Probe seq empty?

[Anto007]

Hi, I've been able to get this nice tool running for my project but one thing I have consistently noticed is that the final *primer.csv file has Probe columns always empty. I always specify --probe in my command-line and yet the probe sequences (& related info) never seem to appear in the final output csv file. Any inputs here would be appreciated.

[Anto007]

Btw, I hope when the tool refers to Probe seq, it is something that is consistent with a TaqMan probe that is used in qPCR? Just making sure that I'm not misunderstanding anything here. Thanks again.

[biologger]

Hi,
This is strange, can you check your config.json file in the config directory if the value for the probe is true ("probe": true)?

Yes, the probe is a hybridization probe from primer3 see also (https://primer3.org/manual.html#PRIMER_PICK_INTERNAL_OLIGO)

[Anto007]

Thanks for your kind response. Yes, its strange since the probe is indeed set to true always on the config.json file; here's for example the config.json from one of my latest runs for another species
{"qc_gene": ["rRNA"], "intermediate": false, "maxsize": 200, "assemblylevel": ["all"], "probe": true, "mfold": -3.0, "minsize": 70, "mpprimer": -3.5, "skip_download": true, "mfethreshold": 90, "path": "/primerdesign", "exception": [], "customdb": null, "ignore_qc": true, "blastdbv5": false, "nolist": true, "skip_tree": false, "target": "Pseudoalteromonas_galatheae", "offline": false, "blastseqs": 1000}

Below is how the final output primer.csv file looks from this run

Primer name,PPC,Primer penalty,Gene,Primer fwd seq,Primer fwd TM,Primer fwd penalty,Primer rev seq,Primer rev TM,Primer rev penalty,Probe seq,Probe TM,Probe penalty,Amplicon size,Amplicon TM,Amplicon sequence,Template sequence
Pseud_galat_g2177_1_P3,100.0,2.9,g2177_1,CGAAGCTCAATACCGCACAG,59.35,0.68,TTGCCTGTCCAGTACGAAAG,57.84,2.2,None,None,None,120,84.64,CGAAGCTCAATACCGCACAGATCAAAACCAGTGAAAAGGGCATTGCGTTGGTGGAGCAGTTCCAGTCGCAGCAACGTTCGACTATCTACGACCGCCCTAACTTTCGTACTGGACAGGCAA,GTGAAACTAAATTCAATCATTCAACAAGCTGGTACTTACCAAGTAAAGCCACAGCCTAAAAAGGCCGTGAGCCCTGCTATTGAAGACGGAAATACGGCGAAGCTCAATACCGCACAGATCAAAACCAGTGAAAAGGGCATTGCGTTGGTGGAGCAGTTCCAGTCGCAGCAACGTTCGACTATCTACGACCGCCCTAACTTTCGTACTGGACAGGCAATTAGTGAATACAAAGCAATTGCAACGGAAGCAAGACGAGATGAGATAAAAAGTATGATTGGCGTTTCTGTTTACGCGTAA

and below is the command-line that I had used. I have the latest ncbi nt database available on the machine and since I had already got the genome for this species downloaded, I skipped the download step here.

speciesprimer.py -t Pseudoalteromonas_galatheae --nolist --email [email protected] --ignore_qc --skip_download --probe

[biologger]

Hi,
I was unable to reproduce this outcome with the docker container with the tag latest and speciesprimer.py V2.1.2.
Could you check which version of the docker container you are using?

$ sudo docker images

Example output:

REPOSITORY                TAG           IMAGE ID       CREATED         SIZE
biologger/speciesprimer   v2.2-beta.4   1ce300e38e4e   21 months ago   4.55GB
biologger/speciesprimer   latest        a92ff0a5767c   2 years ago     4.55GB

[Anto007]

So sorry for the delay in my response. My Covid infection kinda made me forget about this issue :-) Below is the output I got when I ran sudo docker images

REPOSITORY                  TAG                 IMAGE ID            CREATED             SIZE
biologger/speciesprimer     latest              a92ff0a5767c        2 years ago         4.55GB