t283\t14\t0\r\n",
        "k61_8499\t1181\t101\t0\r\n",
        "k61_8500\t370\t33\t0\r\n",
        "k61_8503\t652\t56\t0\r\n",
        "k61_8504\t455\t28\t0\r\n",
        "k61_8506\t281\t19\t0\r\n",
        "k61_8507\t415\t41\t0\r\n",
        "k61_8508\t295\t15\t0\r\n",
        "k61_8509\t1013\t73\t0\r\n",
        "k61_8510\t200\t9\t0\r\n",
        "k61_8511\t413\t25\t0\r\n",
        "k61_8513\t448\t21\t0\r\n",
        "k61_8514\t201\t5\t0\r\n",
        "k61_8515\t574\t53\t0\r\n",
        "k61_8516\t513\t59\t0\r\n",
        "k61_8517\t996\t99\t0\r\n",
        "k61_8518\t219\t10\t0\r\n",
        "k61_8519\t522\t43\t0\r\n",
        "k61_8520\t203\t11\t0\r\n",
        "k61_8521\t249\t20\t0\r\n",
        "k61_8522\t259\t14\t0\r\n",
        "k61_8523\t287\t10\t0\r\n",
        "k61_8524\t458\t49\t0\r\n",
        "k61_8525\t245\t28\t0\r\n",
        "k61_8526\t212\t8\t0\r\n",
        "k61_8527\t616\t42\t0\r\n",
        "k61_8528\t286\t24\t0\r\n",
        "k61_8529\t308\t21\t0\r\n",
        "k61_8530\t221\t18\t0\r\n",
        "k61_8531\t268\t17\t0\r\n",
        "k61_8532\t896\t175\t0\r\n",
        "k61_8533\t475\t49\t0\r\n",
        "k61_8534\t453\t19\t0\r\n",
        "k61_8536\t297\t19\t0\r\n",
        "k61_8537\t482\t31\t0\r\n",
        "k61_8538\t271\t15\t0\r\n",
        "k61_8539\t519\t39\t0\r\n",
        "k61_8540\t266\t28\t0\r\n",
        "k61_8541\t261\t15\t0\r\n",
        "k61_8542\t387\t33\t0\r\n",
        "k61_8543\t217\t14\t0\r\n",
        "k61_8544\t252\t18\t0\r\n",
        "k61_8545\t205\t6\t0\r\n",
        "k61_8546\t279\t17\t0\r\n",
        "k61_8547\t529\t36\t0\r\n",
        "k61_8548\t543\t38\t0\r\n",
        "k61_8549\t340\t23\t0\r\n",
        "k61_8550\t593\t52\t0\r\n",
        "k61_8551\t409\t40\t0\r\n",
        "k61_8552\t554\t110\t0\r\n",
        "k61_8553\t610\t50\t0\r\n",
        "k61_8554\t217\t17\t0\r\n",
        "k61_8555\t215\t15\t0\r\n",
        "k61_8556\t414\t24\t0\r\n",
        "k61_8558\t942\t81\t0\r\n",
        "k61_8559\t636\t52\t0\r\n",
        "k61_8560\t314\t18\t0\r\n",
        "k61_8561\t443\t31\t0\r\n",
        "k61_8562\t376\t23\t0\r\n",
        "k61_8563\t668\t57\t0\r\n",
        "k61_8564\t1599\t221\t0\r\n",
        "k61_8565\t430\t28\t0\r\n",
        "k61_8566\t283\t21\t0\r\n",
        "k61_8567\t629\t54\t0\r\n",
        "k61_8568\t385\t26\t0\r\n",
        "k61_8569\t365\t29\t0\r\n",
        "k61_8570\t763\t75\t0\r\n",
        "k61_8573\t469\t36\t0\r\n",
        "k61_8574\t486\t33\t0\r\n",
        "k61_8575\t247\t8\t0\r\n",
        "k61_8576\t285\t23\t0\r\n",
        "k61_8577\t459\t39\t0\r\n",
        "k61_8578\t219\t5\t0\r\n",
        "k61_8579\t278\t28\t0\r\n",
        "k61_8580\t402\t20\t0\r\n",
        "k61_8581\t284\t14\t0\r\n",
        "k61_8582\t296\t23\t0\r\n",
        "k61_8583\t211\t16\t0\r\n",
        "k61_8584\t307\t10\t0\r\n",
        "k61_8585\t527\t29\t0\r\n",
        "k61_8586\t298\t16\t0\r\n",
        "k61_8587\t835\t76\t0\r\n",
        "k61_8588\t513\t41\t0\r\n",
        "k61_8589\t259\t26\t0\r\n",
        "k61_8590\t681\t67\t0\r\n",
        "k61_8591\t262\t14\t0\r\n",
        "k61_8594\t259\t14\t0\r\n",
        "k61_8595\t410\t24\t0\r\n",
        "k61_8597\t779\t64\t0\r\n",
        "k61_8598\t209\t11\t0\r\n",
        "k61_8599\t215\t9\t0\r\n",
        "k61_8601\t271\t12\t0\r\n",
        "k61_8602\t367\t39\t0\r\n",
        "k61_8603\t336\t23\t0\r\n",
        "k61_8604\t758\t67\t0\r\n",
        "k61_8605\t212\t15\t0\r\n",
        "k61_8606\t202\t8\t0\r\n",
        "k61_8607\t215\t18\t0\r\n",
        "k61_8608\t274\t25\t0\r\n",
        "k61_8610\t231\t22\t0\r\n",
        "k61_8611\t202\t10\t0\r\n",
        "k61_8612\t794\t90\t0\r\n",
        "k61_8613\t361\t29\t0\r\n",
        "k61_8614\t836\t85\t0\r\n",
        "k61_8615\t296\t56\t0\r\n",
        "k61_8616\t384\t21\t0\r\n",
        "k61_8617\t233\t10\t0\r\n",
        "k61_8618\t281\t33\t0\r\n",
        "k61_8619\t346\t21\t0\r\n",
        "k61_8620\t273\t17\t0\r\n",
        "k61_8621\t723\t82\t0\r\n",
        "k61_8622\t247\t9\t0\r\n",
        "k61_8623\t204\t23\t0\r\n",
        "k61_8624\t477\t52\t0\r\n",
        "k61_8625\t246\t15\t0\r\n",
        "k61_8626\t210\t18\t0\r\n",
        "k61_8627\t212\t9\t0\r\n",
        "k61_8628\t349\t23\t0\r\n",
        "k61_8629\t395\t20\t0\r\n",
        "k61_8630\t979\t68\t0\r\n",
        "k61_8631\t228\t16\t0\r\n",
        "k61_8632\t219\t13\t0\r\n",
        "k61_8633\t1140\t88\t0\r\n",
        "k61_8634\t392\t34\t0\r\n",
        "k61_8635\t947\t95\t0\r\n",
        "k61_8636\t229\t11\t0\r\n",
        "k61_8637\t273\t28\t0\r\n",
        "k61_8638\t240\t25\t0\r\n",
        "k61_8639\t263\t18\t0\r\n",
        "k61_8640\t283\t15\t0\r\n",
        "k61_8641\t213\t12\t0\r\n",
        "k61_8642\t252\t12\t0\r\n",
        "k61_8643\t334\t39\t0\r\n",
        "k61_8644\t472\t31\t0\r\n",
        "k61_8645\t1628\t170\t0\r\n",
        "k61_8646\t431\t19\t0\r\n",
        "k61_8647\t344\t27\t0\r\n",
        "k61_8648\t332\t21\t0\r\n",
        "k61_8649\t207\t10\t0\r\n",
        "k61_8650\t257\t7\t0\r\n",
        "k61_8651\t217\t9\t0\r\n",
        "k61_8652\t1437\t109\t0\r\n",
        "k61_8654\t277\t16\t0\r\n",
        "k61_8655\t577\t52\t0\r\n",
        "k61_8657\t384\t22\t0\r\n",
        "k61_8658\t517\t41\t0\r\n",
        "k61_8659\t284\t25\t0\r\n",
        "k61_8660\t362\t34\t0\r\n",
        "k61_8661\t296\t20\t0\r\n",
        "k61_8662\t339\t28\t0\r\n",
        "k61_8663\t263\t20\t0\r\n",
        "k61_8664\t292\t20\t0\r\n",
        "k61_8665\t256\t14\t0\r\n",
        "k61_8666\t231\t15\t0\r\n",
        "k61_8667\t1360\t148\t0\r\n",
        "k61_8668\t211\t12\t0\r\n",
        "k61_8669\t496\t40\t0\r\n",
        "k61_8670\t380\t23\t0\r\n",
        "k61_8671\t697\t76\t0\r\n",
        "k61_8672\t467\t41\t0\r\n",
        "k61_8673\t897\t103\t0\r\n",
        "k61_8674\t312\t27\t0\r\n",
        "k61_8675\t282\t31\t0\r\n",
        "k61_8678\t706\t66\t0\r\n",
        "k61_8679\t375\t29\t0\r\n",
        "k61_8680\t2491\t183\t0\r\n",
        "k61_8681\t205\t13\t0\r\n",
        "k61_8682\t395\t49\t0\r\n",
        "k61_8683\t304\t25\t0\r\n",
        "k61_8684\t260\t11\t0\r\n",
        "k61_8685\t226\t7\t0\r\n",
        "k61_8686\t1020\t77\t0\r\n",
        "k61_8687\t334\t28\t0\r\n",
        "k61_8688\t231\t9\t0\r\n",
        "k61_8689\t642\t42\t0\r\n",
        "k61_8690\t329\t26\t0\r\n",
        "k61_8691\t389\t36\t0\r\n",
        "k61_8692\t372\t37\t0\r\n",
        "k61_8693\t570\t37\t0\r\n",
        "k61_8694\t225\t8\t0\r\n",
        "k61_8696\t757\t75\t0\r\n",
        "k61_8697\t266\t16\t0\r\n",
        "k61_8698\t443\t35\t0\r\n",
        "k61_8700\t624\t38\t0\r\n",
        "k61_8701\t879\t75\t0\r\n",
        "k61_8702\t418\t32\t0\r\n",
        "k61_8703\t300\t27\t0\r\n",
        "k61_8704\t379\t24\t0\r\n",
        "k61_8705\t406\t19\t0\r\n",
        "k61_8706\t695\t45\t0\r\n",
        "k61_8708\t358\t25\t0\r\n",
        "k61_8709\t1196\t89\t0\r\n",
        "k61_8710\t329\t21\t0\r\n",
        "k61_8712\t816\t70\t0\r\n",
        "k61_8713\t222\t9\t0\r\n",
        "k61_8714\t273\t14\t0\r\n",
        "k61_8716\t231\t11\t0\r\n",
        "k61_8717\t432\t25\t0\r\n",
        "k61_8718\t492\t39\t0\r\n",
        "k61_8719\t283\t11\t0\r\n",
        "k61_8720\t988\t97\t0\r\n",
        "k61_8721\t491\t33\t0\r\n",
        "k61_8722\t258\t12\t0\r\n",
        "k61_8723\t343\t12\t0\r\n",
        "k61_8724\t268\t19\t0\r\n",
        "k61_8725\t343\t15\t0\r\n",
        "k61_8726\t249\t7\t0\r\n",
        "k61_8727\t288\t24\t0\r\n",
        "k61_8728\t266\t26\t0\r\n",
        "k61_8731\t732\t50\t0\r\n",
        "k61_8732\t231\t8\t0\r\n",
        "k61_8733\t371\t28\t0\r\n",
        "k61_8735\t551\t55\t0\r\n",
        "k61_8736\t777\t66\t0\r\n",
        "k61_8737\t201\t10\t0\r\n",
        "k61_8739\t842\t80\t0\r\n",
        "k61_8740\t316\t21\t0\r\n",
        "k61_8741\t313\t9\t0\r\n",
        "k61_8742\t240\t11\t0\r\n",
        "k61_8743\t330\t27\t0\r\n",
        "k61_8744\t384\t38\t0\r\n",
        "k61_8747\t401\t40\t0\r\n",
        "k61_8749\t404\t31\t0\r\n",
        "k61_8750\t200\t9\t0\r\n",
        "k61_8751\t242\t19\t0\r\n",
        "k61_8752\t238\t16\t0\r\n",
        "k61_8753\t462\t26\t0\r\n",
        "k61_8754\t303\t15\t0\r\n",
        "k61_8755\t343\t24\t0\r\n",
        "k61_8756\t244\t12\t0\r\n",
        "k61_8757\t494\t38\t0\r\n",
        "k61_8758\t323\t17\t0\r\n",
        "k61_8760\t847\t69\t0\r\n",
        "k61_8761\t247\t21\t0\r\n",
        "k61_8762\t240\t11\t0\r\n",
        "k61_8763\t235\t16\t0\r\n",
        "k61_8764\t218\t16\t0\r\n",
        "k61_8765\t367\t26\t0\r\n",
        "k61_8766\t276\t17\t0\r\n",
        "k61_8767\t297\t20\t0\r\n",
        "k61_8768\t228\t10\t0\r\n",
        "k61_8770\t311\t28\t0\r\n",
        "k61_8771\t1070\t83\t0\r\n",
        "k61_8772\t306\t20\t0\r\n",
        "k61_8773\t470\t58\t0\r\n",
        "k61_8774\t305\t20\t0\r\n",
        "k61_8775\t258\t13\t0\r\n",
        "k61_8776\t353\t23\t0\r\n",
        "k61_8778\t239\t35\t0\r\n",
        "k61_8780\t209\t10\t0\r\n",
        "k61_8781\t214\t18\t0\r\n",
        "k61_8782\t236\t17\t0\r\n",
        "k61_8783\t315\t13\t0\r\n",
        "k61_8784\t423\t41\t0\r\n",
        "k61_8785\t249\t7\t0\r\n",
        "k61_8786\t1065\t78\t0\r\n",
        "k61_8788\t433\t24\t0\r\n",
        "k61_8789\t284\t14\t0\r\n",
        "k61_8790\t500\t33\t0\r\n",
        "k61_8791\t220\t26\t0\r\n",
        "k61_8792\t320\t30\t0\r\n",
        "k61_8793\t474\t28\t0\r\n",
        "k61_8794\t1126\t129\t0\r\n",
        "k61_8795\t205\t5\t0\r\n",
        "k61_8796\t350\t27\t0\r\n",
        "k61_8797\t229\t13\t0\r\n",
        "k61_8798\t358\t19\t0\r\n",
        "k61_8799\t1064\t76\t0\r\n",
        "k61_8800\t325\t25\t0\r\n",
        "k61_8801\t479\t35\t0\r\n",
        "k61_8802\t676\t55\t0\r\n",
        "k61_8803\t224\t11\t0\r\n",
        "k61_8804\t761\t58\t0\r\n",
        "k61_8805\t466\t42\t0\r\n",
        "k61_8806\t269\t15\t0\r\n",
        "k61_8807\t1181\t113\t0\r\n",
        "k61_8808\t333\t17\t0\r\n",
        "k61_8809\t223\t11\t0\r\n",
        "k61_8810\t379\t23\t0\r\n",
        "k61_8812\t822\t85\t0\r\n",
        "k61_8813\t1472\t368\t0\r\n",
        "k61_8814\t885\t93\t0\r\n",
        "k61_8815\t267\t21\t0\r\n",
        "k61_8816\t315\t24\t0\r\n",
        "k61_8817\t306\t28\t0\r\n",
        "k61_8818\t616\t46\t0\r\n",
        "k61_8819\t405\t59\t0\r\n",
        "k61_8820\t514\t29\t0\r\n",
        "k61_8821\t294\t13\t0\r\n",
        "k61_8822\t270\t14\t0\r\n",
        "k61_8823\t249\t20\t0\r\n",
        "k61_8825\t238\t14\t0\r\n",
        "k61_8826\t835\t81\t0\r\n",
        "k61_8827\t295\t22\t0\r\n",
        "k61_8828\t580\t40\t0\r\n",
        "k61_8829\t308\t12\t0\r\n",
        "k61_8830\t212\t17\t0\r\n",
        "k61_8831\t226\t6\t0\r\n",
        "k61_8832\t292\t22\t0\r\n",
        "k61_8833\t311\t21\t0\r\n",
        "k61_8834\t274\t15\t0\r\n",
        "k61_8835\t347\t30\t0\r\n",
        "k61_8836\t311\t13\t0\r\n",
        "k61_8838\t202\t11\t0\r\n",
        "k61_8839\t390\t25\t0\r\n",
        "k61_8840\t367\t17\t0\r\n",
        "k61_8841\t315\t16\t0\r\n",
        "k61_8842\t421\t22\t0\r\n",
        "k61_8843\t329\t24\t0\r\n",
        "k61_8844\t511\t43\t0\r\n",
        "k61_8845\t301\t20\t0\r\n",
        "k61_8846\t397\t19\t0\r\n",
        "k61_8849\t419\t24\t0\r\n",
        "k61_8850\t775\t55\t0\r\n",
        "k61_8851\t551\t39\t0\r\n",
        "k61_8852\t889\t69\t0\r\n",
        "k61_8853\t249\t8\t0\r\n",
        "k61_8854\t227\t20\t0\r\n",
        "k61_8855\t216\t14\t0\r\n",
        "k61_8856\t970\t90\t0\r\n",
        "k61_8857\t301\t15\t0\r\n",
        "k61_8859\t280\t12\t0\r\n",
        "k61_8860\t250\t15\t0\r\n",
        "k61_8861\t1451\t140\t0\r\n",
        "k61_8862\t222\t18\t0\r\n",
        "k61_8863\t271\t14\t0\r\n",
        "k61_8864\t244\t8\t0\r\n",
        "k61_8865\t204\t10\t0\r\n",
        "k61_8866\t501\t51\t0\r\n",
        "k61_8867\t475\t35\t0\r\n",
        "k61_8868\t292\t25\t0\r\n",
        "k61_8869\t492\t40\t0\r\n",
        "k61_8871\t268\t20\t0\r\n",
        "k61_8872\t255\t35\t0\r\n",
        "k61_8873\t856\t65\t0\r\n",
        "k61_8874\t295\t13\t0\r\n",
        "k61_8875\t479\t51\t0\r\n",
        "k61_8876\t235\t11\t0\r\n",
        "k61_8877\t565\t37\t0\r\n",
        "k61_8878\t229\t18\t0\r\n",
        "k61_8879\t347\t18\t0\r\n",
        "k61_8880\t216\t6\t0\r\n",
        "k61_8881\t242\t14\t0\r\n",
        "k61_8882\t935\t71\t0\r\n",
        "k61_8883\t768\t74\t0\r\n",
        "k61_8884\t331\t26\t0\r\n",
        "k61_8886\t330\t18\t0\r\n",
        "k61_8887\t1030\t79\t0\r\n",
        "k61_8888\t380\t26\t0\r\n",
        "k61_8889\t988\t76\t0\r\n",
        "k61_8890\t488\t39\t0\r\n",
        "k61_8891\t2138\t254\t0\r\n",
        "k61_8892\t322\t21\t0\r\n",
        "k61_8893\t979\t88\t0\r\n",
        "k61_8894\t336\t23\t0\r\n",
        "k61_8895\t326\t24\t0\r\n",
        "k61_8896\t597\t54\t0\r\n",
        "k61_8897\t490\t34\t0\r\n",
        "k61_8898\t388\t31\t0\r\n",
        "k61_8899\t250\t18\t0\r\n",
        "k61_8900\t411\t31\t0\r\n",
        "k61_8901\t561\t55\t0\r\n",
        "k61_8902\t245\t10\t0\r\n",
        "k61_8903\t206\t5\t0\r\n",
        "k61_8904\t785\t73\t0\r\n",
        "k61_8905\t605\t78\t0\r\n",
        "k61_8906\t496\t40\t0\r\n",
        "k61_8907\t303\t13\t0\r\n",
        "k61_8908\t408\t23\t0\r\n",
        "k61_8909\t796\t95\t0\r\n",
        "k61_8911\t359\t31\t0\r\n",
        "k61_8912\t583\t294\t0\r\n",
        "k61_8913\t349\t26\t0\r\n",
        "k61_8914\t362\t22\t0\r\n",
        "k61_8915\t389\t42\t0\r\n",
        "k61_8916\t1472\t155\t0\r\n",
        "k61_8917\t575\t41\t0\r\n",
        "k61_8918\t209\t13\t0\r\n",
        "k61_8919\t1245\t115\t0\r\n",
        "k61_8920\t435\t23\t0\r\n",
        "k61_8921\t202\t8\t0\r\n",
        "k61_8922\t359\t10\t0\r\n",
        "k61_8923\t345\t19\t0\r\n",
        "k61_8924\t737\t65\t0\r\n",
        "k61_8925\t642\t61\t0\r\n",
        "k61_8926\t399\t40\t0\r\n",
        "k61_8927\t235\t14\t0\r\n",
        "k61_8928\t1095\t179\t0\r\n",
        "k61_8929\t863\t58\t0\r\n",
        "k61_8930\t542\t39\t0\r\n",
        "k61_8933\t223\t11\t0\r\n",
        "k61_8934\t324\t25\t0\r\n",
        "k61_8935\t625\t41\t0\r\n",
        "k61_8936\t353\t20\t0\r\n",
        "k61_8937\t245\t22\t0\r\n",
        "k61_8938\t555\t49\t0\r\n",
        "k61_8939\t767\t61\t0\r\n",
        "k61_8940\t645\t52\t0\r\n",
        "k61_8941\t257\t13\t0\r\n",
        "k61_8942\t797\t71\t0\r\n",
        "k61_8943\t962\t83\t0\r\n",
        "k61_8944\t475\t33\t0\r\n",
        "k61_8946\t359\t21\t0\r\n",
        "k61_8947\t515\t44\t0\r\n",
        "k61_8948\t260\t19\t0\r\n",
        "k61_8950\t220\t15\t0\r\n",
        "k61_8951\t300\t11\t0\r\n",
        "k61_8953\t348\t16\t0\r\n",
        "k61_8954\t373\t32\t0\r\n",
        "k61_8955\t281\t9\t0\r\n",
        "k61_8956\t223\t10\t0\r\n",
        "k61_8958\t268\t19\t0\r\n",
        "k61_8959\t1253\t120\t0\r\n",
        "k61_8960\t239\t9\t0\r\n",
        "k61_8961\t270\t13\t0\r\n",
        "k61_8962\t737\t80\t0\r\n",
        "k61_8963\t235\t10\t0\r\n",
        "k61_8964\t263\t13\t0\r\n",
        "k61_8965\t427\t39\t0\r\n",
        "k61_8966\t351\t38\t0\r\n",
        "k61_8967\t289\t19\t0\r\n",
        "k61_8968\t589\t55\t0\r\n",
        "k61_8969\t681\t101\t0\r\n",
        "k61_8970\t352\t33\t0\r\n",
        "k61_8971\t470\t20\t0\r\n",
        "k61_8972\t446\t27\t0\r\n",
        "k61_8974\t299\t14\t0\r\n",
        "k61_8975\t555\t49\t0\r\n",
        "k61_8976\t705\t45\t0\r\n",
        "k61_8977\t381\t27\t0\r\n",
        "k61_8978\t1099\t127\t0\r\n",
        "k61_8979\t706\t66\t0\r\n",
        "k61_8980\t289\t21\t0\r\n",
        "k61_8981\t561\t66\t0\r\n",
        "k61_8982\t292\t23\t0\r\n",
        "k61_8983\t563\t45\t0\r\n",
        "k61_8984\t674\t59\t0\r\n",
        "k61_8986\t497\t39\t0\r\n",
        "k61_8987\t260\t19\t0\r\n",
        "k61_8988\t258\t16\t0\r\n",
        "k61_8990\t205\t10\t0\r\n",
        "k61_8991\t1829\t197\t0\r\n",
        "k61_8992\t221\t8\t0\r\n",
        "k61_8993\t273\t20\t0\r\n",
        "k61_8994\t357\t29\t0\r\n",
        "k61_8995\t909\t87\t0\r\n",
        "k61_8996\t317\t22\t0\r\n",
        "k61_8997\t210\t10\t0\r\n",
        "k61_8998\t368\t32\t0\r\n",
        "k61_8999\t316\t28\t0\r\n",
        "k61_9000\t869\t69\t0\r\n",
        "k61_9002\t923\t77\t0\r\n",
        "k61_9003\t906\t73\t0\r\n",
        "k61_9004\t211\t10\t0\r\n",
        "k61_9006\t263\t15\t0\r\n",
        "k61_9008\t1201\t117\t0\r\n",
        "k61_9009\t494\t41\t0\r\n",
        "k61_9010\t258\t11\t0\r\n",
        "k61_9011\t237\t14\t0\r\n",
        "k61_9012\t369\t29\t0\r\n",
        "k61_9013\t594\t45\t0\r\n",
        "k61_9014\t533\t56\t0\r\n",
        "k61_9015\t368\t27\t0\r\n",
        "k61_9016\t863\t81\t0\r\n",
        "k61_9017\t225\t11\t0\r\n",
        "k61_9018\t398\t23\t0\r\n",
        "k61_9019\t651\t45\t0\r\n",
        "k61_9020\t232\t8\t0\r\n",
        "k61_9021\t234\t45\t0\r\n",
        "k61_9024\t228\t14\t0\r\n",
        "k61_9025\t202\t10\t0\r\n",
        "k61_9026\t505\t50\t0\r\n",
        "k61_9027\t461\t34\t0\r\n",
        "k61_9028\t1026\t97\t0\r\n",
        "k61_9030\t446\t24\t0\r\n",
        "k61_9031\t584\t64\t0\r\n",
        "k61_9032\t392\t29\t0\r\n",
        "k61_9034\t584\t46\t0\r\n",
        "k61_9035\t309\t17\t0\r\n",
        "k61_9036\t210\t8\t0\r\n",
        "k61_9037\t717\t57\t0\r\n",
        "k61_9038\t351\t26\t0\r\n",
        "k61_9039\t448\t34\t0\r\n",
        "k61_9040\t400\t31\t0\r\n",
        "k61_9041\t244\t17\t0\r\n",
        "k61_9043\t201\t12\t0\r\n",
        "k61_9044\t378\t14\t0\r\n",
        "k61_9045\t620\t53\t0\r\n",
        "k61_9047\t991\t78\t0\r\n",
        "k61_9048\t213\t67\t0\r\n",
        "k61_9049\t888\t116\t0\r\n",
        "k61_9050\t215\t11\t0\r\n",
        "k61_9051\t226\t19\t0\r\n",
        "k61_9053\t795\t76\t0\r\n",
        "k61_9054\t640\t58\t0\r\n",
        "k61_9055\t272\t9\t0\r\n",
        "k61_9056\t241\t13\t0\r\n",
        "k61_9057\t301\t19\t0\r\n",
        "k61_9058\t241\t16\t0\r\n",
        "k61_9059\t640\t50\t0\r\n",
        "k61_9060\t213\t15\t0\r\n",
        "k61_9061\t450\t26\t0\r\n",
        "k61_9062\t268\t16\t0\r\n",
        "k61_9063\t503\t46\t0\r\n",
        "k61_9064\t539\t55\t0\r\n",
        "k61_9065\t236\t10\t0\r\n",
        "k61_9066\t222\t18\t0\r\n",
        "k61_9067\t220\t10\t0\r\n",
        "k61_9068\t249\t10\t0\r\n",
        "k61_9069\t326\t12\t0\r\n",
        "k61_9070\t497\t27\t0\r\n",
        "k61_9071\t283\t17\t0\r\n",
        "k61_9072\t658\t67\t0\r\n",
        "k61_9073\t1153\t110\t0\r\n",
        "k61_9074\t279\t9\t0\r\n",
        "k61_9075\t317\t16\t0\r\n",
        "k61_9076\t253\t19\t0\r\n",
        "k61_9077\t391\t24\t0\r\n",
        "k61_9078\t611\t52\t0\r\n",
        "k61_9079\t883\t79\t0\r\n",
        "k61_9080\t575\t55\t0\r\n",
        "k61_9081\t279\t16\t0\r\n",
        "k61_9082\t203\t9\t0\r\n",
        "k61_9083\t340\t13\t0\r\n",
        "k61_9084\t315\t33\t0\r\n",
        "k61_9085\t270\t10\t0\r\n",
        "k61_9086\t284\t11\t0\r\n",
        "k61_9087\t672\t44\t0\r\n",
        "k61_9088\t224\t11\t0\r\n",
        "k61_9089\t230\t10\t0\r\n",
        "k61_9090\t305\t17\t0\r\n",
        "k61_9091\t790\t60\t0\r\n",
        "k61_9092\t271\t17\t0\r\n",
        "k61_9093\t375\t22\t0\r\n",
        "k61_9094\t214\t8\t0\r\n",
        "k61_9095\t257\t14\t0\r\n",
        "k61_9097\t242\t23\t0\r\n",
        "k61_9098\t246\t16\t0\r\n",
        "k61_9100\t419\t46\t0\r\n",
        "k61_9101\t301\t15\t0\r\n",
        "k61_9102\t243\t9\t0\r\n",
        "k61_9103\t220\t9\t0\r\n",
        "k61_9104\t389\t53\t0\r\n",
        "k61_9105\t377\t24\t0\r\n",
        "k61_9106\t756\t71\t0\r\n",
        "k61_9107\t238\t13\t0\r\n",
        "k61_9108\t462\t29\t0\r\n",
        "k61_9109\t299\t13\t0\r\n",
