From 072c3fd599e6739789ec972f0b4d559512527624 Mon Sep 17 00:00:00 2001 From: goksel <> Date: Thu, 30 Mar 2023 14:01:52 +0100 Subject: [PATCH 1/2] Updated SBOL3 examples --- .../BBa_F2620_PoPSReceiver.jsonld | 1142 ++++++----- .../BBa_F2620_PoPSReceiver.jsonld_expanded | 14 +- .../BBa_F2620_PoPSReceiver.nt | 14 +- .../BBa_F2620_PoPSReceiver.rdf | 14 +- .../BBa_F2620_PoPSReceiver.rj | 14 +- .../BBa_F2620_PoPSReceiver.ttl | 62 +- .../BBa_F2620_PoPSReceiver_ordered.nt | 14 +- SBOL3/combine2020/combine2020.jsonld | 935 +++++---- SBOL3/combine2020/combine2020.jsonld_expanded | 47 +- SBOL3/combine2020/combine2020.nt | 31 +- SBOL3/combine2020/combine2020.rdf | 33 +- SBOL3/combine2020/combine2020.rj | 113 +- SBOL3/combine2020/combine2020.ttl | 67 +- SBOL3/combine2020/combine2020_ordered.nt | 31 +- SBOL3/entity/annotation/annotation.jsonld | 262 ++- SBOL3/entity/annotation/annotation.ttl | 16 +- SBOL3/entity/attachment/attachment.jsonld | 159 +- .../attachment/attachment.jsonld_expanded | 30 +- SBOL3/entity/attachment/attachment.nt | 10 +- SBOL3/entity/attachment/attachment.rdf | 11 +- SBOL3/entity/attachment/attachment.rj | 45 +- SBOL3/entity/attachment/attachment.ttl | 27 +- SBOL3/entity/attachment/attachment_ordered.nt | 10 +- SBOL3/entity/collection/collection.jsonld | 120 +- SBOL3/entity/collection/collection.ttl | 14 +- .../component_urn_uri.jsonld | 41 +- .../component_urn_uri.jsonld_expanded | 4 +- .../component_urn_uri/component_urn_uri.nt | 8 +- .../component_urn_uri/component_urn_uri.rdf | 4 +- .../component_urn_uri/component_urn_uri.rj | 4 +- .../component_urn_uri/component_urn_uri.ttl | 12 +- .../component_urn_uri_ordered.nt | 8 +- .../implementation/implementation.jsonld | 90 +- .../entity/implementation/implementation.ttl | 12 +- SBOL3/entity/interface/interface.jsonld | 249 +-- SBOL3/entity/interface/interface.ttl | 16 +- SBOL3/entity/model/model.jsonld | 106 +- SBOL3/entity/model/model.ttl | 10 +- .../measurement/measurement.jsonld | 444 +++-- .../measurement/measurement.ttl | 28 +- .../measurement_using_units_From_OM.jsonld | 206 +- ...rement_using_units_From_OM.jsonld_expanded | 105 + .../measurement_using_units_From_OM.nt | 60 +- .../measurement_using_units_From_OM.rdf | 51 +- .../measurement_using_units_From_OM.rj | 210 ++ .../measurement_using_units_From_OM.ttl | 72 +- ...measurement_using_units_From_OM_ordered.nt | 40 + SBOL3/multicellular/multicellular.jsonld | 1700 +++++++++++------ SBOL3/multicellular/multicellular.ttl | 54 +- .../multicellular_simple.jsonld | 446 +++-- .../multicellular_simple.ttl | 20 +- .../activity/activity.jsonld | 305 +-- .../activity/activity.jsonld_expanded | 12 +- SBOL3/provenance_entity/activity/activity.nt | 8 +- SBOL3/provenance_entity/activity/activity.rdf | 8 +- SBOL3/provenance_entity/activity/activity.rj | 8 +- SBOL3/provenance_entity/activity/activity.ttl | 28 +- .../activity/activity_ordered.nt | 8 +- SBOL3/provenance_entity/agent/agent.jsonld | 81 +- SBOL3/provenance_entity/agent/agent.ttl | 12 +- SBOL3/provenance_entity/plan/plan.jsonld | 48 +- SBOL3/provenance_entity/plan/plan.ttl | 10 +- SBOL3/toggle_switch/toggle_switch.jsonld | 1554 +++++++++------ .../toggle_switch.jsonld_expanded | 37 +- SBOL3/toggle_switch/toggle_switch.nt | 17 +- SBOL3/toggle_switch/toggle_switch.rdf | 23 +- SBOL3/toggle_switch/toggle_switch.rj | 57 +- SBOL3/toggle_switch/toggle_switch.ttl | 71 +- SBOL3/toggle_switch/toggle_switch_ordered.nt | 17 +- 69 files changed, 5890 insertions(+), 3649 deletions(-) diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld index 50a47cf..d7ca376 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld @@ -1,441 +1,705 @@ { - "@graph" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010", - "@type" : "sbol:Component", - "description" : "Transcriptional terminator consisting of a 64 bp stem-loop", - "displayId" : "BBa_B0010", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", - "name" : "BBa_B0010", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", - "@type" : "sbol:Sequence", - "description" : "BBa_B0010 sequence", - "displayId" : "BBa_B0010_Sequence1", - "elements" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012", - "@type" : "sbol:Component", - "description" : "Double terminator consisting of BBa_B0010 and BBa_B0012", - "displayId" : "BBa_B0012", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", - "name" : "BBa_B0012", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", - "@type" : "sbol:Sequence", - "description" : "BBa_B0012 sequence", - "displayId" : "BBa_B0012_Sequence1", - "elements" : "tcacactggctcaccttcgggtgggcctttctgcgtttata", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015", - "@type" : "sbol:Component", - "description" : "Double terminator consisting of BBa_B0010 and BBa_B0012", - "displayId" : "BBa_B0015", - "hasFeature" : [ "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" ], - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", - "name" : "BBa_B0015", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_B0010", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "79", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", - "orientation" : "SO:0001030", - "start" : "1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_B0012", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "121", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", - "orientation" : "SO:0001030", - "start" : "81" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", - "@type" : "sbol:Sequence", - "description" : "BBa_B0015 sequence", - "displayId" : "BBa_B0015_Sequence1", - "elements" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034", - "@type" : "sbol:Component", - "description" : "RBS based on Elowitz repressilator", - "displayId" : "BBa_B0034", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", - "name" : "BBa_B0034", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", - "@type" : "sbol:Sequence", - "description" : "BBa_B0034 