Stingless bees (Apidae; Meliponini) are major pollen and nectar collecting insects in the tropical and subtropical regions of the world. They are therefore important generalist pollinators of wild and managed plants, including greenhouse crops. Additionally, they produce honey of high medicinal value due to its high antioxidants and phenolics components. Honey samples were collected from feral nests from different sites in Kenya. Pollen was extracted from honey and identified using Next Generation Sequencing (NGS) methods (DNA metabarcoding. The ITS2 and ITS4 gene was amplified using the F5_ATGCGATACTTGGTGTGAAT and Primer R5_ TCCTCCGCTTATTGATATGC primers. Sequencing using the Illumina MiSeq platform was done using a single flow cell on a 600-cycle run. You are provided with 138 samples. The aim of this mini-project is to:
- Analyse the data using ampliseq workflow
- To identify preference forage plants for the stingless bee species provided using PLANTiTS
- To test how well the workflow scales when using the HPC and the cloud
- Bell, K. L. et al. (2016) ‘Pollen DNA barcoding: current applications and future prospects’, Genome, 59(9), pp. 629–640. doi: 10.1139/gen-2015-0200.
- https://nf-co.re/ampliseq/2.3.2