        "k61_9111\t245\t21\t0\r\n",
        "k61_9112\t327\t17\t0\r\n",
        "k61_9113\t228\t26\t0\r\n",
        "k61_9114\t258\t34\t0\r\n",
        "k61_9115\t324\t18\t0\r\n",
        "k61_9116\t420\t47\t0\r\n",
        "k61_9117\t474\t36\t0\r\n",
        "k61_9118\t965\t118\t0\r\n",
        "k61_9119\t216\t6\t0\r\n",
        "k61_9120\t469\t42\t0\r\n",
        "k61_9121\t589\t55\t0\r\n",
        "k61_9122\t384\t28\t0\r\n",
        "k61_9123\t612\t57\t0\r\n",
        "k61_9124\t213\t9\t0\r\n",
        "k61_9125\t227\t11\t0\r\n",
        "k61_9126\t300\t30\t0\r\n",
        "k61_9127\t250\t21\t0\r\n",
        "k61_9128\t822\t61\t0\r\n",
        "k61_9129\t255\t13\t0\r\n",
        "k61_9130\t1390\t122\t0\r\n",
        "k61_9131\t242\t12\t0\r\n",
        "k61_9132\t622\t63\t0\r\n",
        "k61_9133\t261\t23\t0\r\n",
        "k61_9135\t203\t7\t0\r\n",
        "k61_9136\t241\t15\t0\r\n",
        "k61_9137\t239\t12\t0\r\n",
        "k61_9138\t412\t30\t0\r\n",
        "k61_9139\t290\t11\t0\r\n",
        "k61_9140\t201\t14\t0\r\n",
        "k61_9141\t301\t23\t0\r\n",
        "k61_9142\t203\t16\t0\r\n",
        "k61_9143\t485\t19\t0\r\n",
        "k61_9144\t207\t12\t0\r\n",
        "k61_9145\t912\t78\t0\r\n",
        "k61_9146\t648\t43\t0\r\n",
        "k61_9147\t366\t26\t0\r\n",
        "k61_9148\t1007\t87\t0\r\n",
        "k61_9149\t241\t9\t0\r\n",
        "k61_9150\t213\t15\t0\r\n",
        "k61_9151\t214\t9\t0\r\n",
        "k61_9152\t302\t14\t0\r\n",
        "k61_9153\t232\t17\t0\r\n",
        "k61_9154\t254\t13\t0\r\n",
        "k61_9155\t399\t29\t0\r\n",
        "k61_9156\t230\t14\t0\r\n",
        "k61_9157\t229\t128\t0\r\n",
        "k61_9158\t450\t42\t0\r\n",
        "k61_9159\t349\t16\t0\r\n",
        "k61_9160\t937\t66\t0\r\n",
        "k61_9163\t372\t18\t0\r\n",
        "k61_9164\t243\t8\t0\r\n",
        "k61_9165\t281\t11\t0\r\n",
        "k61_9166\t424\t35\t0\r\n",
        "k61_9167\t2319\t499\t0\r\n",
        "k61_9168\t255\t9\t0\r\n",
        "k61_9169\t662\t52\t0\r\n",
        "k61_9170\t256\t17\t0\r\n",
        "k61_9171\t472\t37\t0\r\n",
        "k61_9172\t230\t16\t0\r\n",
        "k61_9173\t451\t42\t0\r\n",
        "k61_9175\t224\t12\t0\r\n",
        "k61_9176\t244\t17\t0\r\n",
        "k61_9177\t319\t12\t0\r\n",
        "k61_9178\t372\t22\t0\r\n",
        "k61_9179\t267\t15\t0\r\n",
        "k61_9180\t515\t42\t0\r\n",
        "k61_9181\t288\t19\t0\r\n",
        "k61_9182\t424\t44\t0\r\n",
        "k61_9183\t264\t17\t0\r\n",
        "k61_9184\t441\t40\t0\r\n",
        "k61_9185\t1120\t92\t0\r\n",
        "k61_9186\t282\t21\t0\r\n",
        "k61_9187\t211\t15\t0\r\n",
        "k61_9188\t276\t27\t0\r\n",
        "k61_9189\t602\t53\t0\r\n",
        "k61_9190\t328\t26\t0\r\n",
        "k61_9191\t228\t10\t0\r\n",
        "k61_9192\t327\t22\t0\r\n",
        "k61_9193\t242\t19\t0\r\n",
        "k61_9194\t552\t32\t0\r\n",
        "k61_9196\t754\t89\t0\r\n",
        "k61_9197\t247\t9\t0\r\n",
        "k61_9198\t435\t43\t0\r\n",
        "k61_9199\t360\t10\t0\r\n",
        "k61_9200\t351\t26\t0\r\n",
        "k61_9201\t539\t34\t0\r\n",
        "k61_9202\t782\t62\t0\r\n",
        "k61_9203\t611\t48\t0\r\n",
        "k61_9204\t864\t82\t0\r\n",
        "k61_9205\t1039\t110\t0\r\n",
        "k61_9207\t328\t13\t0\r\n",
        "k61_9208\t610\t50\t0\r\n",
        "k61_9209\t399\t29\t0\r\n",
        "k61_9210\t244\t21\t0\r\n",
        "k61_9211\t367\t31\t0\r\n",
        "k61_9212\t235\t8\t0\r\n",
        "k61_9213\t402\t25\t0\r\n",
        "k61_9214\t200\t9\t0\r\n",
        "k61_9215\t257\t25\t0\r\n",
        "k61_9216\t471\t27\t0\r\n",
        "k61_9217\t552\t72\t0\r\n",
        "k61_9218\t293\t13\t0\r\n",
        "k61_9220\t907\t78\t0\r\n",
        "k61_9221\t248\t17\t0\r\n",
        "k61_9222\t297\t24\t0\r\n",
        "k61_9223\t560\t58\t0\r\n",
        "k61_9224\t234\t10\t0\r\n",
        "k61_9226\t811\t65\t0\r\n",
        "k61_9227\t860\t85\t0\r\n",
        "k61_9228\t235\t13\t0\r\n",
        "k61_9229\t295\t25\t0\r\n",
        "k61_9230\t734\t56\t0\r\n",
        "k61_9231\t304\t28\t0\r\n",
        "k61_9232\t1011\t89\t0\r\n",
        "k61_9233\t431\t45\t0\r\n",
        "k61_9234\t2045\t230\t0\r\n",
        "k61_9236\t1071\t119\t0\r\n",
        "k61_9237\t858\t79\t0\r\n",
        "k61_9238\t251\t24\t0\r\n",
        "k61_9240\t238\t18\t0\r\n",
        "k61_9241\t343\t25\t0\r\n",
        "k61_9242\t374\t35\t0\r\n",
        "k61_9243\t251\t10\t0\r\n",
        "k61_9244\t277\t21\t0\r\n",
        "k61_9245\t378\t23\t0\r\n",
        "k61_9246\t231\t13\t0\r\n",
        "k61_9247\t518\t37\t0\r\n",
        "k61_9248\t274\t21\t0\r\n",
        "k61_9249\t376\t29\t0\r\n",
        "k61_9250\t203\t14\t0\r\n",
        "k61_9251\t320\t17\t0\r\n",
        "k61_9252\t832\t81\t0\r\n",
        "k61_9253\t229\t8\t0\r\n",
        "k61_9254\t539\t43\t0\r\n",
        "k61_9255\t376\t19\t0\r\n",
        "k61_9256\t244\t17\t0\r\n",
        "k61_9257\t757\t63\t0\r\n",
        "k61_9258\t351\t22\t0\r\n",
        "k61_9259\t380\t25\t0\r\n",
        "k61_9260\t213\t8\t0\r\n",
        "k61_9261\t309\t21\t0\r\n",
        "k61_9262\t368\t27\t0\r\n",
        "k61_9263\t202\t14\t0\r\n",
        "k61_9264\t912\t86\t0\r\n",
        "k61_9266\t1053\t120\t0\r\n",
        "k61_9267\t984\t78\t0\r\n",
        "k61_9268\t225\t12\t0\r\n",
        "k61_9269\t211\t6\t0\r\n",
        "k61_9270\t450\t32\t0\r\n",
        "k61_9271\t460\t36\t0\r\n",
        "k61_9272\t282\t18\t0\r\n",
        "k61_9273\t261\t23\t0\r\n",
        "k61_9274\t854\t100\t0\r\n",
        "k61_9275\t467\t46\t0\r\n",
        "k61_9276\t330\t19\t0\r\n",
        "k61_9277\t207\t9\t0\r\n",
        "k61_9279\t336\t25\t0\r\n",
        "k61_9280\t277\t9\t0\r\n",
        "k61_9281\t438\t25\t0\r\n",
        "k61_9282\t305\t19\t0\r\n",
        "k61_9283\t832\t73\t0\r\n",
        "k61_9284\t201\t15\t0\r\n",
        "k61_9286\t319\t25\t0\r\n",
        "k61_9287\t774\t51\t0\r\n",
        "k61_9289\t549\t55\t0\r\n",
        "k61_9290\t471\t41\t0\r\n",
        "k61_9291\t270\t23\t0\r\n",
        "k61_9292\t316\t21\t0\r\n",
        "k61_9293\t399\t27\t0\r\n",
        "k61_9294\t374\t26\t0\r\n",
        "k61_9295\t253\t13\t0\r\n",
        "k61_9296\t263\t26\t0\r\n",
        "k61_9297\t423\t22\t0\r\n",
        "k61_9298\t547\t60\t0\r\n",
        "k61_9299\t763\t91\t0\r\n",
        "k61_9300\t237\t10\t0\r\n",
        "k61_9301\t234\t17\t0\r\n",
        "k61_9302\t259\t12\t0\r\n",
        "k61_9303\t279\t45\t0\r\n",
        "k61_9304\t638\t73\t0\r\n",
        "k61_9305\t200\t9\t0\r\n",
        "k61_9306\t312\t24\t0\r\n",
        "k61_9307\t468\t30\t0\r\n",
        "k61_9308\t848\t70\t0\r\n",
        "k61_9309\t397\t26\t0\r\n",
        "k61_9310\t581\t50\t0\r\n",
        "k61_9313\t225\t8\t0\r\n",
        "k61_9314\t502\t49\t0\r\n",
        "k61_9315\t263\t10\t0\r\n",
        "k61_9316\t258\t9\t0\r\n",
        "k61_9317\t774\t60\t0\r\n",
        "k61_9318\t253\t13\t0\r\n",
        "k61_9319\t391\t26\t0\r\n",
        "k61_9320\t1922\t167\t0\r\n",
        "k61_9321\t570\t53\t0\r\n",
        "k61_9323\t380\t23\t0\r\n",
        "k61_9324\t939\t86\t0\r\n",
        "k61_9325\t234\t29\t0\r\n",
        "k61_9326\t243\t11\t0\r\n",
        "k61_9327\t720\t60\t0\r\n",
        "k61_9328\t391\t27\t0\r\n",
        "k61_9329\t813\t72\t0\r\n",
        "k61_9330\t344\t26\t0\r\n",
        "k61_9331\t481\t36\t0\r\n",
        "k61_9332\t336\t21\t0\r\n",
        "k61_9333\t367\t33\t0\r\n",
        "k61_9334\t1117\t321\t0\r\n",
        "k61_9335\t338\t13\t0\r\n",
        "k61_9336\t638\t57\t0\r\n",
        "k61_9337\t256\t16\t0\r\n",
        "k61_9338\t392\t26\t0\r\n",
        "k61_9339\t668\t63\t0\r\n",
        "k61_9340\t259\t17\t0\r\n",
        "k61_9341\t265\t26\t0\r\n",
        "k61_9344\t587\t46\t0\r\n",
        "k61_9345\t247\t16\t0\r\n",
        "k61_9346\t795\t66\t0\r\n",
        "k61_9347\t250\t11\t0\r\n",
        "k61_9348\t215\t10\t0\r\n",
        "k61_9349\t1080\t116\t0\r\n",
        "k61_9350\t211\t20\t0\r\n",
        "k61_9351\t227\t16\t0\r\n",
        "k61_9352\t1576\t157\t0\r\n",
        "k61_9353\t240\t17\t0\r\n",
        "k61_9354\t200\t12\t0\r\n",
        "k61_9355\t434\t43\t0\r\n",
        "k61_9356\t1015\t74\t0\r\n",
        "k61_9357\t231\t12\t0\r\n",
        "k61_9358\t558\t61\t0\r\n",
        "k61_9359\t483\t33\t0\r\n",
        "k61_9360\t1116\t167\t0\r\n",
        "k61_9361\t515\t44\t0\r\n",
        "k61_9362\t571\t49\t0\r\n",
        "k61_9363\t957\t82\t0\r\n",
        "k61_9364\t259\t16\t0\r\n",
        "k61_9365\t792\t55\t0\r\n",
        "k61_9366\t530\t35\t0\r\n",
        "k61_9367\t238\t18\t0\r\n",
        "k61_9368\t638\t57\t0\r\n",
        "k61_9369\t225\t7\t0\r\n",
        "k61_9370\t298\t17\t0\r\n",
        "k61_9371\t268\t18\t0\r\n",
        "k61_9372\t242\t12\t0\r\n",
        "k61_9373\t1598\t169\t0\r\n",
        "k61_9374\t414\t45\t0\r\n",
        "k61_9375\t208\t19\t0\r\n",
        "k61_9377\t250\t14\t0\r\n",
        "k61_9378\t609\t46\t0\r\n",
        "k61_9380\t446\t19\t0\r\n",
        "k61_9381\t211\t18\t0\r\n",
        "k61_9382\t262\t27\t0\r\n",
        "k61_9383\t460\t31\t0\r\n",
        "k61_9385\t460\t43\t0\r\n",
        "k61_9386\t210\t9\t0\r\n",
        "k61_9387\t366\t19\t0\r\n",
        "k61_9388\t561\t52\t0\r\n",
        "k61_9389\t212\t11\t0\r\n",
        "k61_9390\t267\t14\t0\r\n",
        "k61_9391\t429\t42\t0\r\n",
        "k61_9392\t295\t19\t0\r\n",
        "k61_9393\t617\t46\t0\r\n",
        "k61_9394\t418\t28\t0\r\n",
        "k61_9395\t243\t26\t0\r\n",
        "k61_9396\t278\t17\t0\r\n",
        "k61_9397\t373\t34\t0\r\n",
        "k61_9398\t433\t21\t0\r\n",
        "k61_9399\t206\t6\t0\r\n",
        "k61_9400\t1125\t90\t0\r\n",
        "k61_9401\t580\t68\t0\r\n",
        "k61_9402\t1367\t100\t0\r\n",
        "k61_9403\t693\t49\t0\r\n",
        "k61_9407\t210\t22\t0\r\n",
        "k61_9408\t221\t19\t0\r\n",
        "k61_9410\t321\t28\t0\r\n",
        "k61_9411\t453\t23\t0\r\n",
        "k61_9412\t393\t30\t0\r\n",
        "k61_9413\t503\t47\t0\r\n",
        "k61_9414\t536\t43\t0\r\n",
        "k61_9415\t292\t17\t0\r\n",
        "k61_9416\t201\t7\t0\r\n",
        "k61_9417\t336\t26\t0\r\n",
        "k61_9419\t219\t16\t0\r\n",
        "k61_9420\t767\t79\t0\r\n",
        "k61_9421\t323\t19\t0\r\n",
        "k61_9422\t432\t33\t0\r\n",
        "k61_9423\t354\t28\t0\r\n",
        "k61_9424\t271\t13\t0\r\n",
        "k61_9425\t843\t87\t0\r\n",
        "k61_9426\t349\t20\t0\r\n",
        "k61_9428\t6780\t4383\t0\r\n",
        "k61_9429\t565\t36\t0\r\n",
        "k61_9430\t568\t53\t0\r\n",
        "k61_9431\t246\t23\t0\r\n",
        "k61_9432\t1199\t113\t0\r\n",
        "k61_9433\t380\t36\t0\r\n",
        "k61_9434\t733\t68\t0\r\n",
        "k61_9435\t321\t29\t0\r\n",
        "k61_9436\t216\t4\t0\r\n",
        "k61_9437\t278\t22\t0\r\n",
        "k61_9439\t927\t87\t0\r\n",
        "k61_9440\t222\t19\t0\r\n",
        "k61_9441\t921\t113\t0\r\n",
        "k61_9442\t289\t13\t0\r\n",
        "k61_9444\t540\t47\t0\r\n",
        "k61_9445\t248\t12\t0\r\n",
        "k61_9446\t333\t27\t0\r\n",
        "k61_9447\t521\t19\t0\r\n",
        "k61_9448\t296\t22\t0\r\n",
        "k61_9449\t1108\t140\t0\r\n",
        "k61_9450\t781\t56\t0\r\n",
        "k61_9451\t205\t12\t0\r\n",
        "k61_9452\t592\t52\t0\r\n",
        "k61_9453\t266\t22\t0\r\n",
        "k61_9454\t206\t14\t0\r\n",
        "k61_9455\t266\t12\t0\r\n",
        "k61_9456\t269\t22\t0\r\n",
        "k61_9457\t287\t12\t0\r\n",
        "k61_9458\t309\t17\t0\r\n",
        "k61_9459\t212\t14\t0\r\n",
        "k61_9460\t248\t10\t0\r\n",
        "k61_9461\t237\t8\t0\r\n",
        "k61_9462\t207\t18\t0\r\n",
        "k61_9463\t308\t18\t0\r\n",
        "k61_9465\t644\t43\t0\r\n",
        "k61_9466\t1212\t101\t0\r\n",
        "k61_9467\t282\t22\t0\r\n",
        "k61_9468\t298\t39\t0\r\n",
        "k61_9469\t346\t25\t0\r\n",
        "k61_9470\t436\t33\t0\r\n",
        "k61_9471\t225\t16\t0\r\n",
        "k61_9472\t567\t175\t0\r\n",
        "k61_9473\t228\t19\t0\r\n",
        "k61_9474\t294\t24\t0\r\n",
        "k61_9475\t268\t16\t0\r\n",
        "k61_9476\t245\t9\t0\r\n",
        "k61_9477\t610\t26\t0\r\n",
        "k61_9479\t270\t21\t0\r\n",
        "k61_9480\t252\t11\t0\r\n",
        "k61_9481\t456\t30\t0\r\n",
        "k61_9482\t249\t21\t0\r\n",
        "k61_9483\t249\t21\t0\r\n",
        "k61_9484\t220\t15\t0\r\n",
        "k61_9485\t318\t14\t0\r\n",
        "k61_9486\t594\t49\t0\r\n",
        "k61_9488\t260\t17\t0\r\n",
        "k61_9489\t857\t90\t0\r\n",
        "k61_9490\t346\t24\t0\r\n",
        "k61_9491\t339\t39\t0\r\n",
        "k61_9492\t215\t7\t0\r\n",
        "k61_9493\t288\t36\t0\r\n",
        "k61_9494\t245\t16\t0\r\n",
        "k61_9495\t601\t47\t0\r\n",
        "k61_9497\t261\t13\t0\r\n",
        "k61_9498\t306\t28\t0\r\n",
        "k61_9499\t374\t25\t0\r\n",
        "k61_9500\t466\t39\t0\r\n",
        "k61_9502\t437\t21\t0\r\n",
        "k61_9503\t495\t50\t0\r\n",
        "k61_9505\t481\t38\t0\r\n",
        "k61_9506\t687\t50\t0\r\n",
        "k61_9507\t463\t27\t0\r\n",
        "k61_9509\t538\t172\t0\r\n",
        "k61_9510\t319\t25\t0\r\n",
        "k61_9511\t824\t59\t0\r\n",
        "k61_9512\t610\t41\t0\r\n",
        "k61_9513\t244\t21\t0\r\n",
        "k61_9514\t261\t29\t0\r\n",
        "k61_9515\t246\t11\t0\r\n",
        "k61_9516\t214\t8\t0\r\n",
        "k61_9517\t508\t40\t0\r\n",
        "k61_9518\t947\t67\t0\r\n",
        "k61_9519\t356\t28\t0\r\n",
        "k61_9520\t302\t32\t0\r\n",
        "k61_9521\t835\t71\t0\r\n",
        "k61_9522\t256\t17\t0\r\n",
        "k61_9523\t405\t37\t0\r\n",
        "k61_9524\t279\t21\t0\r\n",
        "k61_9525\t287\t23\t0\r\n",
        "k61_9526\t901\t79\t0\r\n",
        "k61_9527\t290\t23\t0\r\n",
        "k61_9528\t432\t38\t0\r\n",
        "k61_9529\t654\t52\t0\r\n",
        "k61_9530\t376\t31\t0\r\n",
        "k61_9531\t248\t11\t0\r\n",
        "k61_9532\t202\t14\t0\r\n",
        "k61_9533\t273\t15\t0\r\n",
        "k61_9534\t255\t29\t0\r\n",
        "k61_9535\t665\t65\t0\r\n",
        "k61_9536\t295\t23\t0\r\n",
        "k61_9538\t220\t9\t0\r\n",
        "k61_9539\t500\t54\t0\r\n",
        "k61_9540\t226\t15\t0\r\n",
        "k61_9541\t840\t63\t0\r\n",
        "k61_9542\t370\t43\t0\r\n",
        "k61_9543\t280\t11\t0\r\n",
        "k61_9544\t242\t16\t0\r\n",
        "k61_9545\t285\t21\t0\r\n",
        "k61_9548\t326\t13\t0\r\n",
        "k61_9549\t238\t8\t0\r\n",
        "k61_9550\t645\t57\t0\r\n",
        "k61_9551\t281\t27\t0\r\n",
        "k61_9552\t1426\t153\t0\r\n",
        "k61_9553\t797\t78\t0\r\n",
        "k61_9554\t380\t26\t0\r\n",
        "k61_9555\t966\t79\t0\r\n",
        "k61_9556\t766\t81\t0\r\n",
        "k61_9557\t1201\t105\t0\r\n",
        "k61_9558\t257\t9\t0\r\n",
        "k61_9560\t927\t65\t0\r\n",
        "k61_9561\t896\t72\t0\r\n",
        "k61_9562\t492\t29\t0\r\n",
        "k61_9563\t229\t16\t0\r\n",
        "k61_9564\t1988\t192\t0\r\n",
        "k61_9565\t418\t34\t0\r\n",
        "k61_9566\t303\t26\t0\r\n",
        "k61_9567\t289\t19\t0\r\n",
        "k61_9569\t497\t71\t0\r\n",
        "k61_9570\t589\t47\t0\r\n",
        "k61_9571\t302\t21\t0\r\n",
        "k61_9573\t204\t12\t0\r\n",
        "k61_9574\t636\t45\t0\r\n",
        "k61_9575\t284\t10\t0\r\n",
        "k61_9576\t1193\t94\t0\r\n",
        "k61_9577\t411\t24\t0\r\n",
        "k61_9578\t999\t138\t0\r\n",
        "k61_9579\t225\t14\t0\r\n",
        "k61_9580\t209\t6\t0\r\n",
        "k61_9581\t274\t19\t0\r\n",
        "k61_9582\t499\t29\t0\r\n",
        "k61_9583\t621\t65\t0\r\n",
        "k61_9584\t660\t43\t0\r\n",
        "k61_9585\t440\t45\t0\r\n",
        "k61_9586\t383\t13\t0\r\n",
        "k61_9587\t229\t11\t0\r\n",
        "k61_9588\t283\t20\t0\r\n",
        "k61_9589\t657\t55\t0\r\n",
        "k61_9591\t212\t13\t0\r\n",
        "k61_9593\t417\t33\t0\r\n",
        "k61_9595\t1313\t131\t0\r\n",
        "k61_9596\t659\t59\t0\r\n",
        "k61_9597\t427\t41\t0\r\n",
        "k61_9598\t223\t21\t0\r\n",
        "k61_9599\t265\t23\t0\r\n",
        "k61_9600\t226\t18\t0\r\n",
        "k61_9603\t368\t25\t0\r\n",
        "k61_9604\t1795\t177\t0\r\n",
        "k61_9605\t316\t14\t0\r\n",
        "k61_9606\t311\t21\t0\r\n",
        "k61_9608\t307\t22\t0\r\n",
        "k61_9609\t207\t6\t0\r\n",
        "k61_9610\t220\t10\t0\r\n",
        "k61_9612\t221\t16\t0\r\n",
        "k61_9613\t401\t22\t0\r\n",
        "k61_9614\t241\t21\t0\r\n",
        "k61_9615\t275\t29\t0\r\n",
        "k61_9616\t209\t30\t0\r\n",
        "k61_9617\t210\t10\t0\r\n",
        "k61_9618\t301\t23\t0\r\n",
        "k61_9619\t700\t65\t0\r\n",
        "k61_9620\t268\t17\t0\r\n",
        "k61_9621\t694\t54\t0\r\n",
        "k61_9622\t304\t33\t0\r\n",
        "k61_9623\t358\t30\t0\r\n",
        "k61_9624\t225\t20\t0\r\n",
        "k61_9625\t236\t26\t0\r\n",
        "k61_9626\t306\t21\t0\r\n",
        "k61_9627\t430\t37\t0\r\n",
        "k61_9628\t355\t25\t0\r\n",
        "k61_9629\t228\t18\t0\r\n",
        "k61_9630\t420\t29\t0\r\n",
        "k61_9631\t230\t12\t0\r\n",
        "k61_9632\t212\t12\t0\r\n",
        "k61_9633\t402\t32\t0\r\n",
        "k61_9634\t269\t25\t0\r\n",
        "k61_9635\t280\t16\t0\r\n",
        "k61_9637\t297\t10\t0\r\n",
        "k61_9638\t204\t4\t0\r\n",
        "k61_9639\t202\t5\t0\r\n",
        "k61_9640\t471\t35\t0\r\n",
        "k61_9641\t475\t39\t0\r\n",
        "k61_9642\t327\t30\t0\r\n",
        "k61_9643\t671\t62\t0\r\n",
        "k61_9645\t1146\t122\t0\r\n",
        "k61_9646\t338\t15\t0\r\n",
        "k61_9647\t207\t12\t0\r\n",
        "k61_9648\t572\t47\t0\r\n",
        "k61_9649\t318\t24\t0\r\n",
        "k61_9651\t255\t12\t0\r\n",
        "k61_9652\t207\t12\t0\r\n",
        "k61_9653\t310\t10\t0\r\n",
        "k61_9654\t239\t17\t0\r\n",
        "k61_9655\t322\t16\t0\r\n",
        "k61_9656\t339\t15\t0\r\n",
        "k61_9657\t430\t55\t0\r\n",
        "k61_9658\t371\t24\t0\r\n",
        "k61_9659\t796\t77\t0\r\n",
        "k61_9660\t427\t37\t0\r\n",
        "k61_9661\t521\t54\t0\r\n",
        "k61_9663\t219\t8\t0\r\n",
        "k61_9664\t248\t9\t0\r\n",
        "k61_9665\t630\t45\t0\r\n",
        "k61_9666\t819\t63\t0\r\n",
        "k61_9667\t248\t13\t0\r\n",
        "k61_9668\t729\t62\t0\r\n",
        "k61_9669\t232\t9\t0\r\n",
        "k61_9670\t302\t10\t0\r\n",
        "k61_9671\t297\t19\t0\r\n",
        "k61_9672\t544\t70\t0\r\n",
        "k61_9673\t443\t29\t0\r\n",
        "k61_9674\t7406\t9872\t0\r\n",
        "k61_9676\t273\t13\t0\r\n",
        "k61_9677\t266\t8\t0\r\n",
        "k61_9678\t220\t7\t0\r\n",
        "k61_9679\t503\t67\t0\r\n",
        "k61_9680\t928\t74\t0\r\n",
        "k61_9681\t208\t9\t0\r\n",
        "k61_9682\t260\t16\t0\r\n",
        "k61_9683\t404\t37\t0\r\n",
        "k61_9684\t461\t34\t0\r\n",
        "k61_9685\t408\t32\t0\r\n",
        "k61_9688\t224\t5\t0\r\n",
        "k61_9689\t204\t10\t0\r\n",
        "k61_9690\t274\t15\t0\r\n",
        "k61_9691\t1686\t171\t0\r\n",
        "k61_9692\t358\t39\t0\r\n",
        "k61_9693\t214\t9\t0\r\n",
        "k61_9694\t320\t16\t0\r\n",
        "k61_9695\t634\t58\t0\r\n",
        "k61_9696\t206\t16\t0\r\n",
        "k61_9697\t309\t38\t0\r\n",
        "k61_9698\t1146\t122\t0\r\n",
        "k61_9699\t374\t55\t0\r\n",
        "k61_9704\t438\t17\t0\r\n",
        "k61_9707\t725\t65\t0\r\n",
        "k61_9708\t508\t52\t0\r\n",
        "k61_9709\t389\t21\t0\r\n",
        "k61_9710\t480\t52\t0\r\n",
        "k61_9711\t479\t31\t0\r\n",
        "k61_9712\t294\t21\t0\r\n",
        "k61_9713\t352\t15\t0\r\n",
        "k61_9714\t215\t7\t0\r\n",
        "k61_9715\t433\t33\t0\r\n",
        "k61_9716\t910\t97\t0\r\n",
        "k61_9717\t1774\t190\t0\r\n",
        "k61_9718\t206\t12\t0\r\n",
        "k61_9719\t274\t15\t0\r\n",
        "k61_9720\t247\t8\t0\r\n",