sequence", - "displayId" : "BBa_B0034_Sequence1", - "elements" : "aaagaggagaaa", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062", - "@type" : "sbol:Component", - "description" : "luxR repressor/activator, (no LVA?)", - "displayId" : "BBa_C0062", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", - "name" : "luxR", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", - "@type" : "sbol:Sequence", - "description" : "luxR sequence", - "displayId" : "BBa_C0062_Sequence1", - "elements" : "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein", - "@type" : "sbol:Component", - "description" : "LuxR protein", - "displayId" : "BBa_C0062_protein", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1", - "name" : "LuxR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1", - "@type" : "sbol:Sequence", - "description" : "LuxR sequence", - "displayId" : "BBa_C0062_protein_Sequence1", - "elements" : "NNNNNNNNNNN", - "encoding" : "EDAM:format_1208", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620", - "@type" : "sbol:Component", - "description" : "PoPS Receiver", - "displayId" : "BBa_F2620", - "hasFeature" : [ "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" ], - "hasInteraction" : [ "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" ], - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "name" : "BBa_F2620", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", - "role" : "SBO:0000645" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", - "role" : "SBO:0000011" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", - "@type" : "sbol:Interaction", - "displayId" : "Interaction2", - "hasParticipation" : [ "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" ], - "type" : "SBO:0000170" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", - "role" : "SBO:0000643" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", - "role" : "SBO:0000459" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3", - "@type" : "sbol:Interaction", - "displayId" : "Interaction3", - "hasParticipation" : [ "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1", "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" ], - "type" : "SBO:0000170" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", - "role" : "SBO:0000643" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", - "role" : "SBO:0000459" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_C0062_protein" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://synbiohub.org/public/igem/TetR_protein" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_R0040", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "53", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "orientation" : "SO:0001030", - "start" : "1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent4", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_B0034", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "66", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "orientation" : "SO:0001030", - "start" : "55" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent5", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_C0062", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "847", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "orientation" : "SO:0001030", - "start" : "67" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent6", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_B0015", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "968", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "orientation" : "SO:0001030", - "start" : "848" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent7", - "hasLocation" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/BBa_R0062", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "1023", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "orientation" : "SO:0001030", - "start" : "969" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "@type" : "sbol:Sequence", - "description" : "BBa_F2620 sequence", - "displayId" : "BBa_F2620_Sequence1", - "elements" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040", - "@type" : "sbol:Component", - "description" : "TetR repressible promoter", - "displayId" : "BBa_R0040", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", - "name" : "pTetR", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", - "@type" : "sbol:Sequence", - "description" : "pTetR sequence", - "displayId" : "BBa_R0040_Sequence1", - "elements" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062", - "@type" : "sbol:Component", - "description" : "Promoter (luxR & HSL regulated -- lux pR)", - "displayId" : "BBa_R0062", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", - "name" : "lux pR", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", - "@type" : "sbol:Sequence", - "description" : "lux pR sequence", - "displayId" : "BBa_R0062_Sequence1", - "elements" : "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1", - "@type" : "sbol:Sequence", - "description" : "TetR sequence", - "displayId" : "TetR_protein_Sequence1", - "elements" : "NNNNNNNNNNN", - "encoding" : "EDAM:format_1208", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - } ], - "@context" : { - "start" : { - "@id" : "http://sbols.org/v3#start" - }, - "orientation" : { - "@id" : "http://sbols.org/v3#orientation", - "@type" : "@id" - }, - "hasSequence" : { - "@id" : "http://sbols.org/v3#hasSequence", - "@type" : "@id" - }, - "end" : { - "@id" : "http://sbols.org/v3#end" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "hasLocation" : { - "@id" : "http://sbols.org/v3#hasLocation", - "@type" : "@id" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "encoding" : { - "@id" : "http://sbols.org/v3#encoding", - "@type" : "@id" - }, - "elements" : { - "@id" : "http://sbols.org/v3#elements" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "hasParticipation" : { - "@id" : "http://sbols.org/v3#hasParticipation", - "@type" : "@id" - }, - "participant" : { - "@id" : "http://sbols.org/v3#participant", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasInteraction" : { - "@id" : "http://sbols.org/v3#hasInteraction", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", + "sbol:start": "1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "54", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", + "sbol:displayId": "BBa_F2620_Sequence1", + "sbol:description": "BBa_F2620 