Bwa should not reverse the cigar when mapping a reverse complement

[nh13]

When reverseComplement=true is passed to BwaAlnInteractive, I think the negative flag should be flipped, but not the cigar. The cigar is always relative to the top strand of the genome. I have confirmed this by mapping two reads, both reverse complements of each other, and the mapping information only differs on the strand, but not the cigar, even in the XA tag.

This occurs here and here when building the Hits. Both places call the Hit.apply method, which will reverse the cigar.

@HD	VN:1.5	SO:unsorted	GO:query
@SQ	SN:chr1	LN:10001
@PG	ID:bwa	PN:bwa	VN:0.7.17-r1198-dirty	CL:bwa aln -S miniref.fa tmp.fq
FORWARD	0	chr1	5825	0	7M1D23M	*	0	0	AAGTGCTGGATTACAGGCATGAGCCACCAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIII	XT:A:R	NM:i:1	X0:i:3	X1:i:0	XM:i:0	XO:i:1	XG:i:1	MD:Z:7^G23	XA:Z:chr1,+2090,7M1D23M,1,.;chr1,+8701,7M1D23M,1,.;	HN:i:3
REVERSE	16	chr1	5825	0	7M1D23M	*	0	0	AAGTGCTGGATTACAGGCATGAGCCACCAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIII	XT:A:R	NM:i:1	X0:i:3	X1:i:0	XM:i:0	XO:i:1	XG:i:1	MD:Z:7^G23	XA:Z:chr1,-2090,7M1D23M,1,.;chr1,-8701,7M1D23M,1,.;	HN:i:3