        "k61_9721\t721\t78\t0\r\n",
        "k61_9722\t482\t32\t0\r\n",
        "k61_9723\t545\t39\t0\r\n",
        "k61_9724\t1913\t200\t0\r\n",
        "k61_9725\t394\t35\t0\r\n",
        "k61_9726\t226\t13\t0\r\n",
        "k61_9727\t269\t21\t0\r\n",
        "k61_9728\t210\t11\t0\r\n",
        "k61_9729\t308\t22\t0\r\n",
        "k61_9730\t431\t39\t0\r\n",
        "k61_9731\t285\t13\t0\r\n",
        "k61_9732\t202\t13\t0\r\n",
        "k61_9733\t835\t73\t0\r\n",
        "k61_9734\t730\t43\t0\r\n",
        "k61_9735\t2311\t245\t0\r\n",
        "k61_9736\t222\t8\t0\r\n",
        "k61_9737\t875\t95\t0\r\n",
        "k61_9738\t280\t15\t0\r\n",
        "k61_9739\t1609\t166\t0\r\n",
        "k61_9740\t270\t19\t0\r\n",
        "k61_9741\t256\t13\t0\r\n",
        "k61_9742\t209\t14\t0\r\n",
        "k61_9743\t317\t32\t0\r\n",
        "k61_9744\t291\t16\t0\r\n",
        "k61_9745\t514\t34\t0\r\n",
        "k61_9746\t697\t81\t0\r\n",
        "k61_9748\t280\t22\t0\r\n",
        "k61_9749\t360\t17\t0\r\n",
        "k61_9751\t238\t11\t0\r\n",
        "k61_9752\t300\t15\t0\r\n",
        "k61_9753\t376\t21\t0\r\n",
        "k61_9754\t1302\t93\t0\r\n",
        "k61_9757\t240\t10\t0\r\n",
        "k61_9758\t701\t54\t0\r\n",
        "k61_9760\t753\t56\t0\r\n",
        "k61_9761\t213\t13\t0\r\n",
        "k61_9762\t1224\t124\t0\r\n",
        "k61_9763\t449\t42\t0\r\n",
        "k61_9764\t1437\t145\t0\r\n",
        "k61_9765\t229\t13\t0\r\n",
        "k61_9767\t300\t17\t0\r\n",
        "k61_9768\t240\t23\t0\r\n",
        "k61_9769\t375\t44\t0\r\n",
        "k61_9770\t228\t13\t0\r\n",
        "k61_9771\t414\t42\t0\r\n",
        "k61_9772\t343\t34\t0\r\n",
        "k61_9774\t925\t91\t0\r\n",
        "k61_9775\t435\t43\t0\r\n",
        "k61_9776\t356\t30\t0\r\n",
        "k61_9777\t239\t10\t0\r\n",
        "k61_9778\t242\t9\t0\r\n",
        "k61_9779\t316\t11\t0\r\n",
        "k61_9780\t261\t10\t0\r\n",
        "k61_9781\t426\t32\t0\r\n",
        "k61_9783\t219\t20\t0\r\n",
        "k61_9784\t682\t60\t0\r\n",
        "k61_9785\t249\t11\t0\r\n",
        "k61_9786\t660\t67\t0\r\n",
        "k61_9787\t371\t23\t0\r\n",
        "k61_9788\t254\t10\t0\r\n",
        "k61_9789\t325\t24\t0\r\n",
        "k61_9790\t400\t17\t0\r\n",
        "k61_9791\t1252\t102\t0\r\n",
        "k61_9792\t232\t19\t0\r\n",
        "k61_9794\t449\t59\t0\r\n",
        "k61_9797\t248\t15\t0\r\n",
        "k61_9798\t219\t18\t0\r\n",
        "k61_9799\t725\t60\t0\r\n",
        "k61_9801\t372\t23\t0\r\n",
        "k61_9802\t206\t9\t0\r\n",
        "k61_9803\t545\t50\t0\r\n",
        "k61_9804\t432\t36\t0\r\n",
        "k61_9805\t287\t25\t0\r\n",
        "k61_9806\t627\t82\t0\r\n",
        "k61_9807\t358\t30\t0\r\n",
        "k61_9808\t278\t9\t0\r\n",
        "k61_9809\t229\t13\t0\r\n",
        "k61_9810\t247\t12\t0\r\n",
        "k61_9811\t321\t25\t0\r\n",
        "k61_9812\t602\t46\t0\r\n",
        "k61_9813\t230\t13\t0\r\n",
        "k61_9814\t247\t8\t0\r\n",
        "k61_9815\t506\t31\t0\r\n",
        "k61_9816\t428\t36\t0\r\n",
        "k61_9817\t1121\t110\t0\r\n",
        "k61_9818\t233\t13\t0\r\n",
        "k61_9819\t303\t12\t0\r\n",
        "k61_9820\t721\t61\t0\r\n",
        "k61_9821\t358\t25\t0\r\n",
        "k61_9822\t462\t46\t0\r\n",
        "k61_9823\t835\t85\t0\r\n",
        "k61_9824\t421\t31\t0\r\n",
        "k61_9825\t319\t21\t0\r\n",
        "k61_9826\t412\t33\t0\r\n",
        "k61_9827\t448\t33\t0\r\n",
        "k61_9828\t906\t79\t0\r\n",
        "k61_9829\t208\t8\t0\r\n",
        "k61_9830\t309\t33\t0\r\n",
        "k61_9831\t272\t16\t0\r\n",
        "k61_9832\t213\t9\t0\r\n",
        "k61_9833\t713\t49\t0\r\n",
        "k61_9835\t455\t45\t0\r\n",
        "k61_9836\t1272\t143\t0\r\n",
        "k61_9837\t448\t65\t0\r\n",
        "k61_9838\t275\t18\t0\r\n",
        "k61_9839\t325\t32\t0\r\n",
        "k61_9840\t353\t17\t0\r\n",
        "k61_9841\t631\t57\t0\r\n",
        "k61_9842\t1087\t104\t0\r\n",
        "k61_9843\t1289\t128\t0\r\n",
        "k61_9844\t201\t9\t0\r\n",
        "k61_9845\t211\t10\t0\r\n",
        "k61_9846\t228\t5\t0\r\n",
        "k61_9847\t351\t26\t0\r\n",
        "k61_9848\t1442\t121\t0\r\n",
        "k61_9849\t552\t49\t0\r\n",
        "k61_9850\t285\t11\t0\r\n",
        "k61_9851\t1039\t96\t0\r\n",
        "k61_9854\t976\t118\t0\r\n",
        "k61_9855\t291\t12\t0\r\n",
        "k61_9856\t292\t14\t0\r\n",
        "k61_9857\t314\t28\t0\r\n",
        "k61_9858\t278\t15\t0\r\n",
        "k61_9860\t733\t54\t0\r\n",
        "k61_9862\t223\t7\t0\r\n",
        "k61_9863\t222\t18\t0\r\n",
        "k61_9864\t861\t105\t0\r\n",
        "k61_9867\t939\t120\t0\r\n",
        "k61_9868\t735\t62\t0\r\n",
        "k61_9869\t385\t27\t0\r\n",
        "k61_9870\t401\t38\t0\r\n",
        "k61_9872\t328\t19\t0\r\n",
        "k61_9873\t261\t12\t0\r\n",
        "k61_9874\t391\t34\t0\r\n",
        "k61_9875\t1082\t86\t0\r\n",
        "k61_9876\t1056\t103\t0\r\n",
        "k61_9878\t1764\t213\t0\r\n",
        "k61_9879\t293\t8\t0\r\n",
        "k61_9880\t215\t7\t0\r\n",
        "k61_9881\t432\t33\t0\r\n",
        "k61_9882\t490\t45\t0\r\n",
        "k61_9883\t528\t31\t0\r\n",
        "k61_9884\t209\t10\t0\r\n",
        "k61_9885\t1061\t122\t0\r\n",
        "k61_9886\t458\t50\t0\r\n",
        "k61_9887\t202\t8\t0\r\n",
        "k61_9888\t324\t31\t0\r\n",
        "k61_9889\t355\t25\t0\r\n",
        "k61_9890\t272\t10\t0\r\n",
        "k61_9891\t359\t18\t0\r\n",
        "k61_9893\t227\t10\t0\r\n",
        "k61_9894\t435\t21\t0\r\n",
        "k61_9896\t269\t13\t0\r\n",
        "k61_9897\t389\t18\t0\r\n",
        "k61_9898\t214\t24\t0\r\n",
        "k61_9900\t707\t55\t0\r\n",
        "k61_9901\t588\t40\t0\r\n",
        "k61_9902\t211\t15\t0\r\n",
        "k61_9904\t249\t13\t0\r\n",
        "k61_9905\t216\t10\t0\r\n",
        "k61_9906\t431\t38\t0\r\n",
        "k61_9907\t700\t63\t0\r\n",
        "k61_9908\t223\t14\t0\r\n",
        "k61_9909\t488\t42\t0\r\n",
        "k61_9910\t354\t45\t0\r\n",
        "k61_9911\t208\t9\t0\r\n",
        "k61_9912\t443\t28\t0\r\n",
        "k61_9913\t482\t42\t0\r\n",
        "k61_9914\t305\t31\t0\r\n",
        "k61_9915\t200\t9\t0\r\n",
        "k61_9916\t441\t31\t0\r\n",
        "k61_9917\t374\t24\t0\r\n",
        "k61_9918\t474\t46\t0\r\n",
        "k61_9920\t643\t80\t0\r\n",
        "k61_9921\t349\t27\t0\r\n",
        "k61_9922\t791\t63\t0\r\n",
        "k61_9923\t334\t16\t0\r\n",
        "k61_9924\t201\t9\t0\r\n",
        "k61_9925\t404\t19\t0\r\n",
        "k61_9926\t500\t45\t0\r\n",
        "k61_9927\t215\t7\t0\r\n",
        "k61_9928\t502\t41\t0\r\n",
        "k61_9929\t350\t24\t0\r\n",
        "k61_9930\t346\t21\t0\r\n",
        "k61_9931\t241\t16\t0\r\n",
        "k61_9932\t218\t9\t0\r\n",
        "k61_9933\t275\t24\t0\r\n",
        "k61_9934\t2163\t256\t0\r\n",
        "k61_9935\t1158\t131\t0\r\n",
        "k61_9936\t306\t28\t0\r\n",
        "k61_9937\t220\t10\t0\r\n",
        "k61_9938\t314\t23\t0\r\n",
        "k61_9939\t312\t25\t0\r\n",
        "k61_9940\t306\t14\t0\r\n",
        "k61_9942\t294\t20\t0\r\n",
        "k61_9943\t303\t14\t0\r\n",
        "k61_9944\t345\t14\t0\r\n",
        "k61_9945\t241\t11\t0\r\n",
        "k61_9946\t363\t50\t0\r\n",
        "k61_9947\t418\t35\t0\r\n",
        "k61_9948\t292\t20\t0\r\n",
        "k61_9949\t214\t8\t0\r\n",
        "k61_9950\t218\t13\t0\r\n",
        "k61_9951\t598\t58\t0\r\n",
        "k61_9952\t238\t17\t0\r\n",
        "k61_9953\t243\t16\t0\r\n",
        "k61_9954\t673\t56\t0\r\n",
        "k61_9955\t1070\t135\t0\r\n",
        "k61_9956\t600\t69\t0\r\n",
        "k61_9957\t630\t68\t0\r\n",
        "k61_9958\t909\t111\t0\r\n",
        "k61_9959\t299\t8\t0\r\n",
        "k61_9960\t281\t27\t0\r\n",
        "k61_9961\t597\t32\t0\r\n",
        "k61_9962\t842\t70\t0\r\n",
        "k61_9963\t384\t38\t0\r\n",
        "k61_9964\t250\t24\t0\r\n",
        "k61_9965\t217\t10\t0\r\n",
        "k61_9966\t207\t10\t0\r\n",
        "k61_9967\t232\t7\t0\r\n",
        "k61_9968\t564\t72\t0\r\n",
        "k61_9969\t371\t29\t0\r\n",
        "k61_9970\t282\t23\t0\r\n",
        "k61_9971\t279\t13\t0\r\n",
        "k61_9972\t287\t14\t0\r\n",
        "k61_9973\t209\t12\t0\r\n",
        "k61_9974\t1796\t170\t0\r\n",
        "k61_9975\t380\t24\t0\r\n",
        "k61_9977\t439\t32\t0\r\n",
        "k61_9978\t204\t8\t0\r\n",
        "k61_9979\t269\t11\t0\r\n",
        "k61_9980\t778\t68\t0\r\n",
        "k61_9981\t461\t46\t0\r\n",
        "k61_9982\t367\t22\t0\r\n",
        "k61_9983\t231\t15\t0\r\n",
        "k61_9984\t394\t38\t0\r\n",
        "k61_9985\t253\t15\t0\r\n",
        "k61_9986\t494\t45\t0\r\n",
        "k61_9987\t907\t74\t0\r\n",
        "k61_9988\t468\t50\t0\r\n",
        "k61_9989\t210\t14\t0\r\n",
        "k61_9990\t246\t13\t0\r\n",
        "k61_9991\t332\t16\t0\r\n",
        "k61_9992\t409\t30\t0\r\n",
        "k61_9993\t339\t20\t0\r\n",
        "k61_9994\t403\t33\t0\r\n",
        "k61_9997\t1130\t91\t0\r\n",
        "k61_9998\t255\t10\t0\r\n",
        "k61_9999\t519\t40\t0\r\n",
        "k61_10000\t215\t19\t0\r\n",
        "k61_10001\t667\t45\t0\r\n",
        "k61_10002\t657\t53\t0\r\n",
        "k61_10003\t1156\t92\t0\r\n",
        "k61_10004\t235\t10\t0\r\n",
        "k61_10005\t451\t41\t0\r\n",
        "k61_10006\t308\t14\t0\r\n",
        "k61_10007\t258\t11\t0\r\n",
        "k61_10008\t1372\t122\t0\r\n",
        "k61_10009\t252\t14\t0\r\n",
        "k61_10010\t454\t40\t0\r\n",
        "k61_10011\t387\t20\t0\r\n",
        "k61_10013\t287\t22\t0\r\n",
        "k61_10014\t509\t48\t0\r\n",
        "k61_10015\t338\t21\t0\r\n",
        "k61_10016\t792\t59\t0\r\n",
        "k61_10017\t400\t29\t0\r\n",
        "k61_10018\t435\t21\t0\r\n",
        "k61_10020\t731\t79\t0\r\n",
        "k61_10021\t393\t31\t0\r\n",
        "k61_10022\t261\t8\t0\r\n",
        "k61_10023\t1075\t120\t0\r\n",
        "k61_10026\t212\t5\t0\r\n",
        "k61_10027\t709\t71\t0\r\n",
        "k61_10029\t271\t15\t0\r\n",
        "k61_10030\t287\t32\t0\r\n",
        "k61_10031\t258\t16\t0\r\n",
        "k61_10032\t271\t10\t0\r\n",
        "k61_10033\t638\t53\t0\r\n",
        "k61_10034\t323\t12\t0\r\n",
        "k61_10035\t577\t43\t0\r\n",
        "k61_10036\t294\t25\t0\r\n",
        "k61_10037\t352\t19\t0\r\n",
        "k61_10038\t888\t75\t0\r\n",
        "k61_10039\t701\t60\t0\r\n",
        "k61_10040\t257\t12\t0\r\n",
        "k61_10042\t290\t23\t0\r\n",
        "k61_10043\t340\t22\t0\r\n",
        "k61_10044\t436\t29\t0\r\n",
        "k61_10045\t235\t14\t0\r\n",
        "k61_10046\t243\t11\t0\r\n",
        "k61_10047\t314\t34\t0\r\n",
        "k61_10048\t284\t32\t0\r\n",
        "k61_10049\t210\t8\t0\r\n",
        "k61_10050\t765\t79\t0\r\n",
        "k61_10051\t1335\t149\t0\r\n",
        "k61_10052\t233\t14\t0\r\n",
        "k61_10053\t444\t45\t0\r\n",
        "k61_10054\t202\t10\t0\r\n",
        "k61_10055\t818\t45\t0\r\n",
        "k61_10056\t227\t16\t0\r\n",
        "k61_10057\t365\t41\t0\r\n",
        "k61_10058\t220\t8\t0\r\n",
        "k61_10059\t384\t35\t0\r\n",
        "k61_10060\t220\t20\t0\r\n",
        "k61_10062\t299\t25\t0\r\n",
        "k61_10064\t1427\t131\t0\r\n",
        "k61_10065\t1869\t200\t0\r\n",
        "k61_10067\t970\t109\t0\r\n",
        "k61_10068\t246\t11\t0\r\n",
        "k61_10069\t253\t17\t0\r\n",
        "k61_10070\t205\t14\t0\r\n",
        "k61_10071\t217\t8\t0\r\n",
        "k61_10072\t558\t37\t0\r\n",
        "k61_10073\t800\t67\t0\r\n",
        "k61_10074\t337\t28\t0\r\n",
        "k61_10075\t239\t15\t0\r\n",
        "k61_10076\t439\t50\t0\r\n",
        "k61_10077\t398\t26\t0\r\n",
        "k61_10078\t341\t24\t0\r\n",
        "k61_10079\t380\t38\t0\r\n",
        "k61_10080\t271\t14\t0\r\n",
        "k61_10081\t2129\t195\t0\r\n",
        "k61_10082\t578\t51\t0\r\n",
        "k61_10083\t286\t24\t0\r\n",
        "k61_10084\t1468\t123\t0\r\n",
        "k61_10085\t221\t14\t0\r\n",
        "k61_10086\t378\t26\t0\r\n",
        "k61_10087\t237\t15\t0\r\n",
        "k61_10090\t1097\t101\t0\r\n",
        "k61_10091\t604\t64\t0\r\n",
        "k61_10093\t261\t14\t0\r\n",
        "k61_10094\t294\t22\t0\r\n",
        "k61_10095\t1126\t245\t0\r\n",
        "k61_10096\t259\t12\t0\r\n",
        "k61_10097\t207\t8\t0\r\n",
        "k61_10098\t869\t75\t0\r\n",
        "k61_10099\t410\t33\t0\r\n",
        "k61_10100\t300\t14\t0\r\n",
        "k61_10101\t207\t6\t0\r\n",
        "k61_10105\t1570\t145\t0\r\n",
        "k61_10106\t223\t8\t0\r\n",
        "k61_10107\t486\t40\t0\r\n",
        "k61_10108\t301\t25\t0\r\n",
        "k61_10109\t349\t22\t0\r\n",
        "k61_10110\t330\t25\t0\r\n",
        "k61_10111\t404\t26\t0\r\n",
        "k61_10112\t383\t27\t0\r\n",
        "k61_10113\t385\t13\t0\r\n",
        "k61_10114\t433\t23\t0\r\n",
        "k61_10115\t276\t9\t0\r\n",
        "k61_10116\t497\t41\t0\r\n",
        "k61_10117\t637\t52\t0\r\n",
        "k61_10118\t288\t12\t0\r\n",
        "k61_10119\t225\t18\t0\r\n",
        "k61_10120\t241\t10\t0\r\n",
        "k61_10121\t415\t20\t0\r\n",
        "k61_10123\t399\t19\t0\r\n",
        "k61_10124\t392\t24\t0\r\n",
        "k61_10125\t306\t21\t0\r\n",
        "k61_10126\t204\t15\t0\r\n",
        "k61_10127\t248\t21\t0\r\n",
        "k61_10128\t229\t9\t0\r\n",
        "k61_10130\t747\t53\t0\r\n",
        "k61_10131\t411\t19\t0\r\n",
        "k61_10132\t1028\t99\t0\r\n",
        "k61_10133\t391\t20\t0\r\n",
        "k61_10134\t464\t32\t0\r\n",
        "k61_10135\t353\t34\t0\r\n",
        "k61_10136\t488\t27\t0\r\n",
        "k61_10137\t573\t63\t0\r\n",
        "k61_10138\t201\t6\t0\r\n",
        "k61_10139\t855\t63\t0\r\n",
        "k61_10140\t213\t11\t0\r\n",
        "k61_10141\t299\t36\t0\r\n",
        "k61_10142\t282\t19\t0\r\n",
        "k61_10143\t293\t19\t0\r\n",
        "k61_10144\t248\t9\t0\r\n",
        "k61_10145\t582\t66\t0\r\n",
        "k61_10146\t395\t29\t0\r\n",
        "k61_10147\t373\t30\t0\r\n",
        "k61_10148\t260\t29\t0\r\n",
        "k61_10150\t1050\t100\t0\r\n",
        "k61_10151\t244\t12\t0\r\n",
        "k61_10152\t505\t38\t0\r\n",
        "k61_10153\t379\t33\t0\r\n",
        "k61_10155\t246\t18\t0\r\n",
        "k61_10156\t272\t11\t0\r\n",
        "k61_10157\t229\t9\t0\r\n",
        "k61_10158\t204\t7\t0\r\n",
        "k61_10159\t259\t17\t0\r\n",
        "k61_10160\t239\t11\t0\r\n",
        "k61_10163\t256\t10\t0\r\n",
        "k61_10164\t232\t7\t0\r\n",
        "k61_10165\t470\t53\t0\r\n",
        "k61_10166\t403\t34\t0\r\n",
        "k61_10168\t733\t65\t0\r\n",
        "k61_10169\t640\t52\t0\r\n",
        "k61_10170\t272\t8\t0\r\n",
        "k61_10171\t246\t20\t0\r\n",
        "k61_10172\t245\t9\t0\r\n",
        "k61_10173\t473\t37\t0\r\n",
        "k61_10174\t208\t10\t0\r\n",
        "k61_10175\t491\t28\t0\r\n",
        "k61_10177\t392\t27\t0\r\n",
        "k61_10178\t573\t36\t0\r\n",
        "k61_10179\t239\t18\t0\r\n",
        "k61_10180\t308\t25\t0\r\n",
        "k61_10181\t911\t98\t0\r\n",
        "k61_10182\t395\t26\t0\r\n",
        "k61_10183\t215\t19\t0\r\n",
        "k61_10184\t660\t61\t0\r\n",
        "k61_10185\t341\t16\t0\r\n",
        "k61_10186\t387\t20\t0\r\n",
        "k61_10187\t493\t193\t0\r\n",
        "k61_10188\t1962\t197\t0\r\n",
        "k61_10189\t263\t16\t0\r\n",
        "k61_10190\t275\t13\t0\r\n",
        "k61_10191\t424\t31\t0\r\n",
        "k61_10192\t200\t8\t0\r\n",
        "k61_10193\t533\t39\t0\r\n",
        "k61_10194\t356\t31\t0\r\n",
        "k61_10195\t450\t39\t0\r\n",
        "k61_10196\t221\t11\t0\r\n",
        "k61_10197\t231\t7\t0\r\n",
        "k61_10198\t289\t21\t0\r\n",
        "k61_10199\t202\t15\t0\r\n",
        "k61_10200\t232\t16\t0\r\n",
        "k61_10202\t859\t78\t0\r\n",
        "k61_10203\t365\t40\t0\r\n",
        "k61_10204\t204\t14\t0\r\n",
        "k61_10205\t201\t10\t0\r\n",
        "k61_10206\t228\t10\t0\r\n",
        "k61_10207\t226\t25\t0\r\n",
        "k61_10208\t269\t32\t0\r\n",
        "k61_10209\t320\t16\t0\r\n",
        "k61_10210\t283\t29\t0\r\n",
        "k61_10211\t354\t38\t0\r\n",
        "k61_10213\t213\t15\t0\r\n",
        "k61_10214\t302\t15\t0\r\n",
        "k61_10215\t457\t42\t0\r\n",
        "k61_10216\t418\t17\t0\r\n",
        "k61_10217\t211\t8\t0\r\n",
        "k61_10218\t588\t50\t0\r\n",
        "k61_10219\t372\t27\t0\r\n",
        "k61_10220\t215\t10\t0\r\n",
        "k61_10221\t677\t56\t0\r\n",
        "k61_10222\t1097\t100\t0\r\n",
        "k61_10223\t244\t13\t0\r\n",
        "k61_10224\t305\t21\t0\r\n",
        "k61_10225\t391\t30\t0\r\n",
        "k61_10226\t2192\t223\t0\r\n",
        "k61_10227\t814\t93\t0\r\n",
        "k61_10228\t621\t63\t0\r\n",
        "k61_10229\t417\t26\t0\r\n",
        "k61_10230\t232\t10\t0\r\n",
        "k61_10231\t718\t61\t0\r\n",
        "k61_10232\t662\t60\t0\r\n",
        "k61_10233\t1993\t228\t0\r\n",
        "k61_10234\t870\t84\t0\r\n",
        "k61_10235\t224\t10\t0\r\n",
        "k61_10236\t340\t16\t0\r\n",
        "k61_10237\t258\t7\t0\r\n",
        "k61_10238\t410\t25\t0\r\n",
        "k61_10239\t277\t28\t0\r\n",
        "k61_10240\t847\t103\t0\r\n",
        "k61_10241\t216\t27\t0\r\n",
        "k61_10242\t590\t48\t0\r\n",
        "k61_10243\t300\t17\t0\r\n",
        "k61_10244\t201\t9\t0\r\n",
        "k61_10245\t688\t84\t0\r\n",
        "k61_10247\t477\t35\t0\r\n",
        "k61_10248\t944\t100\t0\r\n",
        "k61_10249\t687\t42\t0\r\n",
        "k61_10250\t1061\t111\t0\r\n",
        "k61_10252\t209\t12\t0\r\n",
        "k61_10253\t264\t24\t0\r\n",
        "k61_10254\t404\t38\t0\r\n",
        "k61_10255\t228\t12\t0\r\n",
        "k61_10256\t958\t86\t0\r\n",
        "k61_10257\t405\t31\t0\r\n",
        "k61_10258\t306\t24\t0\r\n",
        "k61_10260\t237\t19\t0\r\n",
        "k61_10261\t392\t35\t0\r\n",
        "k61_10262\t992\t88\t0\r\n",
        "k61_10263\t1235\t96\t0\r\n",
        "k61_10264\t247\t17\t0\r\n",
        "k61_10265\t602\t63\t0\r\n",
        "k61_10266\t456\t35\t0\r\n",
        "k61_10267\t402\t16\t0\r\n",
        "k61_10268\t288\t17\t0\r\n",
        "k61_10270\t683\t64\t0\r\n",
        "k61_10272\t204\t7\t0\r\n",
        "k61_10273\t250\t11\t0\r\n",
        "k61_10274\t335\t17\t0\r\n",
        "k61_10275\t329\t28\t0\r\n",
        "k61_10276\t677\t60\t0\r\n",
        "k61_10277\t394\t28\t0\r\n",
        "k61_10278\t430\t52\t0\r\n",
        "k61_10279\t455\t38\t0\r\n",
        "k61_10280\t423\t33\t0\r\n",
        "k61_10281\t273\t24\t0\r\n",
        "k61_10282\t210\t13\t0\r\n",
        "k61_10283\t255\t10\t0\r\n",
        "k61_10284\t564\t42\t0\r\n",
        "k61_10285\t500\t51\t0\r\n",
        "k61_10286\t486\t24\t0\r\n",
        "k61_10287\t268\t17\t0\r\n",
        "k61_10288\t332\t45\t0\r\n",
        "k61_10289\t292\t12\t0\r\n",
        "k61_10290\t231\t12\t0\r\n",
        "k61_10291\t411\t17\t0\r\n",
        "k61_10292\t419\t27\t0\r\n",
        "k61_10293\t788\t98\t0\r\n",
        "k61_10295\t1101\t106\t0\r\n",
        "k61_10298\t210\t7\t0\r\n",
        "k61_10299\t582\t57\t0\r\n",
        "k61_10300\t905\t69\t0\r\n",
        "k61_10302\t555\t49\t0\r\n",
        "k61_10303\t219\t19\t0\r\n",
        "k61_10305\t315\t24\t0\r\n",
        "k61_10306\t412\t42\t0\r\n",
        "k61_10307\t991\t70\t0\r\n",
        "k61_10308\t256\t7\t0\r\n",
        "k61_10309\t971\t79\t0\r\n",
        "k61_10310\t240\t10\t0\r\n",
        "k61_10311\t549\t81\t0\r\n",
        "k61_10312\t211\t12\t0\r\n",
        "k61_10313\t394\t44\t0\r\n",
        "k61_10314\t374\t40\t0\r\n",
        "k61_10315\t235\t8\t0\r\n",
        "k61_10316\t239\t11\t0\r\n",
        "k61_10317\t212\t6\t0\r\n",
        "k61_10319\t767\t103\t0\r\n",
        "k61_10321\t205\t7\t0\r\n",
        "k61_10322\t561\t48\t0\r\n",
        "k61_10323\t365\t28\t0\r\n",
        "k61_10324\t334\t34\t0\r\n",
        "k61_10325\t576\t50\t0\r\n",