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_C0062", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "luxR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_C0062", + "sbol:description": "luxR repressor/activator, (no LVA?)", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1", + "sbol:start": "67", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "847", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac", + "sbol:displayId": "BBa_C0062_Sequence1", + "sbol:description": "BBa_C0062 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:displayId": "BBa_B0010_Sequence1", + "sbol:description": "BBa_B0010 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "LuxR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_C0062_protein", + "sbol:description": "LuxR protein", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1208" + }, + "sbol:elements": "NNNNNNNNNNN", + "sbol:displayId": "BBa_C0062_protein_Sequence1", + "sbol:description": "BBa_C0062_protein sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", + "sbol:start": "969", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "1023", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tcacactggctcaccttcgggtgggcctttctgcgtttata", + "sbol:displayId": "BBa_B0012_Sequence1", + "sbol:description": "BBa_B0012 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0012", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "BBa_B0012", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_B0012", + "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pTetR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_R0040", + "sbol:description": "TetR repressible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "sbol:displayId": "BBa_R0040_Sequence1", + "sbol:description": "BBa_R0040 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_B0034" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0034", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "BBa_B0034", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_B0034", + "sbol:description": "RBS based on Elowitz repressilator", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", + "sbol:start": "55", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "66", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata", + "sbol:displayId": "BBa_B0015_Sequence1", + "sbol:description": "BBa_B0015 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000459" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000459" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/TetR_protein" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1208" + }, + "sbol:elements": "NNNNNNNNNNN", + "sbol:displayId": "TetR_protein_Sequence1", + "sbol:description": "TetR_protein sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_B0012" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", + "sbol:start": "81", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + }, + "sbol:end": "121", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0010", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "BBa_B0010", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_B0010", + "sbol:description": "Transcriptional terminator consisting of a 64 bp stem-loop", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/TetR_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "TetR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "TetR_protein", + "sbol:description": "TetR protein", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000643" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0062" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "aaagaggagaaa", + "sbol:displayId": "BBa_B0034_Sequence1", + "sbol:description": "BBa_B0034 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1", + "sbol:start": "1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + }, + "sbol:end": "80", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000643" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + }, + "@type": "sbol:Component", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" + } + ], + "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "BBa_B0015", + "sbol:displayId": "BBa_B0015" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_B0010" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", + "sbol:displayId": "BBa_R0062_Sequence1", + "sbol:description": "BBa_R0062 sequence", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0062", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "lux pR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_R0062", + "sbol:description": "Promoter (luxR & HSL regulated -- lux pR)", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620", + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + } + ], + "sbol:hasInteraction": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" + } + ], + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:displayId": "BBa_F2620", + "@type": "sbol:Component", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:name": "BBa_F2620", + "sbol:description": "PoPS Receiver", + "sbol:type": { + "@id": "SBO:0000251" + } + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", + "sbol:type": { + "@id": "SBO:0000170" + }, + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3", + "sbol:type": { + "@id": "SBO:0000170" + }, + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", + "sbol:start": "848", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "968", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded index d8f8d31..4d18d06 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded @@ -144,7 +144,7 @@ "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" } ], "http://sbols.org/v3#end" : [ { - "@value" : "79" + "@value" : "80" } ], "http://sbols.org/v3#displayId" : [ { "@value" : "Range1" @@ -291,7 +291,7 @@ "@value" : "BBa_C0062_Sequence1" } ], "http://sbols.org/v3#description" : [ { - "@value" : "luxR sequence" + "@value" : "BBa_C0062 sequence" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] }, { @@ -336,7 +336,7 @@ "@value" : "BBa_C0062_protein_Sequence1" } ], "http://sbols.org/v3#description" : [ { - "@value" : "LuxR sequence" + "@value" : "BBa_C0062_protein sequence" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] }, { @@ -544,7 +544,7 @@ "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ], "http://sbols.org/v3#end" : [ { - "@value" : "53" + "@value" : "54" } ], "http://sbols.org/v3#displayId" : [ { "@value" : "Range1" @@ -745,7 +745,7 @@ "@value" : "BBa_R0040_Sequence1" } ], "http://sbols.org/v3#description" : [ { - "@value" : "pTetR sequence" + "@value" : "BBa_R0040 sequence" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] }, { @@ -790,7 +790,7 @@ "@value" : "BBa_R0062_Sequence1" } ], "http://sbols.org/v3#description" : [ { - "@value" : "lux pR sequence" + "@value" : "BBa_R0062 sequence" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] }, { @@ -835,7 +835,7 @@ "@value" : "TetR_protein_Sequence1" } ], "http://sbols.org/v3#description" : [ { - "@value" : "TetR sequence" + "@value" : "TetR_protein sequence" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] } ] diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt index 5edcf02..730e8d6 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt @@ -1,7 +1,7 @@ "1" . . . - "53" . + "54" . "Range1" . . . @@ -14,7 +14,7 @@ . "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" . "BBa_C0062_Sequence1" . - "luxR sequence" . + "BBa_C0062 sequence" . . "Sequence1" . . @@ -112,7 +112,7 @@ . "NNNNNNNNNNN" . "TetR_protein_Sequence1" . - "TetR sequence" . + "TetR_protein sequence" . . . . @@ -156,7 +156,7 @@ "1" . . . - "79" . + "80" . "Range1" . . . @@ -178,7 +178,7 @@ . "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . "BBa_R0062_Sequence1" . - "lux pR sequence" . + "BBa_R0062 sequence" . . . . @@ -222,7 +222,7 @@ . "NNNNNNNNNNN" . "BBa_C0062_protein_Sequence1" . - "LuxR sequence" . + "BBa_C0062_protein sequence" . . . . @@ -267,7 +267,7 @@ . "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . "BBa_R0040_Sequence1" . - "pTetR sequence" . + "BBa_R0040 sequence" . . . . diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf index 5929861..3ee5ac0 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf @@ -161,7 +161,7 @@ - 53 + 54 Range1 @@ -300,7 +300,7 @@ - 79 + 80 Range1 @@ -346,7 +346,7 @@ acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_R0062_Sequence1 - lux pR sequence + BBa_R0062 sequence Sequence1 @@ -370,7 +370,7 @@ NNNNNNNNNNN TetR_protein_Sequence1 - TetR sequence + TetR_protein sequence Sequence1 @@ -386,7 +386,7 @@ NNNNNNNNNNN BBa_C0062_protein_Sequence1 - LuxR sequence + BBa_C0062_protein sequence Sequence1 @@ -394,7 +394,7 @@ tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_R0040_Sequence1 - pTetR sequence + BBa_R0040 sequence Sequence1 @@ -402,6 +402,6 @@ atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_C0062_Sequence1 - luxR sequence + BBa_C0062 sequence diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj index 7a06331..4655377 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj @@ -140,7 +140,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "lux pR sequence" + "value" : "BBa_R0062 sequence" } ] } @@ -442,7 +442,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "TetR sequence" + "value" : "TetR_protein sequence" } ] } @@ -518,7 +518,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "LuxR sequence" + "value" : "BBa_C0062_protein sequence" } ] } @@ -579,7 +579,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "luxR sequence" + "value" : "BBa_C0062 sequence" } ] } @@ -1264,7 +1264,7 @@ ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "53" + "value" : "54" } ] } @@ -1353,7 +1353,7 @@ ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "79" + "value" : "80" } ] } @@ -1471,7 +1471,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "pTetR sequence" + "value" : "BBa_R0040 sequence" } ] } diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl index 4ca9882..bf80d8e 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl @@ -1,18 +1,18 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:Range ; sbol:displayId "Range1" ; - sbol:end "53" ; + sbol:end "54" ; sbol:hasSequence :BBa_F2620_Sequence1 ; sbol:orientation SO:0001030 ; sbol:start "1" . @@ -25,11 +25,11 @@ sbol:orientation SO:0001030 . :BBa_C0062_Sequence1 a sbol:Sequence ; - sbol:description "luxR sequence" ; + sbol:description "BBa_C0062 sequence" ; sbol:displayId "BBa_C0062_Sequence1" ; sbol:elements "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . :BBa_B0010_Sequence1 a sbol:Sequence ; @@ -37,13 +37,13 @@ sbol:displayId "BBa_B0010_Sequence1" ; sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . :BBa_C0062_protein a sbol:Component ; sbol:description "LuxR protein" ; sbol:displayId "BBa_C0062_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_C0062_protein_Sequence1 ; sbol:name "LuxR" ; sbol:role GO:0003700 ; @@ -68,13 +68,13 @@ sbol:displayId "BBa_B0012_Sequence1" ; sbol:elements "tcacactggctcaccttcgggtgggcctttctgcgtttata" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . :BBa_B0012 a sbol:Component ; sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012" ; sbol:displayId "BBa_B0012" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_B0012_Sequence1 ; sbol:name "BBa_B0012" ; sbol:role SO:0000141 ; @@ -83,7 +83,7 @@ :BBa_R0040 a sbol:Component ; sbol:description "TetR repressible promoter" ; sbol:displayId "BBa_R0040" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_R0040_Sequence1 ; sbol:name "pTetR" ; sbol:role SO:0000167 ; @@ -116,7 +116,7 @@ sbol:displayId "BBa_B0015_Sequence1" ; sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . :BBa_F2620_Sequence1 a sbol:Sequence ; @@ -124,7 +124,7 @@ sbol:displayId "BBa_F2620_Sequence1" ; sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -147,11 +147,11 @@ :TetR_protein_Sequence1 a sbol:Sequence ; - sbol:description "TetR sequence" ; + sbol:description "TetR_protein sequence" ; sbol:displayId "TetR_protein_Sequence1" ; sbol:elements "NNNNNNNNNNN" ; sbol:encoding EDAM:format_1208 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -164,7 +164,7 @@ :BBa_B0010 a sbol:Component ; sbol:description "Transcriptional terminator consisting of a 64 bp stem-loop" ; sbol:displayId "BBa_B0010" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_B0010_Sequence1 ; sbol:name "BBa_B0010" ; sbol:role SO:0000141 ; @@ -173,7 +173,7 @@ :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :TetR_protein_Sequence1 ; sbol:name "TetR" ; sbol:role GO:0003700 ; @@ -195,7 +195,7 @@ sbol:displayId "BBa_B0034_Sequence1" ; sbol:elements "aaagaggagaaa" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -207,7 +207,7 @@ a sbol:Range ; sbol:displayId "Range1" ; - sbol:end "79" ; + sbol:end "80" ; sbol:hasSequence :BBa_B0015_Sequence1 ; sbol:orientation SO:0001030 ; sbol:start "1" . @@ -222,18 +222,18 @@ sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012" ; sbol:displayId "BBa_B0015" ; sbol:hasFeature , ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_B0015_Sequence1 ; sbol:name "BBa_B0015" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . :BBa_R0062_Sequence1 a sbol:Sequence ; - sbol:description "lux pR sequence" ; + sbol:description "BBa_R0062 sequence" ; sbol:displayId "BBa_R0062_Sequence1" ; sbol:elements "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -255,7 +255,7 @@ sbol:displayId "BBa_F2620" ; sbol:hasFeature , , , , , , ; sbol:hasInteraction , , ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_F2620_Sequence1 ; sbol:name "BBa_F2620" ; sbol:role SO:0000704 ; @@ -276,11 +276,11 @@ :BBa_C0062_protein_Sequence1 a sbol:Sequence ; - sbol:description "LuxR sequence" ; + sbol:description "BBa_C0062_protein sequence" ; sbol:displayId "BBa_C0062_protein_Sequence1" ; sbol:elements "NNNNNNNNNNN" ; sbol:encoding EDAM:format_1208 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -307,7 +307,7 @@ :BBa_B0034 a sbol:Component ; sbol:description "RBS based on Elowitz repressilator" ; sbol:displayId "BBa_B0034" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_B0034_Sequence1 ; sbol:name "BBa_B0034" ; sbol:role SO:0000139 ; @@ -316,7 +316,7 @@ :BBa_R0062 a sbol:Component ; sbol:description "Promoter (luxR & HSL regulated -- lux pR)" ; sbol:displayId "BBa_R0062" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_R0062_Sequence1 ; sbol:name "lux pR" ; sbol:role SO:0000167 ; @@ -331,11 +331,11 @@ sbol:start "848" . :BBa_R0040_Sequence1 a sbol:Sequence ; - sbol:description "pTetR sequence" ; + sbol:description "BBa_R0040 sequence" ; sbol:displayId "BBa_R0040_Sequence1" ; sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -347,7 +347,7 @@ :BBa_C0062 a sbol:Component ; sbol:description "luxR repressor/activator, (no LVA?)" ; sbol:displayId "BBa_C0062" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :BBa_C0062_Sequence1 ; sbol:name "luxR" ; sbol:role SO:0000316 ; diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver_ordered.nt b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver_ordered.nt index 3019866..bea05d8 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver_ordered.nt +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver_ordered.nt @@ -29,7 +29,7 @@ "Sequence1" . . "Range1" . - "79" . + "80" . . . "1" . @@ -90,7 +90,7 @@ . . . - "luxR sequence" . + "BBa_C0062 sequence" . "BBa_C0062_Sequence1" . "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" . . @@ -105,7 +105,7 @@ . . . - "LuxR sequence" . + "BBa_C0062_protein sequence" . "BBa_C0062_protein_Sequence1" . "NNNNNNNNNNN" . . @@ -158,7 +158,7 @@ . . "Range1" . - "53" . + "54" . . . "1" . @@ -245,7 +245,7 @@ . . . - "pTetR sequence" . + "BBa_R0040 sequence" . "BBa_R0040_Sequence1" . "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . . @@ -260,7 +260,7 @@ . . . - "lux pR sequence" . + "BBa_R0062 sequence" . "BBa_R0062_Sequence1" . "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . . @@ -275,7 +275,7 @@ . . . - "TetR sequence" . + "TetR_protein sequence" . "TetR_protein_Sequence1" . "NNNNNNNNNNN" . . diff --git a/SBOL3/combine2020/combine2020.jsonld b/SBOL3/combine2020/combine2020.jsonld index 8c50495..42ed855 100644 --- a/SBOL3/combine2020/combine2020.jsonld +++ b/SBOL3/combine2020/combine2020.jsonld @@ -1,374 +1,565 @@ { - "@graph" : [ { - "@id" : "https://synbiohub.org/public/igem/B0015", - "@type" : "sbol:Component", - "description" : "B0015 double terminator", - "displayId" : "B0015", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/B0015_Sequence1", - "name" : "terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/B0015_Sequence1", - "@type" : "sbol:Sequence", - "description" : "terminator sequence", - "displayId" : "B0015_Sequence1", - "elements" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/B0034", - "@type" : "sbol:Component", - "description" : "RBS (Elowitz 