        "k61_10327\t618\t36\t0\r\n",
        "k61_10328\t1192\t144\t0\r\n",
        "k61_10329\t270\t10\t0\r\n",
        "k61_10330\t322\t14\t0\r\n",
        "k61_10331\t275\t12\t0\r\n",
        "k61_10333\t265\t12\t0\r\n",
        "k61_10334\t344\t17\t0\r\n",
        "k61_10335\t224\t11\t0\r\n",
        "k61_10336\t280\t26\t0\r\n",
        "k61_10337\t209\t11\t0\r\n",
        "k61_10338\t239\t13\t0\r\n",
        "k61_10339\t208\t8\t0\r\n",
        "k61_10340\t232\t29\t0\r\n",
        "k61_10341\t902\t74\t0\r\n",
        "k61_10342\t836\t68\t0\r\n",
        "k61_10343\t284\t15\t0\r\n",
        "k61_10344\t268\t9\t0\r\n",
        "k61_10345\t293\t37\t0\r\n",
        "k61_10346\t346\t31\t0\r\n",
        "k61_10348\t220\t13\t0\r\n",
        "k61_10349\t227\t20\t0\r\n",
        "k61_10350\t441\t46\t0\r\n",
        "k61_10351\t395\t39\t0\r\n",
        "k61_10352\t331\t21\t0\r\n",
        "k61_10354\t823\t72\t0\r\n",
        "k61_10355\t249\t22\t0\r\n",
        "k61_10356\t284\t19\t0\r\n",
        "k61_10357\t985\t81\t0\r\n",
        "k61_10358\t501\t42\t0\r\n",
        "k61_10359\t290\t19\t0\r\n",
        "k61_10360\t324\t27\t0\r\n",
        "k61_10361\t421\t26\t0\r\n",
        "k61_10362\t217\t6\t0\r\n",
        "k61_10363\t382\t22\t0\r\n",
        "k61_10364\t1316\t135\t0\r\n",
        "k61_10365\t880\t78\t0\r\n",
        "k61_10368\t217\t5\t0\r\n",
        "k61_10369\t332\t20\t0\r\n",
        "k61_10371\t379\t27\t0\r\n",
        "k61_10372\t362\t21\t0\r\n",
        "k61_10373\t434\t48\t0\r\n",
        "k61_10374\t279\t13\t0\r\n",
        "k61_10376\t206\t7\t0\r\n",
        "k61_10377\t384\t32\t0\r\n",
        "k61_10378\t228\t10\t0\r\n",
        "k61_10379\t308\t16\t0\r\n",
        "k61_10380\t640\t57\t0\r\n",
        "k61_10382\t221\t12\t0\r\n",
        "k61_10383\t494\t29\t0\r\n",
        "k61_10384\t528\t33\t0\r\n",
        "k61_10385\t244\t12\t0\r\n",
        "k61_10386\t411\t17\t0\r\n",
        "k61_10388\t354\t37\t0\r\n",
        "k61_10389\t485\t50\t0\r\n",
        "k61_10390\t234\t13\t0\r\n",
        "k61_10391\t687\t52\t0\r\n",
        "k61_10392\t571\t55\t0\r\n",
        "k61_10393\t698\t53\t0\r\n",
        "k61_10394\t294\t15\t0\r\n",
        "k61_10395\t229\t12\t0\r\n",
        "k61_10397\t334\t24\t0\r\n",
        "k61_10398\t302\t23\t0\r\n",
        "k61_10399\t491\t40\t0\r\n",
        "k61_10400\t455\t29\t0\r\n",
        "k61_10401\t303\t30\t0\r\n",
        "k61_10402\t490\t43\t0\r\n",
        "k61_10403\t460\t19\t0\r\n",
        "k61_10404\t565\t32\t0\r\n",
        "k61_10405\t247\t11\t0\r\n",
        "k61_10406\t499\t36\t0\r\n",
        "k61_10408\t244\t11\t0\r\n",
        "k61_10409\t290\t34\t0\r\n",
        "k61_10410\t213\t9\t0\r\n",
        "k61_10411\t473\t41\t0\r\n",
        "k61_10412\t262\t11\t0\r\n",
        "k61_10413\t336\t29\t0\r\n",
        "k61_10415\t257\t13\t0\r\n",
        "k61_10416\t286\t17\t0\r\n",
        "k61_10417\t216\t6\t0\r\n",
        "k61_10418\t474\t33\t0\r\n",
        "k61_10420\t281\t24\t0\r\n",
        "k61_10421\t538\t53\t0\r\n",
        "k61_10422\t628\t39\t0\r\n",
        "k61_10423\t374\t15\t0\r\n",
        "k61_10424\t599\t71\t0\r\n",
        "k61_10425\t694\t70\t0\r\n",
        "k61_10426\t497\t43\t0\r\n",
        "k61_10427\t416\t27\t0\r\n",
        "k61_10428\t207\t5\t0\r\n",
        "k61_10429\t260\t15\t0\r\n",
        "k61_10430\t321\t22\t0\r\n",
        "k61_10431\t245\t12\t0\r\n",
        "k61_10432\t267\t15\t0\r\n",
        "k61_10433\t281\t17\t0\r\n",
        "k61_10434\t241\t21\t0\r\n",
        "k61_10435\t230\t10\t0\r\n",
        "k61_10436\t315\t14\t0\r\n",
        "k61_10437\t457\t52\t0\r\n",
        "k61_10438\t257\t15\t0\r\n",
        "k61_10439\t323\t27\t0\r\n",
        "k61_10440\t587\t54\t0\r\n",
        "k61_10441\t462\t43\t0\r\n",
        "k61_10442\t224\t6\t0\r\n",
        "k61_10444\t462\t39\t0\r\n",
        "k61_10446\t451\t39\t0\r\n",
        "k61_10447\t348\t34\t0\r\n",
        "k61_10449\t464\t20\t0\r\n",
        "k61_10450\t485\t38\t0\r\n",
        "k61_10451\t253\t19\t0\r\n",
        "k61_10453\t1106\t101\t0\r\n",
        "k61_10454\t413\t24\t0\r\n",
        "k61_10455\t265\t16\t0\r\n",
        "k61_10456\t403\t12\t0\r\n",
        "k61_10460\t274\t11\t0\r\n",
        "k61_10461\t451\t22\t0\r\n",
        "k61_10462\t222\t9\t0\r\n",
        "k61_10463\t438\t30\t0\r\n",
        "k61_10464\t741\t61\t0\r\n",
        "k61_10465\t204\t9\t0\r\n",
        "k61_10466\t210\t11\t0\r\n",
        "k61_10467\t483\t52\t0\r\n",
        "k61_10468\t473\t52\t0\r\n",
        "k61_10469\t679\t66\t0\r\n",
        "k61_10470\t543\t47\t0\r\n",
        "k61_10471\t236\t12\t0\r\n",
        "k61_10472\t202\t7\t0\r\n",
        "k61_10473\t254\t17\t0\r\n",
        "k61_10474\t1122\t90\t0\r\n",
        "k61_10475\t265\t21\t0\r\n",
        "k61_10476\t205\t7\t0\r\n",
        "k61_10477\t281\t11\t0\r\n",
        "k61_10478\t267\t7\t0\r\n",
        "k61_10479\t322\t35\t0\r\n",
        "k61_10481\t505\t46\t0\r\n",
        "k61_10483\t430\t38\t0\r\n",
        "k61_10484\t1336\t129\t0\r\n",
        "k61_10485\t260\t12\t0\r\n",
        "k61_10486\t814\t82\t0\r\n",
        "k61_10487\t429\t37\t0\r\n",
        "k61_10488\t258\t10\t0\r\n",
        "k61_10489\t254\t10\t0\r\n",
        "k61_10490\t283\t10\t0\r\n",
        "k61_10492\t813\t64\t0\r\n",
        "k61_10493\t533\t58\t0\r\n",
        "k61_10495\t327\t20\t0\r\n",
        "k61_10496\t207\t7\t0\r\n",
        "k61_10497\t1440\t140\t0\r\n",
        "k61_10498\t693\t63\t0\r\n",
        "k61_10499\t346\t17\t0\r\n",
        "k61_10500\t534\t33\t0\r\n",
        "k61_10501\t600\t45\t0\r\n",
        "k61_10502\t380\t30\t0\r\n",
        "k61_10503\t402\t51\t0\r\n",
        "k61_10504\t295\t12\t0\r\n",
        "k61_10505\t383\t38\t0\r\n",
        "k61_10506\t434\t36\t0\r\n",
        "k61_10507\t694\t59\t0\r\n",
        "k61_10508\t1133\t115\t0\r\n",
        "k61_10509\t632\t46\t0\r\n",
        "k61_10510\t207\t6\t0\r\n",
        "k61_10511\t321\t17\t0\r\n",
        "k61_10513\t239\t19\t0\r\n",
        "k61_10514\t336\t32\t0\r\n",
        "k61_10515\t212\t8\t0\r\n",
        "k61_10516\t312\t21\t0\r\n",
        "k61_10518\t337\t16\t0\r\n",
        "k61_10519\t616\t46\t0\r\n",
        "k61_10520\t347\t23\t0\r\n",
        "k61_10521\t254\t21\t0\r\n",
        "k61_10522\t232\t17\t0\r\n",
        "k61_10523\t795\t70\t0\r\n",
        "k61_10524\t368\t32\t0\r\n",
        "k61_10525\t535\t33\t0\r\n",
        "k61_10526\t337\t18\t0\r\n",
        "k61_10527\t578\t49\t0\r\n",
        "k61_10528\t409\t26\t0\r\n",
        "k61_10529\t223\t18\t0\r\n",
        "k61_10531\t260\t22\t0\r\n",
        "k61_10532\t684\t73\t0\r\n",
        "k61_10533\t351\t22\t0\r\n",
        "k61_10534\t378\t20\t0\r\n",
        "k61_10535\t225\t26\t0\r\n",
        "k61_10536\t387\t33\t0\r\n",
        "k61_10537\t1290\t125\t0\r\n",
        "k61_10538\t459\t18\t0\r\n",
        "k61_10539\t285\t26\t0\r\n",
        "k61_10540\t391\t35\t0\r\n",
        "k61_10541\t466\t43\t0\r\n",
        "k61_10543\t223\t9\t0\r\n",
        "k61_10544\t270\t20\t0\r\n",
        "k61_10545\t397\t31\t0\r\n",
        "k61_10546\t718\t68\t0\r\n",
        "k61_10547\t280\t20\t0\r\n",
        "k61_10548\t499\t43\t0\r\n",
        "k61_10549\t304\t15\t0\r\n",
        "k61_10550\t259\t16\t0\r\n",
        "k61_10551\t394\t25\t0\r\n",
        "k61_10552\t208\t7\t0\r\n",
        "k61_10553\t2097\t240\t0\r\n",
        "k61_10554\t269\t24\t0\r\n",
        "k61_10555\t274\t23\t0\r\n",
        "k61_10556\t206\t16\t0\r\n",
        "k61_10557\t446\t20\t0\r\n",
        "k61_10558\t496\t38\t0\r\n",
        "k61_10559\t263\t23\t0\r\n",
        "k61_10560\t365\t19\t0\r\n",
        "k61_10561\t204\t5\t0\r\n",
        "k61_10562\t1032\t85\t0\r\n",
        "k61_10563\t715\t63\t0\r\n",
        "k61_10564\t786\t63\t0\r\n",
        "k61_10565\t276\t13\t0\r\n",
        "k61_10566\t265\t17\t0\r\n",
        "k61_10567\t420\t34\t0\r\n",
        "k61_10568\t450\t29\t0\r\n",
        "k61_10569\t244\t16\t0\r\n",
        "k61_10570\t436\t27\t0\r\n",
        "k61_10571\t460\t34\t0\r\n",
        "k61_10572\t454\t54\t0\r\n",
        "k61_10573\t609\t63\t0\r\n",
        "k61_10574\t1002\t72\t0\r\n",
        "k61_10575\t622\t52\t0\r\n",
        "k61_10576\t535\t49\t0\r\n",
        "k61_10577\t313\t22\t0\r\n",
        "k61_10578\t2678\t271\t0\r\n",
        "k61_10579\t964\t63\t0\r\n",
        "k61_10580\t210\t18\t0\r\n",
        "k61_10581\t951\t65\t0\r\n",
        "k61_10582\t261\t17\t0\r\n",
        "k61_10583\t941\t115\t0\r\n",
        "k61_10584\t303\t12\t0\r\n",
        "k61_10585\t282\t11\t0\r\n",
        "k61_10586\t279\t20\t0\r\n",
        "k61_10587\t250\t14\t0\r\n",
        "k61_10588\t258\t20\t0\r\n",
        "k61_10590\t769\t76\t0\r\n",
        "k61_10591\t698\t65\t0\r\n",
        "k61_10592\t267\t17\t0\r\n",
        "k61_10593\t277\t23\t0\r\n",
        "k61_10594\t388\t24\t0\r\n",
        "k61_10595\t501\t40\t0\r\n",
        "k61_10596\t454\t47\t0\r\n",
        "k61_10597\t907\t79\t0\r\n",
        "k61_10598\t1119\t98\t0\r\n",
        "k61_10599\t200\t12\t0\r\n",
        "k61_10600\t465\t48\t0\r\n",
        "k61_10601\t516\t45\t0\r\n",
        "k61_10602\t569\t52\t0\r\n",
        "k61_10603\t287\t14\t0\r\n",
        "k61_10604\t548\t44\t0\r\n",
        "k61_10605\t774\t41\t0\r\n",
        "k61_10606\t224\t17\t0\r\n",
        "k61_10607\t291\t15\t0\r\n",
        "k61_10608\t250\t18\t0\r\n",
        "k61_10609\t561\t55\t0\r\n",
        "k61_10610\t342\t31\t0\r\n",
        "k61_10613\t283\t11\t0\r\n",
        "k61_10615\t397\t28\t0\r\n",
        "k61_10617\t715\t69\t0\r\n",
        "k61_10618\t308\t15\t0\r\n",
        "k61_10619\t371\t22\t0\r\n",
        "k61_10621\t386\t36\t0\r\n",
        "k61_10622\t275\t15\t0\r\n",
        "k61_10623\t220\t13\t0\r\n",
        "k61_10624\t375\t42\t0\r\n",
        "k61_10625\t238\t13\t0\r\n",
        "k61_10626\t306\t27\t0\r\n",
        "k61_10627\t604\t48\t0\r\n",
        "k61_10628\t358\t31\t0\r\n",
        "k61_10629\t244\t18\t0\r\n",
        "k61_10630\t285\t26\t0\r\n",
        "k61_10631\t373\t33\t0\r\n",
        "k61_10632\t1326\t125\t0\r\n",
        "k61_10633\t804\t67\t0\r\n",
        "k61_10634\t281\t14\t0\r\n",
        "k61_10635\t535\t37\t0\r\n",
        "k61_10636\t441\t32\t0\r\n",
        "k61_10637\t246\t14\t0\r\n",
        "k61_10638\t326\t24\t0\r\n",
        "k61_10639\t331\t31\t0\r\n",
        "k61_10640\t347\t17\t0\r\n",
        "k61_10641\t353\t24\t0\r\n",
        "k61_10642\t1403\t118\t0\r\n",
        "k61_10643\t340\t28\t0\r\n",
        "k61_10644\t305\t25\t0\r\n",
        "k61_10645\t472\t22\t0\r\n",
        "k61_10646\t263\t22\t0\r\n",
        "k61_10647\t238\t13\t0\r\n",
        "k61_10648\t217\t13\t0\r\n",
        "k61_10649\t355\t19\t0\r\n",
        "k61_10650\t305\t10\t0\r\n",
        "k61_10651\t237\t13\t0\r\n",
        "k61_10652\t362\t21\t0\r\n",
        "k61_10655\t202\t9\t0\r\n",
        "k61_10656\t708\t126\t0\r\n",
        "k61_10657\t209\t6\t0\r\n",
        "k61_10658\t483\t48\t0\r\n",
        "k61_10659\t694\t52\t0\r\n",
        "k61_10660\t296\t14\t0\r\n",
        "k61_10661\t232\t15\t0\r\n",
        "k61_10662\t208\t12\t0\r\n",
        "k61_10663\t855\t56\t0\r\n",
        "k61_10664\t737\t58\t0\r\n",
        "k61_10665\t734\t69\t0\r\n",
        "k61_10666\t469\t31\t0\r\n",
        "k61_10667\t247\t16\t0\r\n",
        "k61_10668\t413\t34\t0\r\n",
        "k61_10669\t310\t15\t0\r\n",
        "k61_10670\t217\t8\t0\r\n",
        "k61_10671\t504\t48\t0\r\n",
        "k61_10672\t334\t25\t0\r\n",
        "k61_10673\t554\t28\t0\r\n",
        "k61_10674\t220\t10\t0\r\n",
        "k61_10676\t471\t35\t0\r\n",
        "k61_10677\t221\t12\t0\r\n",
        "k61_10678\t435\t41\t0\r\n",
        "k61_10679\t260\t16\t0\r\n",
        "k61_10680\t915\t78\t0\r\n",
        "k61_10681\t813\t74\t0\r\n",
        "k61_10682\t678\t47\t0\r\n",
        "k61_10683\t309\t16\t0\r\n",
        "k61_10684\t210\t14\t0\r\n",
        "k61_10685\t315\t11\t0\r\n",
        "k61_10686\t401\t31\t0\r\n",
        "k61_10687\t389\t28\t0\r\n",
        "k61_10688\t241\t13\t0\r\n",
        "k61_10689\t962\t77\t0\r\n",
        "k61_10690\t226\t16\t0\r\n",
        "k61_10691\t291\t25\t0\r\n",
        "k61_10692\t264\t25\t0\r\n",
        "k61_10693\t355\t23\t0\r\n",
        "k61_10694\t286\t14\t0\r\n",
        "k61_10695\t206\t9\t0\r\n",
        "k61_10696\t256\t22\t0\r\n",
        "k61_10697\t227\t10\t0\r\n",
        "k61_10698\t284\t25\t0\r\n",
        "k61_10699\t357\t37\t0\r\n",
        "k61_10700\t212\t7\t0\r\n",
        "k61_10701\t281\t23\t0\r\n",
        "k61_10702\t319\t16\t0\r\n",
        "k61_10703\t260\t21\t0\r\n",
        "k61_10704\t415\t43\t0\r\n",
        "k61_10705\t507\t47\t0\r\n",
        "k61_10706\t692\t84\t0\r\n",
        "k61_10707\t302\t14\t0\r\n",
        "k61_10708\t1530\t304\t0\r\n",
        "k61_10709\t331\t23\t0\r\n",
        "k61_10710\t220\t11\t0\r\n",
        "k61_10711\t289\t19\t0\r\n",
        "k61_10712\t216\t12\t0\r\n",
        "k61_10713\t261\t13\t0\r\n",
        "k61_10714\t214\t20\t0\r\n",
        "k61_10715\t2055\t184\t0\r\n",
        "k61_10717\t227\t15\t0\r\n",
        "k61_10718\t277\t14\t0\r\n",
        "k61_10719\t271\t17\t0\r\n",
        "k61_10720\t350\t19\t0\r\n",
        "k61_10721\t568\t50\t0\r\n",
        "k61_10723\t427\t36\t0\r\n",
        "k61_10724\t736\t30\t0\r\n",
        "k61_10725\t423\t43\t0\r\n",
        "k61_10726\t303\t16\t0\r\n",
        "k61_10727\t569\t41\t0\r\n",
        "k61_10728\t324\t21\t0\r\n",
        "k61_10729\t434\t17\t0\r\n",
        "k61_10730\t490\t35\t0\r\n",
        "k61_10731\t242\t13\t0\r\n",
        "k61_10732\t356\t21\t0\r\n",
        "k61_10733\t346\t43\t0\r\n",
        "k61_10735\t245\t17\t0\r\n",
        "k61_10736\t510\t48\t0\r\n",
        "k61_10737\t422\t23\t0\r\n",
        "k61_10739\t400\t28\t0\r\n",
        "k61_10740\t525\t40\t0\r\n",
        "k61_10741\t1200\t110\t0\r\n",
        "k61_10742\t636\t52\t0\r\n",
        "k61_10743\t301\t26\t0\r\n",
        "k61_10744\t350\t21\t0\r\n",
        "k61_10745\t471\t26\t0\r\n",
        "k61_10746\t328\t26\t0\r\n",
        "k61_10747\t206\t12\t0\r\n",
        "k61_10748\t544\t62\t0\r\n",
        "k61_10749\t204\t9\t0\r\n",
        "k61_10750\t331\t29\t0\r\n",
        "k61_10751\t352\t25\t0\r\n",
        "k61_10752\t324\t15\t0\r\n",
        "k61_10754\t591\t53\t0\r\n",
        "k61_10755\t818\t94\t0\r\n",
        "k61_10757\t246\t13\t0\r\n",
        "k61_10758\t317\t14\t0\r\n",
        "k61_10759\t276\t16\t0\r\n",
        "k61_10760\t226\t10\t0\r\n",
        "k61_10761\t262\t16\t0\r\n",
        "k61_10762\t347\t22\t0\r\n",
        "k61_10764\t571\t25\t0\r\n",
        "k61_10765\t465\t25\t0\r\n",
        "k61_10767\t326\t13\t0\r\n",
        "k61_10768\t556\t36\t0\r\n",
        "k61_10769\t303\t21\t0\r\n",
        "k61_10770\t238\t20\t0\r\n",
        "k61_10771\t349\t25\t0\r\n",
        "k61_10773\t338\t30\t0\r\n",
        "k61_10774\t469\t30\t0\r\n",
        "k61_10775\t228\t11\t0\r\n",
        "k61_10776\t243\t20\t0\r\n",
        "k61_10777\t264\t17\t0\r\n",
        "k61_10778\t388\t30\t0\r\n",
        "k61_10779\t663\t57\t0\r\n",
        "k61_10780\t563\t56\t0\r\n",
        "k61_10781\t443\t28\t0\r\n",
        "k61_10782\t260\t14\t0\r\n",
        "k61_10783\t242\t14\t0\r\n",
        "k61_10784\t399\t37\t0\r\n",
        "k61_10785\t556\t39\t0\r\n",
        "k61_10786\t291\t19\t0\r\n",
        "k61_10787\t258\t10\t0\r\n",
        "k61_10788\t236\t9\t0\r\n",
        "k61_10789\t283\t14\t0\r\n",
        "k61_10790\t210\t9\t0\r\n",
        "k61_10791\t244\t8\t0\r\n",
        "k61_10792\t260\t17\t0\r\n",
        "k61_10793\t1303\t142\t0\r\n",
        "k61_10794\t381\t47\t0\r\n",
        "k61_10795\t225\t14\t0\r\n",
        "k61_10796\t482\t34\t0\r\n",
        "k61_10797\t473\t24\t0\r\n",
        "k61_10798\t479\t55\t0\r\n",
        "k61_10799\t360\t33\t0\r\n",
        "k61_10800\t1426\t142\t0\r\n",
        "k61_10802\t481\t23\t0\r\n",
        "k61_10803\t369\t10\t0\r\n",
        "k61_10804\t321\t21\t0\r\n",
        "k61_10805\t477\t45\t0\r\n",
        "k61_10806\t442\t43\t0\r\n",
        "k61_10807\t1981\t183\t0\r\n",
        "k61_10808\t668\t56\t0\r\n",
        "k61_10810\t222\t15\t0\r\n",
        "k61_10811\t202\t10\t0\r\n",
        "k61_10812\t253\t15\t0\r\n",
        "k61_10813\t367\t20\t0\r\n",
        "k61_10814\t781\t64\t0\r\n",
        "k61_10815\t323\t20\t0\r\n",
        "k61_10816\t224\t24\t0\r\n",
        "k61_10817\t2546\t258\t0\r\n",
        "k61_10818\t346\t36\t0\r\n",
        "k61_10819\t347\t35\t0\r\n",
        "k61_10820\t203\t6\t0\r\n",
        "k61_10821\t566\t43\t0\r\n",
        "k61_10822\t290\t19\t0\r\n",
        "k61_10823\t262\t21\t0\r\n",
        "k61_10824\t228\t14\t0\r\n",
        "k61_10825\t497\t38\t0\r\n",
        "k61_10826\t508\t32\t0\r\n",
        "k61_10827\t349\t18\t0\r\n",
        "k61_10828\t331\t30\t0\r\n",
        "k61_10829\t307\t16\t0\r\n",
        "k61_10830\t205\t11\t0\r\n",
        "k61_10831\t400\t29\t0\r\n",
        "k61_10832\t269\t11\t0\r\n",
        "k61_10833\t234\t8\t0\r\n",
        "k61_10834\t667\t52\t0\r\n",
        "k61_10835\t306\t18\t0\r\n",
        "k61_10838\t262\t17\t0\r\n",
        "k61_10840\t312\t23\t0\r\n",
        "k61_10841\t315\t27\t0\r\n",
        "k61_10842\t295\t15\t0\r\n",
        "k61_10844\t550\t60\t0\r\n",
        "k61_10845\t528\t40\t0\r\n",
        "k61_10847\t234\t14\t0\r\n",
        "k61_10849\t240\t13\t0\r\n",
        "k61_10851\t335\t23\t0\r\n",
        "k61_10852\t388\t39\t0\r\n",
        "k61_10853\t631\t43\t0\r\n",
        "k61_10854\t979\t85\t0\r\n",
        "k61_10855\t240\t12\t0\r\n",
        "k61_10857\t349\t17\t0\r\n",
        "k61_10859\t534\t47\t0\r\n",
        "k61_10860\t330\t17\t0\r\n",
        "k61_10861\t339\t23\t0\r\n",
        "k61_10862\t253\t23\t0\r\n",
        "k61_10863\t209\t21\t0\r\n",
        "k61_10864\t436\t37\t0\r\n",
        "k61_10865\t388\t24\t0\r\n",
        "k61_10866\t230\t8\t0\r\n",
        "k61_10867\t343\t17\t0\r\n",
        "k61_10868\t454\t37\t0\r\n",
        "k61_10869\t465\t34\t0\r\n",
        "k61_10870\t718\t77\t0\r\n",
        "k61_10872\t356\t16\t0\r\n",
        "k61_10873\t227\t15\t0\r\n",
        "k61_10874\t367\t14\t0\r\n",
        "k61_10875\t280\t18\t0\r\n",
        "k61_10876\t686\t48\t0\r\n",
        "k61_10877\t249\t16\t0\r\n",
        "k61_10878\t654\t64\t0\r\n",
        "k61_10879\t604\t51\t0\r\n",
        "k61_10880\t558\t31\t0\r\n",
        "k61_10881\t239\t11\t0\r\n",
        "k61_10883\t214\t20\t0\r\n",
        "k61_10884\t688\t59\t0\r\n",
        "k61_10885\t200\t7\t0\r\n",
        "k61_10886\t262\t15\t0\r\n",
        "k61_10887\t301\t8\t0\r\n",
        "k61_10888\t242\t15\t0\r\n",
        "k61_10889\t655\t49\t0\r\n",
        "k61_10890\t271\t20\t0\r\n",
        "k61_10891\t771\t66\t0\r\n",
        "k61_10892\t701\t68\t0\r\n",
        "k61_10893\t330\t28\t0\r\n",
        "k61_10894\t542\t49\t0\r\n",
        "k61_10895\t229\t18\t0\r\n",
        "k61_10897\t463\t54\t0\r\n",
        "k61_10898\t300\t10\t0\r\n",
        "k61_10899\t281\t13\t0\r\n",
        "k61_10900\t206\t11\t0\r\n",
        "k61_10901\t203\t16\t0\r\n",
        "k61_10902\t607\t47\t0\r\n",
        "k61_10903\t250\t11\t0\r\n",
        "k61_10905\t736\t64\t0\r\n",
        "k61_10906\t235\t8\t0\r\n",
        "k61_10907\t205\t10\t0\r\n",
        "k61_10908\t560\t53\t0\r\n",
        "k61_10909\t335\t12\t0\r\n",
        "k61_10910\t1002\t82\t0\r\n",
        "k61_10911\t258\t8\t0\r\n",
        "k61_10912\t267\t14\t0\r\n",
        "k61_10913\t287\t10\t0\r\n",
        "k61_10915\t210\t9\t0\r\n",
        "k61_10916\t269\t12\t0\r\n",
        "k61_10918\t217\t12\t0\r\n",
        "k61_10919\t230\t24\t0\r\n",
        "k61_10920\t341\t21\t0\r\n",
        "k61_10921\t515\t40\t0\r\n",
        "k61_10923\t236\t10\t0\r\n",
        "k61_10924\t850\t84\t0\r\n",
        "k61_10925\t210\t8\t0\r\n",
        "k61_10926\t836\t76\t0\r\n",
        "k61_10928\t1393\t144\t0\r\n",
        "k61_10929\t1198\t104\t0\r\n",
        "k61_10930\t241\t26\t0\r\n",
        "k61_10931\t552\t45\t0\r\n",
        "k61_10932\t1284\t118\t0\r\n",
        "k61_10933\t511\t41\t0\r\n",
        "k61_10934\t891\t82\t0\r\n",
        "k61_10935\t210\t15\t0\r\n",
        "k61_10936\t291\t20\t0\r\n",
        "k61_10937\t279\t30\t0\r\n",
        "k61_10938\t354\t18\t0\r\n",
        "k61_10939\t235\t18\t0\r\n",
        "k61_10940\t347\t25\t0\r\n",
        "k61_10942\t374\t32\t0\r\n",
        "k61_10943\t296\t13\t0\r\n",
        "k61_10944\t377\t15\t0\r\n",
        "k61_10946\t269\t13\t0\r\n",
        "k61_10947\t358\t26\t0\r\n",
        "k61_10948\t303\t28\t0\r\n",
        "k61_10949\t1030\t85\t0\r\n",
        "k61_10950\t203\t5\t0\r\n",
        "k61_10951\t311\t26\t0\r\n",
        "k61_10952\t996\t90\t0\r\n",
        "k61_10953\t231\t11\t0\r\n",
        "k61_10954\t790\t63\t0\r\n",
        "k61_10955\t200\t11\t0\r\n",
        "k61_10956\t266\t19\t0\r\n",
        "k61_10960\t206\t8\t0\r\n",
        "k61_10961\t834\t84\t0\r\n",
        "k61_10962\t713\t49\t0\r\n",
        "k61_10963\t533\t45\t0\r\n",
        "k61_10964\t306\t15\t0\r\n",
        "k61_10965\t663\t52\t0\r\n",
        "k61_10966\t3896\t4296\t0\r\n",
        "k61_10967\t299\t24\t0\r\n",
        "k61_10968\t746\t61\t0\r\n",
        "k61_10969\t491\t59\t0\r\n",
        "k61_10970\t215\t13\t0\r\n",
        "k61_10972\t308\t33\t0\r\n",
        "k61_10973\t602\t50\t0\r\n",
        "k61_10974\t397\t30\t0\r\n",
        "k61_10975\t320\t9\t0\r\n",
        "k61_10976\t675\t72\t0\r\n",
        "k61_10977\t271\t14\t0\r\n",
        "k61_10978\t337\t22\t0\r\n",
        "k61_10979\t304\t24\t0\r\n",
        "k61_10980\t534\t38\t0\r\n",
        "k61_10981\t824\t73\t0\r\n",
        "k61_10982\t257\t9\t0\r\n",
        "k61_10983\t836\t57\t0\r\n",
        "k61_10985\t628\t49\t0\r\n",
        "k61_10986\t219\t16\t0\r\n",
        "k61_10987\t216\t10\t0\r\n",
        "k61_10988\t278\t15\t0\r\n",
        "k61_10989\t226\t12\t0\r\n",
        "k61_10990\t536\t54\t0\r\n",
        "k61_10992\t355\t22\t0\r\n",
        "k61_10994\t220\t11\t0\r\n",
        "k61_10995\t354\t24\t0\r\n",
        "k61_10996\t327\t22\t0\r\n",
        "k61_10998\t247\t15\t0\r\n",
        "k61_10999\t420\t35\t0\r\n",
        "k61_11002\t628\t50\t0\r\n",
        "k61_11005\t237\t12\t0\r\n",
        "k61_11006\t229\t23\t0\r\n",
        "k61_11007\t265\t23\t0\r\n",
        "k61_11008\t525\t43\t0\r\n",
        "k61_11009\t321\t23\t0\r\n",
        "k61_11010\t287\t17\t0\r\n",
        "k61_11011\t1030\t91\t0\r\n",
        "k61_11012\t252\t16\t0\r\n",
        "k61_11013\t525\t31\t0\r\n",
        "k61_11014\t335\t22\t0\r\n",
        "k61_11015\t518\t55\t0\r\n",
        "k61_11016\t269\t19\t0\r\n",
        "k61_11017\t217\t16\t0\r\n",
        "k61_11018\t202\t14\t0\r\n",
        "k61_11019\t284\t21\t0\r\n",
        "k61_11020\t743\t45\t0\r\n",
        "k61_11021\t287\t21\t0\r\n",
        "k61_11022\t1862\t2084\t0\r\n",
        "k61_11024\t545\t50\t0\r\n",
        "k61_11025\t210\t12\t0\r\n",
        "k61_11026\t1005\t69\t0\r\n",
        "k61_11027\t590\t32\t0\r\n",
        "k61_11028\t382\t27\t0\r\n",
        "k61_11029\t1423\t134\t0\r\n",
        "k61_11030\t379\t25\t0\r\n",
        "k61_11031\t654\t48\t0\r\n",
        "k61_11032\t822\t70\t0\r\n",
        "k61_11033\t794\t64\t0\r\n",
        "k61_11034\t734\t79\t0\r\n",
        "k61_11035\t429\t40\t0\r\n",
        "k61_11036\t309\t21\t0\r\n",
        "k61_11037\t748\t60\t0\r\n",
        "k61_11038\t409\t25\t0\r\n",
        "k61_11039\t473\t29\t0\r\n",
        "k61_11040\t888\t90\t0\r\n",
        "k61_11041\t337\t16\t0\r\n",
        "k61_11042\t342\t22\t0\r\n",
        "k61_11043\t245\t29\t0\r\n",
        "k61_11046\t277\t16\t0\r\n",
        "k61_11047\t435\t31\t0\r\n",
        "k61_11048\t342\t31\t0\r\n",
        "k61_11049\t348\t20\t0\r\n",
        "k61_11050\t215\t11\t0\r\n",
        "k61_11051\t314\t30\t0\r\n",
        "k61_11052\t268\t33\t0\r\n",
        "k61_11053\t243\t8\t0\r\n",
        "k61_11054\t260\t9\t0\r\n",
        "k61_11055\t899\t82\t0\r\n",
        "k61_11056\t274\t13\t0\r\n",
        "k61_11057\t1043\t92\t0\r\n",
        "k61_11058\t440\t39\t0\r\n",
        "k61_11059\t678\t58\t0\r\n",
        "k61_11060\t242\t13\t0\r\n",
        "k61_11061\t586\t44\t0\r\n",
        "k61_11062\t697\t49\t0\r\n",
        "k61_11063\t900\t64\t0\r\n",
        "k61_11064\t757\t62\t0\r\n",
        "k61_11065\t958\t84\t0\r\n",
        "k61_11066\t685\t54\t0\r\n",
        "k61_11067\t442\t37\t0\r\n",
        "k61_11068\t420\t26\t0\r\n",
        "k61_11069\t424\t41\t0\r\n",
        "k61_11070\t1053\t113\t0\r\n",
        "k61_11071\t865\t75\t0\r\n",
        "k61_11073\t255\t18\t0\r\n",
        "k61_11074\t253\t10\t0\r\n",
        "k61_11075\t285\t14\t0\r\n",
        "k61_11076\t230\t29\t0\r\n",
        "k61_11077\t264\t13\t0\r\n",
        "k61_11078\t763\t77\t0\r\n",
        "k61_11079\t356\t30\t0\r\n",
        "k61_11080\t433\t45\t0\r\n",
        "k61_11083\t217\t14\t0\r\n",
        "k61_11085\t208\t8\t0\r\n",
        "k61_11086\t227\t18\t0\r\n",
        "k61_11087\t801\t74\t0\r\n",
        "k61_11088\t241\t21\t0\r\n",
        "k61_11089\t390\t21\t0\r\n",
        "k61_11090\t252\t10\t0\r\n",
        "k61_11091\t231\t10\t0\r\n",
        "k61_11092\t728\t70\t0\r\n",
        "k61_11093\t569\t50\t0\r\n",
        "k61_11094\t295\t21\t0\r\n",
        "k61_11095\t672\t61\t0\r\n",
        "k61_11096\t809\t63\t0\r\n",
        "k61_11097\t567\t47\t0\r\n",
        "k61_11098\t475\t62\t0\r\n",
        "k61_11099\t289\t12\t0\r\n",
        "k61_11100\t244\t13\t0\r\n",
        "k61_11101\t267\t23\t0\r\n",
        "k61_11102\t207\t18\t0\r\n",
        "k61_11103\t275\t10\t0\r\n",
        "k61_11104\t378\t42\t0\r\n",
        "k61_11105\t1038\t108\t0\r\n",
        "k61_11106\t314\t26\t0\r\n",
        "k61_11108\t317\t23\t0\r\n",
        "k61_11109\t239\t9\t0\r\n",
        "k61_11110\t434\t36\t0\r\n",
        "k61_11111\t331\t35\t0\r\n",
        "k61_11112\t294\t31\t0\r\n",
        "k61_11113\t546\t45\t0\r\n",
        "k61_11114\t207\t13\t0\r\n",
        "k61_11115\t443\t31\t0\r\n",
        "k61_11116\t524\t42\t0\r\n",
        "k61_11117\t1223\t98\t0\r\n",
        "k61_11118\t324\t30\t0\r\n",
        "k61_11119\t613\t59\t0\r\n",
        "k61_11120\t1726\t135\t0\r\n",
        "k61_11121\t323\t20\t0\r\n",
        "k61_11122\t911\t102\t0\r\n",
        "k61_11124\t375\t30\t0\r\n",
        "k61_11125\t313\t20\t0\r\n",
        "k61_11126\t384\t22\t0\r\n",
        "k61_11127\t499\t23\t0\r\n",
        "k61_11128\t368\t25\t0\r\n",
        "k61_11129\t361\t32\t0\r\n",
        "k61_11130\t409\t30\t0\r\n",
        "k61_11131\t205\t8\t0\r\n",
        "k61_11132\t1646\t182\t0\r\n",
        "k61_11133\t347\t14\t0\r\n",
        "k61_11134\t609\t42\t0\r\n",
        "k61_11135\t246\t24\t0\r\n",
        "k61_11136\t518\t49\t0\r\n",
        "k61_11138\t654\t60\t0\r\n",
        "k61_11139\t265\t29\t0\r\n",
        "k61_11140\t555\t44\t0\r\n",
        "k61_11141\t436\t46\t0\r\n",
        "k61_11142\t237\t11\t0\r\n",
        "k61_11143\t348\t24\t0\r\n",
        "k61_11144\t200\t11\t0\r\n",
        "k61_11146\t212\t11\t0\r\n",
        "k61_11147\t482\t36\t0\r\n",
        "k61_11148\t424\t27\t0\r\n",
        "k61_11149\t218\t8\t0\r\n",
        "k61_11150\t457\t21\t0\r\n",
        "k61_11151\t279\t19\t0\r\n",
        "k61_11152\t412\t27\t0\r\n",
        "k61_11153\t1197\t103\t0\r\n",
        "k61_11154\t1107\t92\t0\r\n",
        "k61_11155\t625\t53\t0\r\n",
        "k61_11156\t227\t8\t0\r\n",
        "k61_11157\t617\t38\t0\r\n",
        "k61_11158\t532\t56\t0\r\n",
        "k61_11159\t438\t33\t0\r\n",
        "k61_11160\t709\t69\t0\r\n",
        "k61_11161\t799\t63\t0\r\n",
        "k61_11162\t253\t23\t0\r\n",
        "k61_11163\t296\t18\t0\r\n",
        "k61_11165\t497\t54\t0\r\n",
        "k61_11166\t766\t68\t0\r\n",
        "k61_11167\t551\t53\t0\r\n",
        "k61_11168\t320\t23\t0\r\n",
        "k61_11169\t254\t29\t0\r\n",
        "k61_11170\t593\t64\t0\r\n",
        "k61_11171\t240\t10\t0\r\n",
        "k61_11172\t269\t21\t0\r\n",
        "k61_11173\t814\t84\t0\r\n",
        "k61_11174\t618\t53\t0\r\n",
        "k61_11176\t549\t39\t0\r\n",
        "k61_11177\t465\t72\t0\r\n",
        "k61_11178\t380\t23\t0\r\n",
        "k61_11179\t282\t14\t0\r\n",
        "k61_11180\t770\t64\t0\r\n",
        "k61_11181\t290\t14\t0\r\n",
        "k61_11182\t234\t26\t0\r\n",
        "k61_11183\t263\t20\t0\r\n",
        "k61_11184\t222\t15\t0\r\n",
        "k61_11185\t298\t25\t0\r\n",
        "k61_11186\t241\t29\t0\r\n",
        "k61_11187\t2034\t235\t0\r\n",
        "k61_11188\t212\t8\t0\r\n",
        "k61_11189\t666\t97\t0\r\n",
        "k61_11190\t249\t11\t0\r\n",
        "k61_11192\t755\t75\t0\r\n",
        "k61_11194\t594\t50\t0\r\n",
        "k61_11195\t309\t20\t0\r\n",
        "k61_11196\t554\t64\t0\r\n",
        "k61_11197\t253\t10\t0\r\n",
        "k61_11198\t201\t10\t0\r\n",
        "k61_11199\t268\t21\t0\r\n",
        "k61_11201\t524\t44\t0\r\n",
        "k61_11202\t223\t8\t0\r\n",
        "k61_11203\t304\t33\t0\r\n",
        "k61_11204\t212\t6\t0\r\n",
        "k61_11205\t471\t41\t0\r\n",
        "k61_11206\t762\t63\t0\r\n",
        "k61_11207\t204\t8\t0\r\n",
        "k61_11208\t386\t24\t0\r\n",
        "k61_11209\t315\t14\t0\r\n",
        "k61_11210\t367\t22\t0\r\n",
        "k61_11211\t227\t22\t0\r\n",
        "k61_11212\t297\t14\t0\r\n",
        "k61_11213\t494\t68\t0\r\n",
        "k61_11214\t346\t28\t0\r\n",
        "k61_11215\t419\t59\t0\r\n",
        "k61_11216\t303\t15\t0\r\n",
        "k61_11217\t302\t20\t0\r\n",
        "k61_11218\t947\t76\t0\r\n",
        "k61_11219\t307\t21\t0\r\n",
        "k61_11220\t346\t33\t0\r\n",
        "k61_11221\t766\t69\t0\r\n",
        "k61_11222\t210\t9\t0\r\n",
        "k61_11224\t255\t19\t0\r\n",
        "k61_11225\t230\t11\t0\r\n",
        "k61_11226\t260\t17\t0\r\n",
        "k61_11227\t269\t17\t0\r\n",
        "k61_11228\t344\t29\t0\r\n",
        "k61_11229\t202\t16\t0\r\n",
        "k61_11230\t254\t15\t0\r\n",
        "k61_11231\t255\t14\t0\r\n",
        "k61_11232\t220\t5\t0\r\n",
        "k61_11233\t253\t12\t0\r\n",
        "k61_11234\t271\t14\t0\r\n",
        "k61_11235\t742\t61\t0\r\n",
        "k61_11236\t261\t17\t0\r\n",
        "k61_11237\t826\t71\t0\r\n",
        "k61_11239\t391\t33\t0\r\n",
        "k61_11240\t245\t17\t0\r\n",
        "k61_11241\t329\t18\t0\r\n",
        "k61_11242\t428\t39\t0\r\n",
        "k61_11243\t303\t20\t0\r\n",
        "k61_11244\t246\t12\t0\r\n",
        "k61_11245\t230\t18\t0\r\n",
        "k61_11246\t438\t30\t0\r\n",
        "k61_11247\t569\t50\t0\r\n",
        "k61_11248\t991\t99\t0\r\n",
        "k61_11249\t519\t37\t0\r\n",
        "k61_11250\t497\t53\t0\r\n",
        "k61_11251\t277\t16\t0\r\n",
        "k61_11252\t490\t47\t0\r\n",
        "k61_11253\t274\t21\t0\r\n",
        "k61_11254\t238\t16\t0\r\n",
        "k61_11255\t254\t25\t0\r\n",
        "k61_11256\t401\t32\t0\r\n",
        "k61_11257\t461\t45\t0\r\n",
        "k61_11258\t341\t11\t0\r\n",
        "k61_11259\t341\t21\t0\r\n",
        "k61_11260\t508\t42\t0\r\n",
        "k61_11261\t209\t17\t0\r\n",
        "k61_11262\t361\t25\t0\r\n",
        "k61_11263\t478\t33\t0\r\n",
        "k61_11264\t1128\t88\t0\r\n",
        "k61_11265\t312\t14\t0\r\n",
        "k61_11266\t1084\t104\t0\r\n",
        "k61_11267\t200\t13\t0\r\n",
        "k61_11268\t1187\t115\t0\r\n",
        "k61_11269\t289\t20\t0\r\n",
        "k61_11270\t216\t18\t0\r\n",
        "k61_11271\t576\t62\t0\r\n",
        "k61_11273\t217\t13\t0\r\n",
        "k61_11274\t562\t49\t0\r\n",
        "k61_11275\t263\t19\t0\r\n",
        "k61_11276\t201\t16\t0\r\n",
        "k61_11277\t235\t7\t0\r\n",
        "k61_11278\t340\t39\t0\r\n",
        "k61_11279\t204\t7\t0\r\n",
        "k61_11280\t1783\t159\t0\r\n",
        "k61_11281\t235\t9\t0\r\n",
        "k61_11282\t444\t38\t0\r\n",
        "k61_11283\t558\t44\t0\r\n",
        "k61_11284\t467\t41\t0\r\n",
        "k61_11285\t571\t58\t0\r\n",
        "k61_11286\t235\t7\t0\r\n",
        "k61_11287\t972\t99\t0\r\n",
        "k61_11288\t1067\t186\t0\r\n",
        "k61_11289\t759\t54\t0\r\n",
        "k61_11290\t368\t26\t0\r\n",
        "k61_11291\t288\t14\t0\r\n",
        "k61_11292\t401\t27\t0\r\n",
        "k61_11293\t205\t13\t0\r\n",
        "k61_11294\t302\t14\t0\r\n",
        "k61_11295\t215\t9\t0\r\n",
        "k61_11296\t1058\t93\t0\r\n",
        "k61_11297\t387\t23\t0\r\n",
        "k61_11298\t253\t8\t0\r\n",
        "k61_11300\t1809\t187\t0\r\n",
        "k61_11301\t253\t14\t0\r\n",
        "k61_11302\t491\t42\t0\r\n",
        "k61_11303\t249\t15\t0\r\n",
        "k61_11304\t301\t9\t0\r\n",
        "k61_11305\t398\t33\t0\r\n",
        "k61_11306\t295\t15\t0\r\n",
        "k61_11307\t237\t16\t0\r\n",
        "k61_11309\t226\t27\t0\r\n",
        "k61_11310\t225\t11\t0\r\n",
        "k61_11311\t242\t23\t0\r\n",
        "k61_11312\t341\t38\t0\r\n",
        "k61_11313\t443\t32\t0\r\n",
        "k61_11314\t220\t18\t0\r\n",
        "k61_11315\t215\t16\t0\r\n",
        "k61_11316\t564\t48\t0\r\n",
        "k61_11318\t272\t19\t0\r\n",
        "k61_11319\t320\t23\t0\r\n",
        "k61_11320\t478\t24\t0\r\n",
        "k61_11321\t255\t11\t0\r\n",
        "k61_11322\t322\t24\t0\r\n",
        "k61_11323\t832\t79\t0\r\n",
        "k61_11324\t276\t15\t0\r\n",
        "k61_11325\t619\t35\t0\r\n",
        "k61_11326\t206\t6\t0\r\n",
        "k61_11327\t209\t10\t0\r\n",
        "k61_11328\t201\t19\t0\r\n",
        "k61_11330\t341\t11\t0\r\n",
        "k61_11331\t255\t18\t0\r\n",
        "k61_11332\t211\t9\t0\r\n",
        "k61_11333\t234\t14\t0\r\n",
        "k61_11334\t752\t60\t0\r\n",
        "k61_11338\t301\t33\t0\r\n",
        "k61_11339\t334\t27\t0\r\n",
        "k61_11340\t428\t38\t0\r\n",
        "k61_11341\t1215\t148\t0\r\n",
        "k61_11342\t545\t47\t0\r\n",
        "k61_11344\t467\t36\t0\r\n",
        "k61_11345\t305\t28\t0\r\n",
        "k61_11346\t438\t30\t0\r\n",
        "k61_11347\t287\t20\t0\r\n",
        "k61_11350\t239\t15\t0\r\n",
        "k61_11351\t1965\t196\t0\r\n",
        "k61_11352\t521\t40\t0\r\n",
        "k61_11354\t280\t15\t0\r\n",
        "k61_11355\t599\t40\t0\r\n",
        "k61_11356\t208\t16\t0\r\n",
        "k61_11357\t463\t48\t0\r\n",
        "k61_11358\t307\t28\t0\r\n",
        "k61_11359\t204\t14\t0\r\n",
        "k61_11360\t225\t7\t0\r\n",
        "k61_11361\t1338\t119\t0\r\n",
        "k61_11362\t660\t51\t0\r\n",
        "k61_11363\t324\t20\t0\r\n",
        "k61_11364\t257\t18\t0\r\n",
        "k61_11367\t668\t61\t0\r\n",
        "k61_11368\t357\t19\t0\r\n",
        "k61_11370\t595\t50\t0\r\n",
        "k61_11371\t588\t49\t0\r\n",
        "k61_11372\t304\t13\t0\r\n",
        "k61_11373\t202\t12\t0\r\n",
        "k61_11374\t687\t73\t0\r\n",
        "k61_11375\t222\t14\t0\r\n",
        "k61_11376\t974\t79\t0\r\n",
        "k61_11377\t729\t68\t0\r\n",
        "k61_11378\t649\t42\t0\r\n",
        "k61_11379\t551\t22\t0\r\n",
        "k61_11380\t262\t11\t0\r\n",
        "k61_11381\t323\t13\t0\r\n",
        "k61_11382\t274\t20\t0\r\n",
        "k61_11383\t441\t35\t0\r\n",
        "k61_11384\t219\t21\t0\r\n",
        "k61_11385\t349\t26\t0\r\n",
        "k61_11386\t304\t28\t0\r\n",
        "k61_11387\t533\t38\t0\r\n",
        "k61_11388\t279\t17\t0\r\n",
        "k61_11389\t523\t35\t0\r\n",
        "k61_11390\t319\t40\t0\r\n",
        "k61_11392\t669\t50\t0\r\n",
        "k61_11393\t454\t44\t0\r\n",
        "k61_11394\t394\t39\t0\r\n",
        "k61_11395\t708\t56\t0\r\n",
        "k61_11396\t246\t18\t0\r\n",
        "k61_11397\t786\t59\t0\r\n",
        "k61_11398\t328\t13\t0\r\n",
        "k61_11399\t1604\t184\t0\r\n",
        "k61_11400\t662\t61\t0\r\n",
        "k61_11401\t797\t68\t0\r\n",
        "k61_11402\t1025\t99\t0\r\n",
        "k61_11403\t729\t47\t0\r\n",
        "k61_11404\t378\t33\t0\r\n",
        "k61_11405\t308\t15\t0\r\n",
        "k61_11406\t1030\t82\t0\r\n",
        "k61_11407\t1318\t95\t0\r\n",
        "k61_11408\t582\t47\t0\r\n",
        "k61_11409\t230\t8\t0\r\n",
        "k61_11410\t609\t77\t0\r\n",
        "k61_11412\t337\t33\t0\r\n",
        "k61_11413\t603\t43\t0\r\n",
        "k61_11414\t522\t41\t0\r\n",
        "k61_11415\t286\t17\t0\r\n",
        "k61_11417\t348\t34\t0\r\n",
        "k61_11418\t213\t10\t0\r\n",
        "k61_11419\t1099\t115\t0\r\n",
        "k61_11420\t732\t53\t0\r\n",
        "k61_11421\t763\t89\t0\r\n",
        "k61_11422\t260\t29\t0\r\n",
        "k61_11423\t483\t37\t0\r\n",
        "k61_11424\t429\t41\t0\r\n",
        "k61_11425\t260\t10\t0\r\n",
        "k61_11426\t253\t17\t0\r\n",
        "k61_11427\t558\t47\t0\r\n",
        "k61_11428\t244\t22\t0\r\n",
        "k61_11429\t374\t16\t0\r\n",
        "k61_11430\t291\t10\t0\r\n",
        "k61_11431\t357\t37\t0\r\n",
        "k61_11432\t492\t32\t0\r\n",
        "k61_11433\t310\t26\t0\r\n",
        "k61_11436\t227\t10\t0\r\n",
        "k61_11437\t260\t22\t0\r\n",
        "k61_11438\t714\t63\t0\r\n",
        "k61_11439\t376\t46\t0\r\n",
        "k61_11440\t405\t29\t0\r\n",
        "k61_11441\t244\t19\t0\r\n",
        "k61_11442\t237\t10\t0\r\n",
        "k61_11443\t231\t12\t0\r\n",
        "k61_11444\t334\t25\t0\r\n",
        "k61_11445\t431\t30\t0\r\n",
        "k61_11446\t262\t16\t0\r\n",
        "k61_11447\t389\t30\t0\r\n",
        "k61_11448\t1307\t156\t0\r\n",
        "k61_11449\t559\t26\t0\r\n",
        "k61_11451\t270\t16\t0\r\n",
        "k61_11454\t396\t27\t0\r\n",
        "k61_11455\t596\t41\t0\r\n",
        "k61_11456\t548\t60\t0\r\n",
        "k61_11457\t364\t23\t0\r\n",
        "k61_11458\t317\t21\t0\r\n",
        "k61_11459\t1417\t135\t0\r\n",
        "k61_11460\t573\t63\t0\r\n",
        "k61_11461\t271\t11\t0\r\n",
        "k61_11462\t239\t10\t0\r\n",
        "k61_11463\t220\t19\t0\r\n",
        "k61_11465\t252\t25\t0\r\n",
        "k61_11466\t385\t9\t0\r\n",
        "k61_11467\t682\t38\t0\r\n",
        "k61_11468\t742\t41\t0\r\n",
        "k61_11470\t336\t28\t0\r\n",
        "k61_11471\t900\t104\t0\r\n",
        "k61_11472\t270\t18\t0\r\n",
        "k61_11473\t293\t19\t0\r\n",
        "k61_11474\t332\t19\t0\r\n",
        "k61_11475\t334\t24\t0\r\n",
        "k61_11476\t327\t18\t0\r\n",
        "k61_11477\t245\t17\t0\r\n",
        "k61_11478\t767\t72\t0\r\n",
        "k61_11479\t636\t54\t0\r\n",
        "k61_11480\t237\t20\t0\r\n",
        "k61_11481\t237\t21\t0\r\n",
        "k61_11482\t503\t50\t0\r\n",
        "k61_11483\t306\t33\t0\r\n",
        "k61_11484\t399\t38\t0\r\n",
        "k61_11485\t386\t32\t0\r\n",
        "k61_11487\t237\t10\t0\r\n",
        "k61_11489\t710\t49\t0\r\n",
        "k61_11491\t1106\t87\t0\r\n",
        "k61_11492\t383\t35\t0\r\n",
        "k61_11493\t310\t18\t0\r\n",
        "k61_11495\t240\t20\t0\r\n",
        "k61_11496\t251\t14\t0\r\n",
        "k61_11497\t256\t17\t0\r\n",
        "k61_11498\t420\t41\t0\r\n",
        "k61_11499\t611\t46\t0\r\n",
        "k61_11500\t509\t52\t0\r\n",
        "k61_11501\t440\t30\t0\r\n",
        "k61_11502\t2322\t230\t0\r\n",
        "k61_11503\t594\t53\t0\r\n",
        "k61_11504\t607\t55\t0\r\n",
        "k61_11505\t227\t14\t0\r\n",
        "k61_11506\t474\t50\t0\r\n",
        "k61_11507\t218\t7\t0\r\n",
        "k61_11508\t231\t21\t0\r\n",
        "k61_11509\t282\t24\t0\r\n",
        "k61_11510\t405\t14\t0\r\n",
        "k61_11511\t418\t22\t0\r\n",
        "k61_11513\t320\t28\t0\r\n",
        "k61_11514\t603\t48\t0\r\n",
        "k61_11516\t340\t20\t0\r\n",
        "k61_11518\t444\t41\t0\r\n",
        "k61_11519\t327\t21\t0\r\n",
        "k61_11520\t464\t51\t0\r\n",