1999)", - "displayId" : "B0034", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/B0034_Sequence", - "name" : "B0034", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/B0034_Sequence", - "@type" : "sbol:Sequence", - "displayId" : "B0034_Sequence", - "elements" : "aaagaggagaaa", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem" - }, { - "@id" : "https://synbiohub.org/public/igem/E0040", - "@type" : "sbol:Component", - "description" : "gfp coding sequence", - "displayId" : "E0040", - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/E0040_Sequence1", - "name" : "gfp", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/E0040_Sequence1", - "@type" : "sbol:Sequence", - "description" : "gfp sequence", - "displayId" : "E0040_Sequence1", - "elements" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/GFP_protein", - "@type" : "sbol:Component", - "description" : "GFP", - "displayId" : "GFP_protein", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "GFP", - "type" : "SBO:0000252" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504", - "@type" : "sbol:Component", - "description" : "Screening plasmid intermediate", - "displayId" : "i13504", - "hasFeature" : [ "https://synbiohub.org/public/igem/i13504/SubComponent3", "https://synbiohub.org/public/igem/i13504/SequenceFeature2", "https://synbiohub.org/public/igem/i13504/SequenceFeature1", "https://synbiohub.org/public/igem/i13504/SubComponent2", "https://synbiohub.org/public/igem/i13504/SubComponent1" ], - "hasNamespace" : "https://synbiohub.org/public/igem", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "name" : "i13504", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1", - "@type" : "sbol:SequenceFeature", - "displayId" : "SequenceFeature1", - "hasLocation" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "18", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "start" : "13" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2", - "@type" : "sbol:SequenceFeature", - "displayId" : "SequenceFeature2", - "hasLocation" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "746", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "start" : "739" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "hasLocation" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/B0034", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "11", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "orientation" : "SO:0001030", - "start" : "1" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "hasLocation" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/E0040", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "738", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "orientation" : "SO:0001030", - "start" : "19" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "hasLocation" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", - "instanceOf" : "https://synbiohub.org/public/igem/B0015", - "orientation" : "SO:0001030" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", - "@type" : "sbol:Range", - "displayId" : "Range1", - "end" : "826", - "hasSequence" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "start" : "747" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "@type" : "sbol:Sequence", - "description" : "i13504 sequence", - "displayId" : "i13504_Sequence1", - "elements" : "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", - "encoding" : "EDAM:format_1207", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "Sequence1" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system", - "@type" : "sbol:Component", - "displayId" : "i13504_system", - "hasFeature" : [ "https://synbiohub.org/public/igem/i13504_system/SubComponent2", "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", "https://synbiohub.org/public/igem/i13504_system/SubComponent1" ], - "hasInteraction" : "https://synbiohub.org/public/igem/i13504_system/Interaction1", - "hasNamespace" : "https://synbiohub.org/public/igem", - "name" : "i13504 system", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1", - "refersTo" : "https://synbiohub.org/public/igem/i13504/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", - "role" : "SBO:0000645" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2", - "role" : "SBO:0000011" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://synbiohub.org/public/igem/i13504" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://synbiohub.org/public/igem/GFP_protein" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1", - "@type" : "sbol:Component", - "displayId" : "interlab16device1", - "hasConstraint" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1", - "hasFeature" : [ "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" ], - "hasNamespace" : "https://synbiohub.org/public/igem", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", - "refersTo" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", - "restriction" : "sbol:meets", - "subject" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://synbiohub.org/public/igem/j23101" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://synbiohub.org/public/igem/i13504_system" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2", - "@type" : "sbol:Component", - "displayId" : "interlab16device2", - "hasConstraint" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1", - "hasFeature" : [ "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" ], - "hasNamespace" : "https://synbiohub.org/public/igem", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", - "refersTo" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", - "restriction" : "sbol:meets", - "subject" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://synbiohub.org/public/igem/j23106" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://synbiohub.org/public/igem/i13504_system" - }, { - "@id" : "https://synbiohub.org/public/igem/j23101", - "@type" : "sbol:Component", - "displayId" : "j23101", - "hasNamespace" : "https://synbiohub.org/public/igem", - "type" : "SBO:0000251" - }, { - "@id" : "https://synbiohub.org/public/igem/j23106", - "@type" : "sbol:Component", - "displayId" : "j23106", - "hasNamespace" : "https://synbiohub.org/public/igem", - "type" : "SBO:0000251" - } ], - "@context" : { - "hasParticipation" : { - "@id" : "http://sbols.org/v3#hasParticipation", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "orientation" : { - "@id" : "http://sbols.org/v3#orientation", - "@type" : "@id" - }, - "end" : { - "@id" : "http://sbols.org/v3#end" - }, - "start" : { - "@id" : "http://sbols.org/v3#start" - }, - "hasSequence" : { - "@id" : "http://sbols.org/v3#hasSequence", - "@type" : "@id" - }, - "hasConstraint" : { - "@id" : "http://sbols.org/v3#hasConstraint", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "participant" : { - "@id" : "http://sbols.org/v3#participant", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "hasLocation" : { - "@id" : "http://sbols.org/v3#hasLocation", - "@type" : "@id" - }, - "encoding" : { - "@id" : "http://sbols.org/v3#encoding", - "@type" : "@id" - }, - "elements" : { - "@id" : "http://sbols.org/v3#elements" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "inChildOf" : { - "@id" : "http://sbols.org/v3#inChildOf", - "@type" : "@id" - }, - "refersTo" : { - "@id" : "http://sbols.org/v3#refersTo", - "@type" : "@id" - }, - "object" : { - "@id" : "http://sbols.org/v3#object", - "@type" : "@id" - }, - "subject" : { - "@id" : "http://sbols.org/v3#subject", - "@type" : "@id" - }, - "restriction" : { - "@id" : "http://sbols.org/v3#restriction", - "@type" : "@id" - }, - "hasInteraction" : { - "@id" : "http://sbols.org/v3#hasInteraction", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1", + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" + } + ], + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2" + }, + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1", + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + }, + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "12", + "sbol:start": "1", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1", + "sbol:elements": "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:description": "i13504 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "i13504_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1", + "sbol:hasConstraint": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "interlab16device1", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1", + "sbol:object": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + "sbol:subject": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:meets" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/j23101" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/B0034_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "aaagaggagaaa", + "sbol:description": "B0034 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0034_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" + }, + "sbol:displayId": "SequenceFeature1", + "@type": "sbol:SequenceFeature" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "18", + "sbol:start": "13", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/E0040", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/E0040_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:description": "gfp coding sequence", + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "E0040", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/E0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "sbol:description": "E0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "E0040_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ], + "sbol:role": { + "@id": "SBO:0000289" + }, + "@type": "sbol:Component", + "sbol:hasInteraction": { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1" + }, + "sbol:name": "i13504 system", + "sbol:displayId": "i13504_system", + "sbol:type": { + "@id": "SBO:0000241" + } + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:description": "B0015 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0015_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/j23106" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/j23106", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "j23106", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/Constraint1", + "sbol:object": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" + }, + "sbol:subject": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:meets" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://synbiohub.org/public/igem/GFP_protein", + "sbol:description": "GFP", + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "GFP_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1" + } + ], + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:name": "i13504", + "@type": "sbol:Component", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "i13504", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000804" + }, + "sbol:description": "Screening plasmid intermediate" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/B0015" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" + }, + "sbol:displayId": "SequenceFeature2", + "@type": "sbol:SequenceFeature" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/E0040" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/B0034" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/j23101", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "j23101", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "826", + "sbol:start": "747", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:description": "B0015 double terminator", + "sbol:name": "terminator", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0015", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/B0034", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/B0034_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:description": "RBS (Elowitz 