        "k61_11521\t2639\t259\t0\r\n",
        "k61_11522\t312\t10\t0\r\n",
        "k61_11523\t1922\t184\t0\r\n",
        "k61_11524\t345\t30\t0\r\n",
        "k61_11525\t552\t36\t0\r\n",
        "k61_11526\t1368\t114\t0\r\n",
        "k61_11527\t251\t10\t0\r\n",
        "k61_11528\t949\t85\t0\r\n",
        "k61_11529\t212\t7\t0\r\n",
        "k61_11530\t250\t12\t0\r\n",
        "k61_11531\t644\t55\t0\r\n",
        "k61_11532\t266\t23\t0\r\n",
        "k61_11534\t210\t13\t0\r\n",
        "k61_11535\t255\t10\t0\r\n",
        "k61_11537\t265\t10\t0\r\n",
        "k61_11538\t384\t34\t0\r\n",
        "k61_11539\t322\t19\t0\r\n",
        "k61_11540\t564\t69\t0\r\n",
        "k61_11541\t1093\t158\t0\r\n",
        "k61_11542\t695\t44\t0\r\n",
        "k61_11543\t344\t22\t0\r\n",
        "k61_11544\t587\t67\t0\r\n",
        "k61_11545\t312\t13\t0\r\n",
        "k61_11547\t643\t67\t0\r\n",
        "k61_11548\t442\t31\t0\r\n",
        "k61_11549\t976\t73\t0\r\n",
        "k61_11550\t704\t74\t0\r\n",
        "k61_11551\t225\t15\t0\r\n",
        "k61_11552\t393\t25\t0\r\n",
        "k61_11553\t200\t8\t0\r\n",
        "k61_11554\t710\t64\t0\r\n",
        "k61_11555\t224\t9\t0\r\n",
        "k61_11556\t427\t28\t0\r\n",
        "k61_11557\t262\t21\t0\r\n",
        "k61_11558\t357\t28\t0\r\n",
        "k61_11559\t282\t14\t0\r\n",
        "k61_11561\t206\t6\t0\r\n",
        "k61_11562\t374\t38\t0\r\n",
        "k61_11563\t694\t62\t0\r\n",
        "k61_11565\t449\t39\t0\r\n",
        "k61_11567\t1388\t121\t0\r\n",
        "k61_11568\t350\t23\t0\r\n",
        "k61_11569\t417\t23\t0\r\n",
        "k61_11570\t264\t10\t0\r\n",
        "k61_11571\t378\t17\t0\r\n",
        "k61_11572\t233\t7\t0\r\n",
        "k61_11573\t298\t15\t0\r\n",
        "k61_11574\t262\t9\t0\r\n",
        "k61_11575\t482\t40\t0\r\n",
        "k61_11576\t246\t10\t0\r\n",
        "k61_11577\t871\t81\t0\r\n",
        "k61_11578\t203\t19\t0\r\n",
        "k61_11579\t589\t61\t0\r\n",
        "k61_11581\t330\t21\t0\r\n",
        "k61_11583\t206\t9\t0\r\n",
        "k61_11584\t1236\t134\t0\r\n",
        "k61_11585\t345\t24\t0\r\n",
        "k61_11586\t944\t72\t0\r\n",
        "k61_11587\t377\t24\t0\r\n",
        "k61_11588\t1402\t177\t0\r\n",
        "k61_11589\t874\t81\t0\r\n",
        "k61_11590\t966\t72\t0\r\n",
        "k61_11591\t227\t18\t0\r\n",
        "k61_11593\t400\t36\t0\r\n",
        "k61_11594\t244\t15\t0\r\n",
        "k61_11596\t408\t19\t0\r\n",
        "k61_11597\t815\t62\t0\r\n",
        "k61_11598\t924\t66\t0\r\n",
        "k61_11599\t222\t9\t0\r\n",
        "k61_11600\t250\t15\t0\r\n",
        "k61_11601\t232\t24\t0\r\n",
        "k61_11602\t338\t21\t0\r\n",
        "k61_11603\t999\t96\t0\r\n",
        "k61_11604\t437\t53\t0\r\n",
        "k61_11605\t219\t13\t0\r\n",
        "k61_11606\t410\t25\t0\r\n",
        "k61_11607\t539\t26\t0\r\n",
        "k61_11608\t224\t10\t0\r\n",
        "k61_11609\t289\t10\t0\r\n",
        "k61_11610\t204\t7\t0\r\n",
        "k61_11612\t508\t43\t0\r\n",
        "k61_11613\t337\t12\t0\r\n",
        "k61_11614\t274\t32\t0\r\n",
        "k61_11615\t235\t13\t0\r\n",
        "k61_11616\t470\t20\t0\r\n",
        "k61_11617\t322\t24\t0\r\n",
        "k61_11618\t403\t44\t0\r\n",
        "k61_11619\t221\t8\t0\r\n",
        "k61_11620\t225\t15\t0\r\n",
        "k61_11621\t681\t56\t0\r\n",
        "k61_11622\t308\t23\t0\r\n",
        "k61_11624\t807\t59\t0\r\n",
        "k61_11625\t491\t57\t0\r\n",
        "k61_11626\t481\t29\t0\r\n",
        "k61_11627\t298\t20\t0\r\n",
        "k61_11628\t1302\t109\t0\r\n",
        "k61_11629\t466\t43\t0\r\n",
        "k61_11630\t280\t13\t0\r\n",
        "k61_11632\t1221\t125\t0\r\n",
        "k61_11633\t245\t16\t0\r\n",
        "k61_11634\t428\t36\t0\r\n",
        "k61_11635\t994\t92\t0\r\n",
        "k61_11636\t202\t8\t0\r\n",
        "k61_11637\t332\t30\t0\r\n",
        "k61_11639\t481\t21\t0\r\n",
        "k61_11640\t303\t24\t0\r\n",
        "k61_11641\t306\t22\t0\r\n",
        "k61_11642\t219\t12\t0\r\n",
        "k61_11643\t738\t59\t0\r\n",
        "k61_11644\t359\t18\t0\r\n",
        "k61_11645\t208\t7\t0\r\n",
        "k61_11646\t445\t35\t0\r\n",
        "k61_11650\t446\t22\t0\r\n",
        "k61_11652\t272\t23\t0\r\n",
        "k61_11653\t711\t42\t0\r\n",
        "k61_11655\t304\t27\t0\r\n",
        "k61_11656\t837\t95\t0\r\n",
        "k61_11657\t201\t21\t0\r\n",
        "k61_11658\t200\t8\t0\r\n",
        "k61_11659\t579\t28\t0\r\n",
        "k61_11660\t720\t60\t0\r\n",
        "k61_11661\t1089\t90\t0\r\n",
        "k61_11662\t639\t49\t0\r\n",
        "k61_11663\t369\t14\t0\r\n",
        "k61_11665\t236\t26\t0\r\n",
        "k61_11666\t270\t13\t0\r\n",
        "k61_11667\t225\t10\t0\r\n",
        "k61_11668\t299\t19\t0\r\n",
        "k61_11669\t716\t52\t0\r\n",
        "k61_11670\t353\t34\t0\r\n",
        "k61_11671\t220\t6\t0\r\n",
        "k61_11672\t761\t72\t0\r\n",
        "k61_11673\t237\t8\t0\r\n",
        "k61_11674\t252\t21\t0\r\n",
        "k61_11675\t303\t27\t0\r\n",
        "k61_11676\t200\t11\t0\r\n",
        "k61_11677\t278\t24\t0\r\n",
        "k61_11680\t339\t19\t0\r\n",
        "k61_11681\t688\t77\t0\r\n",
        "k61_11682\t408\t33\t0\r\n",
        "k61_11684\t290\t15\t0\r\n",
        "k61_11685\t247\t10\t0\r\n",
        "k61_11686\t314\t20\t0\r\n",
        "k61_11687\t327\t31\t0\r\n",
        "k61_11688\t266\t26\t0\r\n",
        "k61_11690\t279\t15\t0\r\n",
        "k61_11691\t445\t36\t0\r\n",
        "k61_11692\t334\t25\t0\r\n",
        "k61_11693\t501\t31\t0\r\n",
        "k61_11694\t293\t24\t0\r\n",
        "k61_11695\t392\t33\t0\r\n",
        "k61_11696\t605\t32\t0\r\n",
        "k61_11697\t747\t83\t0\r\n",
        "k61_11698\t363\t31\t0\r\n",
        "k61_11699\t526\t31\t0\r\n",
        "k61_11700\t394\t27\t0\r\n",
        "k61_11701\t357\t20\t0\r\n",
        "k61_11702\t745\t67\t0\r\n",
        "k61_11703\t474\t50\t0\r\n",
        "k61_11704\t279\t12\t0\r\n",
        "k61_11705\t365\t27\t0\r\n",
        "k61_11706\t248\t10\t0\r\n",
        "k61_11707\t490\t28\t0\r\n",
        "k61_11708\t247\t13\t0\r\n",
        "k61_11711\t210\t9\t0\r\n",
        "k61_11712\t556\t49\t0\r\n",
        "k61_11713\t206\t5\t0\r\n",
        "k61_11714\t407\t27\t0\r\n",
        "k61_11715\t466\t20\t0\r\n",
        "k61_11716\t554\t37\t0\r\n",
        "k61_11717\t213\t8\t0\r\n",
        "k61_11718\t254\t22\t0\r\n",
        "k61_11719\t468\t41\t0\r\n",
        "k61_11720\t511\t30\t0\r\n",
        "k61_11721\t411\t24\t0\r\n",
        "k61_11722\t1444\t117\t0\r\n",
        "k61_11723\t376\t23\t0\r\n",
        "k61_11724\t593\t42\t0\r\n",
        "k61_11725\t418\t30\t0\r\n",
        "k61_11726\t211\t16\t0\r\n",
        "k61_11727\t205\t12\t0\r\n",
        "k61_11728\t241\t8\t0\r\n",
        "k61_11729\t403\t36\t0\r\n",
        "k61_11730\t443\t39\t0\r\n",
        "k61_11731\t391\t27\t0\r\n",
        "k61_11732\t442\t48\t0\r\n",
        "k61_11733\t1571\t166\t0\r\n",
        "k61_11734\t293\t19\t0\r\n",
        "k61_11735\t473\t43\t0\r\n",
        "k61_11737\t277\t11\t0\r\n",
        "k61_11738\t578\t57\t0\r\n",
        "k61_11739\t401\t40\t0\r\n",
        "k61_11740\t214\t7\t0\r\n",
        "k61_11741\t856\t83\t0\r\n",
        "k61_11742\t262\t12\t0\r\n",
        "k61_11743\t210\t11\t0\r\n",
        "k61_11744\t421\t29\t0\r\n",
        "k61_11745\t226\t9\t0\r\n",
        "k61_11746\t257\t17\t0\r\n",
        "k61_11747\t233\t9\t0\r\n",
        "k61_11749\t448\t32\t0\r\n",
        "k61_11750\t551\t57\t0\r\n",
        "k61_11751\t1780\t166\t0\r\n",
        "k61_11752\t242\t9\t0\r\n",
        "k61_11753\t289\t23\t0\r\n",
        "k61_11754\t555\t44\t0\r\n",
        "k61_11755\t289\t15\t0\r\n",
        "k61_11756\t239\t15\t0\r\n",
        "k61_11757\t565\t47\t0\r\n",
        "k61_11758\t539\t50\t0\r\n",
        "k61_11759\t249\t12\t0\r\n",
        "k61_11760\t639\t66\t0\r\n",
        "k61_11761\t350\t19\t0\r\n",
        "k61_11762\t241\t10\t0\r\n",
        "k61_11764\t260\t24\t0\r\n",
        "k61_11765\t226\t10\t0\r\n",
        "k61_11766\t450\t35\t0\r\n",
        "k61_11767\t357\t17\t0\r\n",
        "k61_11768\t976\t72\t0\r\n",
        "k61_11769\t369\t29\t0\r\n",
        "k61_11770\t340\t22\t0\r\n",
        "k61_11771\t259\t14\t0\r\n",
        "k61_11772\t280\t19\t0\r\n",
        "k61_11773\t202\t5\t0\r\n",
        "k61_11774\t878\t80\t0\r\n",
        "k61_11775\t238\t26\t0\r\n",
        "k61_11776\t249\t20\t0\r\n",
        "k61_11777\t470\t37\t0\r\n",
        "k61_11778\t215\t13\t0\r\n",
        "k61_11779\t254\t9\t0\r\n",
        "k61_11781\t448\t33\t0\r\n",
        "k61_11782\t551\t53\t0\r\n",
        "k61_11784\t224\t10\t0\r\n",
        "k61_11785\t336\t24\t0\r\n",
        "k61_11786\t215\t10\t0\r\n",
        "k61_11787\t222\t15\t0\r\n",
        "k61_11788\t363\t30\t0\r\n",
        "k61_11790\t324\t20\t0\r\n",
        "k61_11791\t585\t49\t0\r\n",
        "k61_11792\t214\t12\t0\r\n",
        "k61_11793\t491\t23\t0\r\n",
        "k61_11794\t306\t21\t0\r\n",
        "k61_11795\t262\t11\t0\r\n",
        "k61_11796\t201\t12\t0\r\n",
        "k61_11797\t225\t14\t0\r\n",
        "k61_11798\t576\t46\t0\r\n",
        "k61_11800\t744\t63\t0\r\n",
        "k61_11801\t320\t26\t0\r\n",
        "k61_11802\t401\t35\t0\r\n",
        "k61_11803\t621\t59\t0\r\n",
        "k61_11804\t441\t26\t0\r\n",
        "k61_11805\t206\t19\t0\r\n",
        "k61_11806\t399\t40\t0\r\n",
        "k61_11807\t378\t23\t0\r\n",
        "k61_11808\t343\t17\t0\r\n",
        "k61_11809\t202\t5\t0\r\n",
        "k61_11810\t831\t86\t0\r\n",
        "k61_11811\t228\t15\t0\r\n",
        "k61_11812\t853\t66\t0\r\n",
        "k61_11813\t326\t23\t0\r\n",
        "k61_11814\t274\t18\t0\r\n",
        "k61_11815\t203\t10\t0\r\n",
        "k61_11816\t251\t8\t0\r\n",
        "k61_11817\t583\t25\t0\r\n",
        "k61_11818\t442\t39\t0\r\n",
        "k61_11819\t1202\t95\t0\r\n",
        "k61_11820\t349\t29\t0\r\n",
        "k61_11821\t217\t14\t0\r\n",
        "k61_11823\t1259\t112\t0\r\n",
        "k61_11825\t451\t25\t0\r\n",
        "k61_11826\t518\t48\t0\r\n",
        "k61_11827\t1111\t85\t0\r\n",
        "k61_11828\t1206\t66\t0\r\n",
        "k61_11829\t734\t82\t0\r\n",
        "k61_11830\t466\t51\t0\r\n",
        "k61_11831\t1723\t194\t0\r\n",
        "k61_11832\t236\t19\t0\r\n",
        "k61_11833\t244\t16\t0\r\n",
        "k61_11834\t223\t10\t0\r\n",
        "k61_11835\t244\t17\t0\r\n",
        "k61_11836\t201\t8\t0\r\n",
        "k61_11837\t1325\t111\t0\r\n",
        "k61_11838\t219\t5\t0\r\n",
        "k61_11839\t287\t11\t0\r\n",
        "k61_11840\t405\t25\t0\r\n",
        "k61_11842\t1121\t98\t0\r\n",
        "k61_11844\t325\t56\t0\r\n",
        "k61_11845\t440\t30\t0\r\n",
        "k61_11846\t699\t72\t0\r\n",
        "k61_11847\t696\t68\t0\r\n",
        "k61_11849\t1051\t101\t0\r\n",
        "k61_11850\t433\t59\t0\r\n",
        "k61_11851\t452\t46\t0\r\n",
        "k61_11852\t211\t18\t0\r\n",
        "k61_11853\t397\t22\t0\r\n",
        "k61_11854\t333\t20\t0\r\n",
        "k61_11856\t1176\t110\t0\r\n",
        "k61_11857\t211\t8\t0\r\n",
        "k61_11858\t773\t53\t0\r\n",
        "k61_11859\t217\t14\t0\r\n",
        "k61_11860\t262\t24\t0\r\n",
        "k61_11861\t287\t21\t0\r\n",
        "k61_11862\t225\t14\t0\r\n",
        "k61_11863\t635\t51\t0\r\n",
        "k61_11864\t232\t9\t0\r\n",
        "k61_11865\t816\t76\t0\r\n",
        "k61_11866\t364\t28\t0\r\n",
        "k61_11867\t747\t65\t0\r\n",
        "k61_11868\t383\t20\t0\r\n",
        "k61_11869\t660\t60\t0\r\n",
        "k61_11870\t371\t35\t0\r\n",
        "k61_11871\t588\t49\t0\r\n",
        "k61_11872\t211\t20\t0\r\n",
        "k61_11873\t236\t16\t0\r\n",
        "k61_11874\t1449\t131\t0\r\n",
        "k61_11875\t277\t18\t0\r\n",
        "k61_11876\t281\t22\t0\r\n",
        "k61_11877\t266\t10\t0\r\n",
        "k61_11878\t704\t49\t0\r\n",
        "k61_11879\t1060\t92\t0\r\n",
        "k61_11880\t282\t29\t0\r\n",
        "k61_11881\t247\t14\t0\r\n",
        "k61_11882\t441\t29\t0\r\n",
        "k61_11883\t349\t26\t0\r\n",
        "k61_11884\t808\t108\t0\r\n",
        "k61_11885\t323\t18\t0\r\n",
        "k61_11886\t447\t16\t0\r\n",
        "k61_11887\t315\t18\t0\r\n",
        "k61_11888\t201\t11\t0\r\n",
        "k61_11889\t458\t32\t0\r\n",
        "k61_11890\t207\t10\t0\r\n",
        "k61_11892\t3188\t324\t0\r\n",
        "k61_11893\t253\t27\t0\r\n",
        "k61_11895\t214\t5\t0\r\n",
        "k61_11896\t386\t21\t0\r\n",
        "k61_11897\t325\t16\t0\r\n",
        "k61_11899\t467\t42\t0\r\n",
        "k61_11900\t326\t15\t0\r\n",
        "k61_11901\t256\t27\t0\r\n",
        "k61_11902\t200\t13\t0\r\n",
        "k61_11903\t254\t21\t0\r\n",
        "k61_11904\t367\t26\t0\r\n",
        "k61_11905\t441\t36\t0\r\n",
        "k61_11907\t265\t10\t0\r\n",
        "k61_11908\t231\t14\t0\r\n",
        "k61_11909\t388\t28\t0\r\n",
        "k61_11910\t249\t12\t0\r\n",
        "k61_11911\t815\t71\t0\r\n",
        "k61_11912\t429\t27\t0\r\n",
        "k61_11913\t1049\t97\t0\r\n",
        "k61_11914\t254\t21\t0\r\n",
        "k61_11915\t819\t52\t0\r\n",
        "k61_11916\t231\t7\t0\r\n",
        "k61_11917\t228\t15\t0\r\n",
        "k61_11918\t249\t11\t0\r\n",
        "k61_11919\t248\t10\t0\r\n",
        "k61_11920\t253\t14\t0\r\n",
        "k61_11921\t702\t68\t0\r\n",
        "k61_11922\t1258\t115\t0\r\n",
        "k61_11923\t305\t7\t0\r\n",
        "k61_11924\t266\t26\t0\r\n",
        "k61_11925\t357\t40\t0\r\n",
        "k61_11926\t1486\t146\t0\r\n",
        "k61_11927\t316\t26\t0\r\n",
        "k61_11928\t212\t9\t0\r\n",
        "k61_11929\t221\t10\t0\r\n",
        "k61_11930\t1525\t138\t0\r\n",
        "k61_11931\t467\t129\t0\r\n",
        "k61_11932\t348\t13\t0\r\n",
        "k61_11933\t266\t16\t0\r\n",
        "k61_11934\t323\t35\t0\r\n",
        "k61_11937\t270\t17\t0\r\n",
        "k61_11938\t952\t114\t0\r\n",
        "k61_11940\t232\t9\t0\r\n",
        "k61_11941\t320\t24\t0\r\n",
        "k61_11943\t208\t15\t0\r\n",
        "k61_11944\t428\t35\t0\r\n",
        "k61_11945\t808\t78\t0\r\n",
        "k61_11946\t205\t16\t0\r\n",
        "k61_11947\t235\t10\t0\r\n",
        "k61_11948\t200\t7\t0\r\n",
        "k61_11949\t214\t7\t0\r\n",
        "k61_11950\t814\t74\t0\r\n",
        "k61_11951\t628\t67\t0\r\n",
        "k61_11953\t346\t21\t0\r\n",
        "k61_11954\t254\t8\t0\r\n",
        "k61_11955\t285\t15\t0\r\n",
        "k61_11956\t361\t30\t0\r\n",
        "k61_11957\t209\t9\t0\r\n",
        "k61_11958\t235\t19\t0\r\n",
        "k61_11959\t334\t25\t0\r\n",
        "k61_11960\t583\t49\t0\r\n",
        "k61_11962\t260\t13\t0\r\n",
        "k61_11963\t317\t28\t0\r\n",
        "k61_11964\t202\t9\t0\r\n",
        "k61_11965\t206\t8\t0\r\n",
        "k61_11969\t678\t47\t0\r\n",
        "k61_11970\t730\t63\t0\r\n",
        "k61_11971\t451\t40\t0\r\n",
        "k61_11972\t214\t18\t0\r\n",
        "k61_11973\t824\t60\t0\r\n",
        "k61_11974\t570\t57\t0\r\n",
        "k61_11975\t257\t17\t0\r\n",
        "k61_11976\t231\t16\t0\r\n",
        "k61_11977\t961\t68\t0\r\n",
        "k61_11978\t212\t7\t0\r\n",
        "k61_11979\t615\t47\t0\r\n",
        "k61_11980\t201\t12\t0\r\n",
        "k61_11981\t556\t45\t0\r\n",
        "k61_11982\t720\t52\t0\r\n",
        "k61_11983\t336\t16\t0\r\n",
        "k61_11984\t429\t40\t0\r\n",
        "k61_11985\t718\t67\t0\r\n",
        "k61_11986\t257\t22\t0\r\n",
        "k61_11988\t244\t20\t0\r\n",
        "k61_11989\t211\t13\t0\r\n",
        "k61_11990\t509\t37\t0\r\n",
        "k61_11991\t257\t18\t0\r\n",
        "k61_11992\t226\t22\t0\r\n",
        "k61_11993\t564\t49\t0\r\n",
        "k61_11994\t872\t68\t0\r\n",
        "k61_11995\t514\t67\t0\r\n",
        "k61_11996\t965\t89\t0\r\n",
        "k61_11997\t309\t14\t0\r\n",
        "k61_11998\t507\t28\t0\r\n",
        "k61_11999\t834\t103\t0\r\n",
        "k61_12000\t243\t8\t0\r\n",
        "k61_12001\t525\t32\t0\r\n",
        "k61_12002\t360\t26\t0\r\n",
        "k61_12003\t692\t68\t0\r\n",
        "k61_12004\t200\t16\t0\r\n",
        "k61_12005\t514\t42\t0\r\n",
        "k61_12006\t401\t27\t0\r\n",
        "k61_12007\t518\t60\t0\r\n",
        "k61_12008\t226\t19\t0\r\n",
        "k61_12009\t222\t12\t0\r\n",
        "k61_12010\t488\t44\t0\r\n",
        "k61_12011\t289\t33\t0\r\n",
        "k61_12012\t245\t17\t0\r\n",
        "k61_12013\t233\t7\t0\r\n",
        "k61_12014\t407\t38\t0\r\n",
        "k61_12015\t235\t20\t0\r\n",
        "k61_12016\t282\t16\t0\r\n",
        "k61_12017\t231\t19\t0\r\n",
        "k61_12018\t1355\t128\t0\r\n",
        "k61_12019\t307\t24\t0\r\n",
        "k61_12020\t282\t13\t0\r\n",
        "k61_12021\t254\t12\t0\r\n",
        "k61_12022\t1069\t99\t0\r\n",
        "k61_12023\t558\t40\t0\r\n",
        "k61_12024\t214\t9\t0\r\n",
        "k61_12025\t232\t13\t0\r\n",
        "k61_12026\t550\t40\t0\r\n",
        "k61_12027\t207\t34\t0\r\n",
        "k61_12028\t200\t8\t0\r\n",
        "k61_12031\t457\t39\t0\r\n",
        "k61_12032\t258\t13\t0\r\n",
        "k61_12033\t888\t86\t0\r\n",
        "k61_12036\t255\t14\t0\r\n",
        "k61_12037\t640\t44\t0\r\n",
        "k61_12038\t240\t10\t0\r\n",
        "k61_12039\t407\t31\t0\r\n",
        "k61_12040\t369\t31\t0\r\n",
        "k61_12041\t673\t72\t0\r\n",
        "k61_12042\t317\t16\t0\r\n",
        "k61_12043\t236\t10\t0\r\n",
        "k61_12044\t344\t10\t0\r\n",
        "k61_12045\t242\t12\t0\r\n",
        "k61_12046\t270\t13\t0\r\n",
        "k61_12047\t233\t11\t0\r\n",
        "k61_12048\t310\t20\t0\r\n",
        "k61_12049\t560\t22\t0\r\n",
        "k61_12050\t369\t24\t0\r\n",
        "k61_12051\t279\t10\t0\r\n",
        "k61_12052\t255\t12\t0\r\n",
        "k61_12053\t2220\t201\t0\r\n",
        "k61_12054\t335\t23\t0\r\n",
        "k61_12055\t528\t46\t0\r\n",
        "k61_12056\t393\t35\t0\r\n",
        "k61_12057\t308\t19\t0\r\n",
        "k61_12058\t291\t9\t0\r\n",
        "k61_12059\t235\t9\t0\r\n",
        "k61_12060\t513\t35\t0\r\n",
        "k61_12061\t337\t24\t0\r\n",
        "k61_12062\t1952\t159\t0\r\n",
        "k61_12063\t369\t32\t0\r\n",
        "k61_12064\t1748\t231\t0\r\n",
        "k61_12065\t501\t30\t0\r\n",
        "k61_12066\t972\t63\t0\r\n",
        "k61_12068\t406\t18\t0\r\n",
        "k61_12069\t252\t15\t0\r\n",
        "k61_12070\t362\t22\t0\r\n",
        "k61_12071\t217\t12\t0\r\n",
        "k61_12072\t231\t9\t0\r\n",
        "k61_12073\t374\t31\t0\r\n",
        "k61_12074\t610\t61\t0\r\n",
        "k61_12075\t582\t53\t0\r\n",
        "k61_12076\t259\t11\t0\r\n",
        "k61_12078\t225\t15\t0\r\n",
        "k61_12079\t619\t46\t0\r\n",
        "k61_12080\t835\t56\t0\r\n",
        "k61_12082\t802\t61\t0\r\n",
        "k61_12083\t237\t15\t0\r\n",
        "k61_12084\t551\t48\t0\r\n",
        "k61_12085\t223\t10\t0\r\n",
        "k61_12086\t217\t15\t0\r\n",
        "k61_12087\t428\t38\t0\r\n",
        "k61_12088\t1051\t110\t0\r\n",
        "k61_12089\t324\t33\t0\r\n",
        "k61_12090\t271\t27\t0\r\n",
        "k61_12091\t224\t21\t0\r\n",
        "k61_12093\t202\t13\t0\r\n",
        "k61_12094\t254\t10\t0\r\n",
        "k61_12095\t230\t7\t0\r\n",
        "k61_12096\t698\t61\t0\r\n",
        "k61_12097\t734\t68\t0\r\n",
        "k61_12098\t245\t13\t0\r\n",
        "k61_12099\t758\t72\t0\r\n",
        "k61_12100\t1097\t112\t0\r\n",
        "k61_12101\t288\t16\t0\r\n",
        "k61_12102\t253\t14\t0\r\n",
        "k61_12103\t294\t11\t0\r\n",
        "k61_12104\t407\t40\t0\r\n",
        "k61_12105\t1349\t129\t0\r\n",
        "k61_12106\t640\t43\t0\r\n",
        "k61_12107\t217\t14\t0\r\n",
        "k61_12108\t1010\t95\t0\r\n",
        "k61_12109\t959\t90\t0\r\n",
        "k61_12110\t309\t18\t0\r\n",
        "k61_12111\t466\t30\t0\r\n",
        "k61_12112\t227\t7\t0\r\n",
        "k61_12113\t882\t92\t0\r\n",
        "k61_12114\t207\t11\t0\r\n",
        "k61_12115\t229\t17\t0\r\n",
        "k61_12116\t323\t18\t0\r\n",
        "k61_12117\t276\t20\t0\r\n",
        "k61_12118\t944\t859\t0\r\n",
        "k61_12119\t482\t54\t0\r\n",
        "k61_12120\t283\t21\t0\r\n",
        "k61_12121\t218\t16\t0\r\n",
        "k61_12122\t361\t36\t0\r\n",
        "k61_12124\t301\t30\t0\r\n",
        "k61_12126\t529\t50\t0\r\n",
        "k61_12127\t1185\t116\t0\r\n",
        "k61_12128\t256\t16\t0\r\n",
        "k61_12129\t202\t13\t0\r\n",
        "k61_12130\t907\t87\t0\r\n",
        "k61_12131\t224\t15\t0\r\n",
        "k61_12132\t738\t73\t0\r\n",
        "k61_12133\t231\t16\t0\r\n",
        "k61_12134\t897\t81\t0\r\n",
        "k61_12135\t444\t32\t0\r\n",
        "k61_12136\t433\t40\t0\r\n",
        "k61_12137\t200\t17\t0\r\n",
        "k61_12138\t290\t15\t0\r\n",
        "k61_12140\t483\t45\t0\r\n",
        "k61_12141\t568\t57\t0\r\n",
        "k61_12142\t283\t30\t0\r\n",
        "k61_12143\t280\t20\t0\r\n",
        "k61_12144\t405\t25\t0\r\n",
        "k61_12145\t622\t49\t0\r\n",
        "k61_12146\t297\t11\t0\r\n",
        "k61_12147\t320\t22\t0\r\n",
        "k61_12148\t269\t7\t0\r\n",
        "k61_12149\t411\t26\t0\r\n",
        "k61_12150\t659\t41\t0\r\n",
        "k61_12152\t1015\t97\t0\r\n",
        "k61_12153\t200\t10\t0\r\n",
        "k61_12154\t259\t11\t0\r\n",
        "k61_12155\t843\t56\t0\r\n",
        "k61_12156\t559\t53\t0\r\n",
        "k61_12158\t385\t43\t0\r\n",
        "k61_12159\t958\t76\t0\r\n",
        "k61_12160\t808\t71\t0\r\n",
        "k61_12161\t1324\t138\t0\r\n",
        "k61_12162\t338\t19\t0\r\n",
        "k61_12163\t362\t19\t0\r\n",
        "k61_12164\t344\t12\t0\r\n",
        "k61_12165\t551\t47\t0\r\n",
        "k61_12166\t617\t37\t0\r\n",
        "k61_12167\t200\t8\t0\r\n",
        "k61_12168\t447\t49\t0\r\n",
        "k61_12169\t303\t20\t0\r\n",
        "k61_12170\t247\t12\t0\r\n",
        "k61_12171\t375\t26\t0\r\n",
        "k61_12172\t244\t7\t0\r\n",
        "k61_12173\t216\t11\t0\r\n",
        "k61_12174\t397\t17\t0\r\n",
        "k61_12175\t250\t12\t0\r\n",
        "k61_12176\t830\t86\t0\r\n",
        "k61_12177\t200\t9\t0\r\n",
        "k61_12178\t626\t40\t0\r\n",
        "k61_12179\t346\t16\t0\r\n",
        "k61_12180\t2840\t302\t0\r\n",
        "k61_12181\t232\t14\t0\r\n",
        "k61_12182\t235\t10\t0\r\n",
        "k61_12183\t260\t8\t0\r\n",
        "k61_12185\t939\t83\t0\r\n",
        "k61_12186\t217\t17\t0\r\n",
        "k61_12187\t228\t15\t0\r\n",
        "k61_12189\t1957\t177\t0\r\n",
        "k61_12190\t300\t23\t0\r\n",
        "k61_12191\t256\t20\t0\r\n",
        "k61_12192\t430\t27\t0\r\n",
        "k61_12193\t275\t21\t0\r\n",
        "k61_12194\t299\t30\t0\r\n",
        "k61_12195\t292\t21\t0\r\n",
        "k61_12196\t223\t12\t0\r\n",
        "k61_12198\t469\t34\t0\r\n",
        "k61_12199\t673\t71\t0\r\n",
        "k61_12200\t445\t27\t0\r\n",
        "k61_12201\t392\t23\t0\r\n",
        "k61_12202\t403\t30\t0\r\n",
        "k61_12204\t408\t32\t0\r\n",
        "k61_12205\t454\t38\t0\r\n",
        "k61_12206\t208\t24\t0\r\n",
        "k61_12209\t386\t25\t0\r\n",
        "k61_12210\t324\t23\t0\r\n",
        "k61_12211\t353\t28\t0\r\n",
        "k61_12212\t255\t14\t0\r\n",
        "k61_12213\t334\t11\t0\r\n",
        "k61_12214\t1083\t86\t0\r\n",
        "k61_12215\t250\t13\t0\r\n",
        "k61_12216\t312\t18\t0\r\n",
        "k61_12217\t721\t43\t0\r\n",
        "k61_12219\t230\t19\t0\r\n",
        "k61_12220\t213\t15\t0\r\n",
        "k61_12221\t339\t117\t0\r\n",
        "k61_12222\t233\t15\t0\r\n",
        "k61_12223\t229\t15\t0\r\n",
        "k61_12224\t540\t26\t0\r\n",
        "k61_12225\t237\t11\t0\r\n",
        "k61_12226\t1501\t128\t0\r\n",
        "k61_12227\t269\t17\t0\r\n",
        "k61_12228\t718\t64\t0\r\n",
        "k61_12229\t453\t26\t0\r\n",
        "k61_12230\t1114\t122\t0\r\n",
        "k61_12231\t726\t53\t0\r\n",
        "k61_12232\t302\t15\t0\r\n",
        "k61_12233\t480\t38\t0\r\n",
        "k61_12234\t683\t51\t0\r\n",
        "k61_12235\t462\t29\t0\r\n",
        "k61_12236\t566\t48\t0\r\n",
        "k61_12238\t277\t18\t0\r\n",
        "k61_12239\t593\t33\t0\r\n",
        "k61_12240\t392\t41\t0\r\n",
        "k61_12241\t241\t10\t0\r\n",
        "k61_12242\t1973\t221\t0\r\n",
        "k61_12244\t524\t39\t0\r\n",
        "k61_12245\t1273\t88\t0\r\n",
        "k61_12246\t704\t513\t0\r\n",
        "k61_12247\t277\t21\t0\r\n",
        "k61_12248\t355\t30\t0\r\n",
        "k61_12249\t891\t67\t0\r\n",
        "k61_12250\t531\t59\t0\r\n",
        "k61_12251\t200\t9\t0\r\n",
        "k61_12252\t285\t15\t0\r\n",
        "k61_12253\t258\t19\t0\r\n",
        "k61_12254\t287\t11\t0\r\n",
        "k61_12255\t631\t62\t0\r\n",
        "k61_12256\t223\t11\t0\r\n",
        "k61_12257\t803\t70\t0\r\n",
        "k61_12258\t226\t11\t0\r\n",
        "k61_12259\t333\t15\t0\r\n",
        "k61_12261\t793\t56\t0\r\n",
        "k61_12262\t313\t16\t0\r\n",
        "k61_12263\t228\t21\t0\r\n",
        "k61_12264\t283\t8\t0\r\n",
        "k61_12265\t417\t39\t0\r\n",
        "k61_12266\t1225\t169\t0\r\n",
        "k61_12267\t201\t7\t0\r\n",
        "k61_12268\t314\t8\t0\r\n",
        "k61_12269\t228\t9\t0\r\n",
        "k61_12271\t221\t11\t0\r\n",
        "k61_12272\t416\t38\t0\r\n",
        "k61_12274\t250\t14\t0\r\n",
        "k61_12275\t4499\t30833\t0\r\n",
        "k61_12276\t283\t22\t0\r\n",
        "k61_12278\t1053\t75\t0\r\n",
        "k61_12280\t300\t10\t0\r\n",
        "k61_12281\t219\t20\t0\r\n",
        "k61_12282\t577\t44\t0\r\n",
        "k61_12283\t262\t12\t0\r\n",
        "k61_12284\t332\t25\t0\r\n",
        "k61_12285\t300\t9\t0\r\n",
        "k61_12286\t568\t48\t0\r\n",
        "k61_12287\t212\t25\t0\r\n",
        "k61_12288\t250\t12\t0\r\n",
        "k61_12289\t228\t13\t0\r\n",
        "k61_12290\t469\t31\t0\r\n",
        "k61_12291\t430\t46\t0\r\n",
        "k61_12292\t228\t18\t0\r\n",
        "k61_12293\t201\t14\t0\r\n",
        "k61_12294\t359\t14\t0\r\n",
        "k61_12295\t436\t33\t0\r\n",
        "k61_12296\t251\t20\t0\r\n",
        "k61_12297\t302\t13\t0\r\n",
        "k61_12300\t229\t12\t0\r\n",
        "k61_12301\t202\t11\t0\r\n",
        "k61_12302\t1203\t86\t0\r\n",
        "k61_12305\t276\t16\t0\r\n",
        "k61_12306\t2536\t1932\t0\r\n",
        "k61_12307\t239\t11\t0\r\n",
        "k61_12308\t247\t11\t0\r\n",
        "k61_12309\t454\t33\t0\r\n",
        "k61_12312\t340\t17\t0\r\n",
        "k61_12313\t308\t29\t0\r\n",
        "k61_12315\t448\t46\t0\r\n",
        "k61_12317\t203\t16\t0\r\n",
        "k61_12318\t333\t27\t0\r\n",
        "k61_12319\t348\t152\t0\r\n",
        "k61_12321\t630\t61\t0\r\n",
        "k61_12323\t453\t39\t0\r\n",
        "k61_12324\t497\t37\t0\r\n",
        "k61_12326\t213\t10\t0\r\n",
        "k61_12328\t215\t22\t0\r\n",
        "k61_12330\t415\t38\t0\r\n",
        "k61_12332\t273\t14\t0\r\n",
        "k61_12337\t207\t16\t0\r\n",
        "k61_12340\t639\t53\t0\r\n",
        "k61_12343\t204\t11\t0\r\n",
        "k61_12345\t480\t37\t0\r\n",
        "k61_12346\t227\t10\t0\r\n",
        "k61_12347\t835\t67\t0\r\n",
        "k61_12348\t202\t10\t0\r\n",
        "k61_12349\t204\t10\t0\r\n",
        "k61_12350\t310\t15\t0\r\n",
        "k61_12351\t324\t21\t0\r\n",
        "k61_12352\t506\t42\t0\r\n",
        "k61_12353\t292\t15\t0\r\n",
        "k61_12354\t269\t18\t0\r\n",
        "k61_12355\t489\t36\t0\r\n",
        "k61_12356\t675\t54\t0\r\n",
        "k61_12357\t712\t47\t0\r\n",
        "k61_12358\t364\t24\t0\r\n",
        "k61_12359\t689\t62\t0\r\n",
        "k61_12361\t373\t26\t0\r\n",
        "k61_12362\t210\t14\t0\r\n",
        "k61_12363\t486\t36\t0\r\n",
        "k61_12364\t1232\t111\t0\r\n",
        "k61_12365\t348\t19\t0\r\n",
        "k61_12366\t459\t20\t0\r\n",
        "k61_12367\t898\t99\t0\r\n",
        "k61_12368\t576\t44\t0\r\n",
        "k61_12369\t223\t14\t0\r\n",
        "k61_12372\t210\t12\t0\r\n",
        "k61_12373\t602\t69\t0\r\n",
        "k61_12374\t201\t17\t0\r\n",
        "k61_12376\t787\t77\t0\r\n",
        "k61_12377\t280\t18\t0\r\n",
        "k61_12378\t328\t23\t0\r\n",
        "k61_12379\t513\t67\t0\r\n",
        "k61_12380\t288\t12\t0\r\n",
        "k61_12381\t245\t13\t0\r\n",
        "k61_12382\t523\t45\t0\r\n",
        "k61_12383\t259\t20\t0\r\n",
        "k61_12386\t772\t63\t0\r\n",
        "k61_12387\t211\t13\t0\r\n",
        "k61_12388\t283\t18\t0\r\n",
        "k61_12389\t234\t16\t0\r\n",
        "k61_12391\t378\t30\t0\r\n",
        "k61_12392\t1149\t103\t0\r\n",
        "k61_12393\t208\t16\t0\r\n",
        "k61_12394\t478\t22\t0\r\n",
        "k61_12395\t457\t39\t0\r\n",
        "k61_12396\t505\t52\t0\r\n",
        "k61_12397\t228\t14\t0\r\n",
        "k61_12398\t625\t63\t0\r\n",
        "k61_12399\t218\t11\t0\r\n",
        "k61_12400\t338\t31\t0\r\n",
        "k61_12401\t225\t8\t0\r\n",
        "k61_12402\t355\t23\t0\r\n",
        "k61_12403\t260\t7\t0\r\n",
        "k61_12404\t541\t56\t0\r\n",
        "k61_12405\t314\t21\t0\r\n",
        "k61_12406\t1403\t183\t0\r\n",
        "k61_12407\t261\t15\t0\r\n",
        "k61_12408\t414\t41\t0\r\n",
        "k61_12409\t667\t60\t0\r\n",
        "k61_12410\t323\t14\t0\r\n",
        "k61_12411\t226\t15\t0\r\n",
        "k61_12412\t570\t52\t0\r\n",
        "k61_12413\t234\t14\t0\r\n",
        "k61_12414\t238\t19\t0\r\n",
        "k61_12415\t250\t9\t0\r\n",
        "k61_12416\t236\t11\t0\r\n",
        "k61_12417\t441\t36\t0\r\n",
        "k61_12418\t533\t45\t0\r\n",
        "k61_12419\t287\t17\t0\r\n",
        "k61_12420\t444\t39\t0\r\n",
        "k61_12421\t260\t10\t0\r\n",
        "k61_12422\t232\t8\t0\r\n",
        "k61_12423\t653\t65\t0\r\n",
        "k61_12424\t586\t37\t0\r\n",
        "k61_12425\t902\t81\t0\r\n",
        "k61_12426\t364\t27\t0\r\n",
        "k61_12427\t360\t21\t0\r\n",
        "k61_12428\t236\t9\t0\r\n",
        "k61_12430\t357\t15\t0\r\n",
        "k61_12431\t326\t27\t0\r\n",
        "k61_12432\t401\t24\t0\r\n",
        "k61_12436\t232\t8\t0\r\n",
        "k61_12438\t397\t33\t0\r\n",
        "k61_12439\t903\t94\t0\r\n",
        "k61_12440\t545\t52\t0\r\n",
        "k61_12441\t353\t30\t0\r\n",
        "k61_12442\t376\t34\t0\r\n",
        "k61_12443\t305\t17\t0\r\n",
        "k61_12444\t221\t26\t0\r\n",
        "k61_12445\t288\t22\t0\r\n",
        "k61_12446\t247\t10\t0\r\n",
        "k61_12447\t848\t98\t0\r\n",
        "k61_12448\t472\t53\t0\r\n",
        "k61_12449\t376\t30\t0\r\n",
        "k61_12450\t208\t19\t0\r\n",
        "k61_12451\t267\t22\t0\r\n",
        "k61_12452\t220\t14\t0\r\n",
        "k61_12453\t361\t33\t0\r\n",
        "k61_12455\t237\t8\t0\r\n",
        "k61_12456\t573\t41\t0\r\n",
        "k61_12457\t256\t13\t0\r\n",
        "k61_12458\t368\t30\t0\r\n",
        "k61_12459\t629\t35\t0\r\n",
        "k61_12460\t231\t11\t0\r\n",
        "k61_12461\t1402\t124\t0\r\n",
        "k61_12462\t297\t16\t0\r\n",
        "k61_12463\t257\t7\t0\r\n",
        "k61_12464\t530\t39\t0\r\n",
        "k61_12465\t207\t23\t0\r\n",
        "k61_12466\t406\t30\t0\r\n",
        "k61_12467\t786\t61\t0\r\n",
        "k61_12468\t204\t6\t0\r\n",
        "k61_12469\t269\t23\t0\r\n",
        "k61_12470\t631\t42\t0\r\n",
        "k61_12471\t220\t14\t0\r\n",
        "k61_12472\t472\t47\t0\r\n",
        "k61_12473\t1016\t95\t0\r\n",
        "k61_12474\t359\t18\t0\r\n",
        "k61_12475\t673\t50\t0\r\n",
        "k61_12476\t1740\t150\t0\r\n",
        "k61_12477\t693\t59\t0\r\n",
        "k61_12478\t343\t31\t0\r\n",
        "k61_12479\t296\t21\t0\r\n",
        "k61_12480\t233\t92\t0\r\n",
        "k61_12481\t497\t48\t0\r\n",
        "k61_12482\t540\t26\t0\r\n",
        "k61_12483\t758\t62\t0\r\n",
        "k61_12484\t274\t21\t0\r\n",
        "k61_12485\t738\t68\t0\r\n",
        "k61_12486\t302\t32\t0\r\n",
        "k61_12487\t1361\t199\t0\r\n",
        "k61_12488\t268\t10\t0\r\n",
        "k61_12489\t295\t24\t0\r\n",
        "k61_12490\t331\t20\t0\r\n",
        "k61_12491\t297\t16\t0\r\n",
        "k61_12492\t232\t15\t0\r\n",
        "k61_12493\t338\t20\t0\r\n",
        "k61_12494\t275\t22\t0\r\n",
        "k61_12495\t210\t11\t0\r\n",
        "k61_12496\t479\t20\t0\r\n",
        "k61_12497\t362\t25\t0\r\n",
        "k61_12498\t549\t61\t0\r\n",
        "k61_12499\t328\t30\t0\r\n",
        "k61_12500\t475\t26\t0\r\n",
        "k61_12501\t835\t288\t0\r\n",
        "k61_12504\t1083\t93\t0\r\n",
        "k61_12505\t355\t41\t0\r\n",
        "k61_12506\t764\t83\t0\r\n",
        "k61_12507\t529\t56\t0\r\n",
        "k61_12508\t296\t25\t0\r\n",
        "k61_12509\t555\t44\t0\r\n",
        "k61_12510\t300\t31\t0\r\n",
        "k61_12511\t462\t32\t0\r\n",
        "k61_12512\t546\t58\t0\r\n",
        "k61_12513\t460\t37\t0\r\n",
        "k61_12514\t751\t79\t0\r\n",
        "k61_12515\t263\t23\t0\r\n",
        "k61_12516\t386\t21\t0\r\n",
        "k61_12517\t362\t20\t0\r\n",
        "k61_12518\t238\t10\t0\r\n",
        "k61_12519\t280\t15\t0\r\n",
        "k61_12520\t568\t50\t0\r\n",
        "k61_12521\t600\t55\t0\r\n",
        "k61_12522\t1122\t121\t0\r\n",
        "k61_12523\t530\t38\t0\r\n",
        "k61_12524\t337\t23\t0\r\n",
        "k61_12525\t370\t25\t0\r\n",
        "k61_12526\t687\t61\t0\r\n",
        "k61_12527\t693\t50\t0\r\n",
        "k61_12528\t297\t19\t0\r\n",
        "k61_12529\t439\t33\t0\r\n",
        "k61_12530\t211\t8\t0\r\n",
        "k61_12532\t204\t10\t0\r\n",
        "k61_12533\t237\t13\t0\r\n",
        "k61_12535\t270\t29\t0\r\n",
        "k61_12536\t513\t51\t0\r\n",
        "k61_12537\t824\t77\t0\r\n",
        "k61_12538\t659\t45\t0\r\n",
        "k61_12539\t746\t67\t0\r\n",
        "k61_12540\t203\t5\t0\r\n",
        "k61_12541\t218\t13\t0\r\n",
        "k61_12542\t1422\t126\t0\r\n",
        "k61_12543\t200\t8\t0\r\n",
        "k61_12544\t822\t63\t0\r\n",
        "k61_12545\t279\t18\t0\r\n",
        "k61_12546\t757\t62\t0\r\n",
        "k61_12547\t225\t16\t0\r\n",
        "k61_12548\t1031\t112\t0\r\n",
        "k61_12549\t234\t13\t0\r\n",
        "k61_12550\t537\t45\t0\r\n",
        "k61_12551\t260\t27\t0\r\n",
        "k61_12552\t565\t61\t0\r\n",
        "k61_12553\t219\t6\t0\r\n",
        "k61_12554\t563\t46\t0\r\n",
        "k61_12555\t216\t15\t0\r\n",
        "k61_12556\t774\t60\t0\r\n",
        "k61_12557\t210\t14\t0\r\n",
        "k61_12558\t325\t26\t0\r\n",
        "k61_12559\t377\t14\t0\r\n",
        "k61_12560\t1034\t82\t0\r\n",
        "k61_12561\t414\t45\t0\r\n",
        "k61_12563\t611\t69\t0\r\n",
        "k61_12564\t256\t20\t0\r\n",
        "k61_12566\t220\t8\t0\r\n",
        "k61_12567\t433\t30\t0\r\n",
        "k61_12568\t517\t55\t0\r\n",
        "k61_12569\t237\t12\t0\r\n",
        "k61_12571\t522\t40\t0\r\n",
        "k61_12572\t312\t18\t0\r\n",
        "k61_12573\t329\t20\t0\r\n",
        "k61_12574\t246\t7\t0\r\n",
        "k61_12575\t501\t45\t0\r\n",
        "k61_12576\t406\t22\t0\r\n",
        "k61_12578\t243\t12\t0\r\n",
        "k61_12580\t1213\t104\t0\r\n",
        "k61_12581\t263\t21\t0\r\n",
        "k61_12582\t408\t56\t0\r\n",
        "k61_12584\t562\t41\t0\r\n",
        "k61_12586\t1277\t98\t0\r\n",
        "k61_12587\t222\t9\t0\r\n",
        "k61_12588\t521\t44\t0\r\n",
        "k61_12589\t223\t16\t0\r\n",
        "k61_12590\t851\t77\t0\r\n",
        "k61_12591\t280\t110\t0\r\n",
        "k61_12592\t223\t6\t0\r\n",
        "k61_12593\t202\t18\t0\r\n",
        "k61_12595\t280\t68\t0\r\n",
        "k61_12596\t430\t30\t0\r\n",
        "k61_12597\t680\t80\t0\r\n",
        "k61_12598\t338\t20\t0\r\n",
        "k61_12599\t1126\t117\t0\r\n",
        "k61_12600\t310\t15\t0\r\n",
        "k61_12601\t266\t14\t0\r\n",
        "k61_12602\t2361\t206\t0\r\n",
        "k61_12603\t333\t24\t0\r\n",
        "k61_12604\t700\t62\t0\r\n",
        "k61_12605\t519\t50\t0\r\n",
        "k61_12606\t257\t26\t0\r\n",
        "k61_12607\t266\t23\t0\r\n",
        "k61_12608\t249\t16\t0\r\n",
        "k61_12610\t301\t14\t0\r\n",
        "k61_12611\t1380\t139\t0\r\n",
        "k61_12612\t402\t36\t0\r\n",
        "k61_12613\t315\t17\t0\r\n",
        "k61_12614\t284\t14\t0\r\n",
        "k61_12616\t214\t15\t0\r\n",
        "k61_12617\t297\t22\t0\r\n",
        "k61_12618\t346\t25\t0\r\n",
        "k61_12619\t222\t10\t0\r\n",
        "k61_12620\t637\t71\t0\r\n",
        "k61_12621\t954\t82\t0\r\n",
        "k61_12622\t1006\t81\t0\r\n",
        "k61_12623\t290\t11\t0\r\n",
        "k61_12624\t420\t21\t0\r\n",
        "k61_12625\t210\t11\t0\r\n",
        "k61_12626\t544\t67\t0\r\n",
        "k61_12627\t359\t18\t0\r\n",
        "k61_12628\t2526\t274\t0\r\n",
        "k61_12629\t280\t18\t0\r\n",
        "k61_12630\t271\t19\t0\r\n",
        "k61_12631\t293\t20\t0\r\n",
        "k61_12632\t204\t8\t0\r\n",
        "k61_12633\t255\t11\t0\r\n",
        "k61_12635\t213\t9\t0\r\n",
        "k61_12637\t405\t23\t0\r\n",
        "k61_12638\t290\t12\t0\r\n",
        "k61_12639\t631\t64\t0\r\n",
        "k61_12640\t579\t42\t0\r\n",
        "k61_12641\t243\t23\t0\r\n",
        "k61_12642\t373\t21\t0\r\n",
        "k61_12643\t212\t10\t0\r\n",
        "k61_12644\t418\t38\t0\r\n",
        "k61_12645\t255\t27\t0\r\n",
        "k61_12646\t474\t40\t0\r\n",
        "k61_12647\t253\t24\t0\r\n",
        "k61_12648\t494\t40\t0\r\n",
        "k61_12649\t438\t35\t0\r\n",
        "k61_12650\t231\t15\t0\r\n",
        "k61_12651\t594\t33\t0\r\n",
        "*\t0\t0\t298465\r\n"
       ]
      }
     ],
     "prompt_number": 36
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 10. Annotating the assembled contigs\n",
      "\n",
      "Sequencing is often used to determine \"who\" and/or \"what\" is in your sample.  In our case, we know that the HMP mock community should orignate from a set of genomes (which we actually downlaoded above).  One of the most popular tools of comparing an unknown sequence to a known reference is The Basic Local Alignment Search Tool (or BLAST).  To identify the origin of our contigs, we will align assembled contigs to the genomes used in the HMP mock community.\n",
      "\n",
      "The first thing we will do is download the BLAST software.  Given the increasing volume of sequencing datasets, one may also consider new tools for more efficient annotation are now available such as Diamond (https://github.com/bbuchfink/diamond/, http://dx.doi.org/10.1038/nmeth.3176). "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-x64-linux.tar.gz\n",
      "!tar -xvf ncbi-blast-2.2.30+-x64-linux.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 14:20:56--  ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-x64-linux.tar.gz\r\n",
        "           => \u2018ncbi-blast-2.2.30+-x64-linux.tar.gz\u2019\r\n",
        "Resolving ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)... 130.14.250.12, 2607:f220:41e:250::11\r\n",
        "Connecting to ftp.ncbi.nlm.nih.gov (ftp.ncbi.nlm.nih.gov)|130.14.250.12|:21... connected.\r\n",
        "Logging in as anonymous ... Logged in!\r\n",
        "==> SYST ... done.    ==> PWD ... done.\r\n",
        "==> TYPE I ... done.  ==> CWD (1) /blast/executables/blast+/2.2.30 ... done.\r\n",
        "==> SIZE ncbi-blast-2.2.30+-x64-linux.tar.gz ... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "172818286\r\n",
        "==> PASV ... done.    ==> RETR ncbi-blast-2.2.30+-x64-linux.tar.gz ... done.\r\n",
        "Length: 172818286 (165M) (unauthoritative)\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "11% [===>                                   ] 19,799,762  87.3MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "33% [===========>                           ] 57,513,952   132MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "57% [=====================>                 ] 98,741,750   153MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "82% [===============================>       ] 142,527,990  166MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "100%[======================================>] 172,818,286  164MB/s   in 1.0s   \r\n",
        "\r\n",
        "2015-06-26 14:20:57 (164 MB/s) - \u2018ncbi-blast-2.2.30+-x64-linux.tar.gz\u2019 saved [172818286]\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/\r\n",
        "ncbi-blast-2.2.30+/LICENSE\r\n",
        "ncbi-blast-2.2.30+/ChangeLog\r\n",
        "ncbi-blast-2.2.30+/ncbi_package_info\r\n",
        "ncbi-blast-2.2.30+/doc/\r\n",
        "ncbi-blast-2.2.30+/doc/README.txt\r\n",
        "ncbi-blast-2.2.30+/README\r\n",
        "ncbi-blast-2.2.30+/bin/\r\n",
        "ncbi-blast-2.2.30+/bin/tblastn\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blastdbcheck\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blast_formatter\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/deltablast\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/tblastx\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blastp\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/makeblastdb\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blastn\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/windowmasker\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blastdbcmd\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/makembindex\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/makeprofiledb\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/update_blastdb.pl\r\n",
        "ncbi-blast-2.2.30+/bin/blastdb_aliastool\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/dustmasker\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/psiblast\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/rpsblast\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/rpstblastn\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/convert2blastmask\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/blastx\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/segmasker\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ncbi-blast-2.2.30+/bin/legacy_blast.pl\r\n"
       ]
      }
     ],
     "prompt_number": 40
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Now, we will make a searchable database for the BLAST software.  First, we'll concatenate all the genomes in the genomes directory to one file."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!cat genomes/*fa >> all-genomes.fa\n",
      "!ncbi-blast-2.2.30+/bin/makeblastdb -in all-genomes.fa -dbtype nucl -out all-genomes\n",
      "!ncbi-blast-2.2.30+/bin/blastn -db all-genomes -query megahit_assembly/final.contigs.fa -outfmt 6 -out contigs.x.all-genomes.blastnout"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "\r\n",
        "Building a new DB, current time: 06/26/2015 14:21:06\r\n",
        "New DB name:   all-genomes\r\n",
        "New DB title:  all-genomes.fa\r\n",
        "Sequence type: Nucleotide\r\n",
        "Keep Linkouts: T\r\n",
        "Keep MBits: T\r\n",
        "Maximum file size: 1000000000B\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Adding sequences from FASTA; added 60 sequences in 1.84624 seconds.\r\n"
       ]
      }
     ],
     "prompt_number": 41
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "The above command aligns each query (each sequence in the assembled final.contings.fa file) with each sequence (e.g., genome in all-genomes.fa).  The -outfmt tells the program to save the results in a tab-delimited format in the -out file contigs.x.all-genomes.blastnout.\n",
      "\n",
      "Let's take a look at the first 10 lines of that file.  You'll see the query (contig) and the hit (genome) followed by the percent identity, the length of alignment, mismatch counts, gap open counts, query start position, query end position, subject start position, subject end position, E-value, and bit score. "
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head -n 10 contigs.x.all-genomes.blastnout"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "k61_2\tgi|27466918|ref|NC_004461.1|\t100.00\t218\t0\t0\t1\t218\t1986675\t1986892\t5e-112\t  403\r\n",
        "k61_2\tgi|27466918|ref|NC_004461.1|\t100.00\t218\t0\t0\t1\t218\t1986675\t1986892\t5e-112\t  403\r\n",
        "k61_3\tgi|24378532|ref|NC_004350.1|\t100.00\t206\t0\t0\t1\t206\t1898492\t1898697\t2e-105\t  381\r\n",
        "k61_3\tgi|24378532|ref|NC_004350.1|\t100.00\t206\t0\t0\t1\t206\t1898492\t1898697\t2e-105\t  381\r\n",
        "k61_4\tgi|32470532|ref|NC_005004.1|\t95.31\t256\t12\t0\t1\t256\t10969\t10714\t4e-113\t  407\r\n",
        "k61_4\tgi|32470532|ref|NC_005004.1|\t95.31\t256\t12\t0\t1\t256\t10969\t10714\t4e-113\t  407\r\n",
        "k61_4\tgi|32470555|ref|NC_005005.1|\t92.58\t256\t19\t0\t1\t256\t10016\t10271\t2e-101\t  368\r\n",
        "k61_4\tgi|32470555|ref|NC_005005.1|\t92.58\t256\t19\t0\t1\t256\t10016\t10271\t2e-101\t  368\r\n",
        "k61_5\tgi|24378532|ref|NC_004350.1|\t100.00\t258\t0\t0\t1\t258\t928208\t928465\t3e-134\t  477\r\n",
        "k61_5\tgi|24378532|ref|NC_004350.1|\t100.00\t258\t0\t0\t1\t258\t928208\t928465\t3e-134\t  477\r\n"
       ]
      }
     ],
     "prompt_number": 42
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Depending on your scientific question, it may be of more interest to have open reading frames (ORFs) annotated rather than contig sequences.  In this case, there exist multiple ORF callers (e.g., FragGeneScan, http://nar.oxfordjournals.org/content/early/2010/08/29/nar.gkq747.abstract and Metagene, http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1636498/) that can be used.  We can call ORFs from our contigs using FragGeneScan.  We will download, install, and then call ORFs from our contigs as follows:"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget http://downloads.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz\n",
      "!tar -xvf FragGeneScan1.19.tar.gz"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2015-06-26 14:21:15--  http://downloads.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz\r\n",
        "Resolving downloads.sourceforge.net (downloads.sourceforge.net)... 216.34.181.59\r\n",
        "Connecting to downloads.sourceforge.net (downloads.sourceforge.net)|216.34.181.59|:80... connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "302 Found\r\n",
        "Location: http://iweb.dl.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz [following]\r\n",
        "--2015-06-26 14:21:15--  http://iweb.dl.sourceforge.net/project/fraggenescan/FragGeneScan1.19.tar.gz\r\n",
        "Resolving iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)... 70.38.0.134, 2607:f748:10:12::5f:2\r\n",
        "Connecting to iweb.dl.sourceforge.net (iweb.dl.sourceforge.net)|70.38.0.134|:80... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "connected.\r\n",
        "HTTP request sent, awaiting response... 200 OK\r\n",
        "Length: 11371331 (11M) [application/x-gzip]\r\n",
        "Saving to: \u2018FragGeneScan1.19.tar.gz\u2019\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 3% [>                                      ] 406,136     1.86MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 7% [=>                                     ] 836,688     1.91MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "11% [===>                                   ] 1,289,912   1.96MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "12% [===>                                   ] 1,420,232   1.45MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [====>                                  ] 1,731,056   1.44MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [====>                                  ] 1,735,896   1.19MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "17% [=====>                                 ] 1,980,608   1.18MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "18% [======>                                ] 2,091,608   1.04MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "20% [=======>                               ] 2,357,088   1.06MB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "21% [=======>                               ] 2,455,552    975KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "23% [=======>                               ] 2,616,392    936KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "24% [========>                              ] 2,813,320    934KB/s             "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "26% [=========>                             ] 3,027,128    879KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "28% [==========>                            ] 3,223,104    881KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "29% [==========>                            ] 3,379,488    873KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 3,559,040    871KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 3,592,344    820KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "33% [===========>                           ] 3,780,584    784KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "34% [============>                          ] 3,939,864    745KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "36% [=============>                         ] 4,144,984    706KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "38% [=============>                         ] 4,346,752    685KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "39% [==============>                        ] 4,479,968    629KB/s  eta 9s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "40% [==============>                        ] 4,650,832    663KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "42% [===============>                       ] 4,843,416    658KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "42% [===============>                       ] 4,844,864    640KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "44% [================>                      ] 5,056,272    624KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "46% [=================>                     ] 5,287,952    652KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "47% [=================>                     ] 5,453,976    647KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "49% [==================>                    ] 5,613,752    664KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "51% [==================>                    ] 5,812,128    664KB/s  eta 8s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "52% [===================>                   ] 5,972,360    634KB/s  eta 7s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "54% [====================>                  ] 6,204,040    650KB/s  eta 7s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "56% [====================>                  ] 6,391,328    702KB/s  eta 7s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "56% [=====================>                 ] 6,452,144    651KB/s  eta 7s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "58% [=====================>                 ] 6,669,344    662KB/s  eta 7s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 6,760,568    603KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "61% [=======================>               ] 7,008,176    655KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "61% [=======================>               ] 7,017,816    610KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "64% [=======================>               ] 7,280,400    630KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "65% [========================>              ] 7,465,744    676KB/s  eta 6s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "67% [=========================>             ] 7,724,936    684KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "70% [==========================>            ] 8,017,432    744KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "73% [===========================>           ] 8,362,056    791KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "74% [===========================>           ] 8,438,800    755KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "75% [============================>          ] 8,625,592    757KB/s  eta 5s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "76% [============================>          ] 8,719,712    724KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "77% [=============================>         ] 8,868,856    767KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "79% [==============================>        ] 9,051,304    749KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "80% [==============================>        ] 9,191,760    709KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "82% [===============================>       ] 9,391,088    763KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "83% [===============================>       ] 9,497,288    735KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "84% [===============================>       ] 9,595,752    733KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "86% [================================>      ] 9,792,680    721KB/s  eta 3s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "87% [=================================>     ] 9,951,960    766KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "88% [=================================>     ] 10,028,208   690KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "90% [==================================>    ] 10,266,176   700KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "91% [==================================>    ] 10,448,624   686KB/s  eta 2s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "93% [===================================>   ] 10,597,272   596KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "95% [====================================>  ] 10,825,104   586KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "96% [====================================>  ] 11,010,448   635KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "98% [=====================================> ] 11,249,368   644KB/s  eta 1s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "100%[======================================>] 11,371,331   674KB/s   in 15s    \r\n",
        "\r\n",
        "2015-06-26 14:21:30 (738 KB/s) - \u2018FragGeneScan1.19.tar.gz\u2019 saved [11371331/11371331]\r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/\r\n",
        "FragGeneScan1.19/post_process.pl\r\n",
        "FragGeneScan1.19/run_FragGeneScan.pl\r\n",
        "FragGeneScan1.19/hmm.h\r\n",
        "FragGeneScan1.19/README\r\n",
        "FragGeneScan1.19/hmm_lib.c\r\n",
        "FragGeneScan1.19/Makefile\r\n",
        "FragGeneScan1.19/run_hmm.c\r\n",
        "FragGeneScan1.19/example/\r\n",
        "FragGeneScan1.19/example/NC_000913.test.454.5.gff\r\n",
        "FragGeneScan1.19/example/NC_000913.test.ffn\r\n",
        "FragGeneScan1.19/example/NC_000913.test.out\r\n",
        "FragGeneScan1.19/example/NC_000913.test.gff\r\n",
        "FragGeneScan1.19/example/NC_000913-454.test.gff\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/example/NC_000913.test.454.5.out\r\n",
        "FragGeneScan1.19/example/NC_000913-454.test.out\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/example/NC_000913.test.454.5.faa\r\n",
        "FragGeneScan1.19/example/NC_000913-454.fna\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/example/NC_000913.fna\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/example/NC_000913.test.454.5.ffn\r\n",
        "FragGeneScan1.19/example/NC_000913-454.test.ffn\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/example/NC_000913.test.faa\r\n",
        "FragGeneScan1.19/example/NC_000913-454.test.faa\r\n",
        "FragGeneScan1.19/util_lib.h\r\n",
        "FragGeneScan1.19/util_lib.c\r\n",
        "FragGeneScan1.19/FGS_gff.py\r\n",
        "FragGeneScan1.19/train/\r\n",
        "FragGeneScan1.19/train/illumina_10\r\n",
        "FragGeneScan1.19/train/454_5\r\n",
        "FragGeneScan1.19/train/pwm\r\n",
        "FragGeneScan1.19/train/454_30\r\n",
        "FragGeneScan1.19/train/rgene\r\n",
        "FragGeneScan1.19/train/stop1\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "FragGeneScan1.19/train/noncoding\r\n",
        "FragGeneScan1.19/train/complete\r\n",
        "FragGeneScan1.19/train/start\r\n",
        "FragGeneScan1.19/train/454_10\r\n",
        "FragGeneScan1.19/train/start1\r\n",
        "FragGeneScan1.19/train/illumina_5\r\n",
        "FragGeneScan1.19/train/sanger_10\r\n",
        "FragGeneScan1.19/train/gene\r\n",
        "FragGeneScan1.19/train/illumina_1\r\n",
        "FragGeneScan1.19/train/stop\r\n",
        "FragGeneScan1.19/train/sanger_5\r\n"
       ]
      }
     ],
     "prompt_number": 43
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!bash fraggenescan-install.sh"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "rm -rf *.o FragGeneScan* *~\r\n",
        "gcc    -c -o util_lib.o util_lib.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc    -c -o hmm_lib.o hmm_lib.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc    -c -o run_hmm.o run_hmm.c\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "gcc  -O3 -o FragGeneScan util_lib.o hmm_lib.o run_hmm.o  -lm -lpthread\r\n"
       ]
      }
     ],
     "prompt_number": 44
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "We will run FragGeneScan on the assembled contigs, assuming that it fits the training profile of a \"complete\" genome sequence (in their documentaion, this equals complete genomic sequences or short sequence reads without sequencing error)."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!FragGeneScan1.19/FragGeneScan -s megahit_assembly/final.contigs.fa -o final.contigs.orfs.fa -w 1 -t complete "
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "no. of seqs: 11345\r\n"
       ]
      }
     ],
     "prompt_number": 45
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "The ORFs called are contained as FASTA files in final.contigs.orfs.fa.faa (amino acids) and final.contigs.orfs.fa.ffn (nucleotides).  You can annotate these against a database of your choice just as described for the contigs above."
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "### 11. Going forward"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Now you have all the information you need to produce the following information:\n",
      "\n",
      "* Sequence Abundance Information:  Sequence (e.g., contig) and abundance (e.g., number of mapped reads)\n",
      "* Sequence Annotation Information:  Sequence (eg., contig) and NCBI genome\n",
      "\n",
      "You'll note that this is similar to 16S rRNA amplicon analysis where you'd have an OTU abundance table and OTU best hit annotations.  For metagenomic analysis, this information takes you into further analysis and visualization packages like PhyloSeq in R (http://joey711.github.io/phyloseq/)."
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "Once you run through this tutorial on this workbook, a good exercise would be to try to run the assembly outside the IPython Notebook environment.  To do so, you can log into your EC2 instance, navigate to the directory where this data is stored (cd /mnt/frontiers-review-2015), and you could run every command in this notebook on the command line (with the exception of the \"!\" at the beginning of each command in the notebook.  Also, note that you will not have to reinstall the software."
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [],
     "language": "python",
     "metadata": {},
     "outputs": []
    }
   ],
   "metadata": {}
  }
 ]
}