1999)", + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0034", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/GFP_protein" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "738", + "sbol:start": "19", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2", + "sbol:hasConstraint": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/Constraint1" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "interlab16device2", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "746", + "sbol:start": "739", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/combine2020/combine2020.jsonld_expanded b/SBOL3/combine2020/combine2020.jsonld_expanded index 93f6b89..62d585e 100644 --- a/SBOL3/combine2020/combine2020.jsonld_expanded +++ b/SBOL3/combine2020/combine2020.jsonld_expanded @@ -31,7 +31,7 @@ "@value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" } ], "http://sbols.org/v3#description" : [ { - "@value" : "terminator sequence" + "@value" : "B0015 sequence" } ], "http://sbols.org/v3#name" : [ { "@value" : "Sequence1" @@ -46,7 +46,7 @@ }, { "@id" : "https://synbiohub.org/public/igem/B0034", "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/B0034_Sequence" + "@id" : "https://synbiohub.org/public/igem/B0034_Sequence1" } ], "http://sbols.org/v3#role" : [ { "@id" : "https://identifiers.org/SO:0000139" @@ -55,7 +55,7 @@ "@value" : "RBS (Elowitz 1999)" } ], "http://sbols.org/v3#name" : [ { - "@value" : "B0034" + "@value" : "rbs" } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" @@ -68,18 +68,24 @@ } ], "@type" : [ "http://sbols.org/v3#Component" ] }, { - "@id" : "https://synbiohub.org/public/igem/B0034_Sequence", + "@id" : "https://synbiohub.org/public/igem/B0034_Sequence1", "http://sbols.org/v3#encoding" : [ { "@id" : "https://identifiers.org/edam:format_1207" } ], "http://sbols.org/v3#elements" : [ { "@value" : "aaagaggagaaa" } ], + "http://sbols.org/v3#description" : [ { + "@value" : "B0034 sequence" + } ], + "http://sbols.org/v3#name" : [ { + "@value" : "Sequence1" + } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" } ], "http://sbols.org/v3#displayId" : [ { - "@value" : "B0034_Sequence" + "@value" : "B0034_Sequence1" } ], "@type" : [ "http://sbols.org/v3#Sequence" ] }, { @@ -115,7 +121,7 @@ "@value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" } ], "http://sbols.org/v3#description" : [ { - "@value" : "gfp sequence" + "@value" : "E0040 sequence" } ], "http://sbols.org/v3#name" : [ { "@value" : "Sequence1" @@ -165,9 +171,6 @@ "@value" : "i13504" } ], "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], "http://sbols.org/v3#hasSequence" : [ { "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ], @@ -177,6 +180,9 @@ "http://sbols.org/v3#type" : [ { "@id" : "https://identifiers.org/SBO:0000251" } ], + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000804" + } ], "http://sbols.org/v3#description" : [ { "@value" : "Screening plasmid intermediate" } ] @@ -194,6 +200,9 @@ "@type" : [ "http://sbols.org/v3#SequenceFeature" ] }, { "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", + "http://sbols.org/v3#orientation" : [ { + "@id" : "https://identifiers.org/SO:0001030" + } ], "http://sbols.org/v3#end" : [ { "@value" : "18" } ], @@ -221,6 +230,9 @@ "@type" : [ "http://sbols.org/v3#SequenceFeature" ] }, { "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", + "http://sbols.org/v3#orientation" : [ { + "@id" : "https://identifiers.org/SO:0001030" + } ], "http://sbols.org/v3#end" : [ { "@value" : "746" } ], @@ -255,7 +267,7 @@ "@id" : "https://identifiers.org/SO:0001030" } ], "http://sbols.org/v3#end" : [ { - "@value" : "11" + "@value" : "12" } ], "http://sbols.org/v3#start" : [ { "@value" : "1" @@ -317,6 +329,9 @@ "@type" : [ "http://sbols.org/v3#SubComponent" ] }, { "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", + "http://sbols.org/v3#orientation" : [ { + "@id" : "https://identifiers.org/SO:0001030" + } ], "http://sbols.org/v3#end" : [ { "@value" : "826" } ], @@ -459,6 +474,9 @@ }, { "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" } ], + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000704" + } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" } ], @@ -526,6 +544,9 @@ }, { "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" } ], + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000704" + } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" } ], @@ -583,6 +604,9 @@ "@type" : [ "http://sbols.org/v3#SubComponent" ] }, { "@id" : "https://synbiohub.org/public/igem/j23101", + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000704" + } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" } ], @@ -595,6 +619,9 @@ "@type" : [ "http://sbols.org/v3#Component" ] }, { "@id" : "https://synbiohub.org/public/igem/j23106", + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000704" + } ], "http://sbols.org/v3#hasNamespace" : [ { "@id" : "https://synbiohub.org/public/igem" } ], diff --git a/SBOL3/combine2020/combine2020.nt b/SBOL3/combine2020/combine2020.nt index 7d7cb3e..9aa745d 100644 --- a/SBOL3/combine2020/combine2020.nt +++ b/SBOL3/combine2020/combine2020.nt @@ -4,7 +4,7 @@ "Interaction1" . . . - "11" . + "12" . "1" . . "Range1" . @@ -13,10 +13,18 @@ . . . + . . . "interlab16device1" . . + . + "aaagaggagaaa" . + "B0034 sequence" . + "Sequence1" . + . + "B0034_Sequence1" . + . . . "Participation1" . @@ -25,16 +33,12 @@ . "SequenceFeature1" . . + . "18" . "13" . . "Range1" . . - . - "aaagaggagaaa" . - . - "B0034_Sequence" . - . . . "gfp coding sequence" . @@ -52,7 +56,7 @@ . . "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . - "terminator sequence" . + "B0015 sequence" . "Sequence1" . . "B0015_Sequence1" . @@ -76,18 +80,20 @@ "i13504" . . . - . . . . . "i13504" . . + . "Screening plasmid intermediate" . + . . . "j23101" . . + . . . "j23106" . @@ -116,10 +122,10 @@ . "SubComponent3" . . - . + . . "RBS (Elowitz 1999)" . - "B0034" . + "rbs" . . . "B0034" . @@ -134,6 +140,7 @@ . "i13504_system" . . + . "826" . "747" . . @@ -157,7 +164,7 @@ . . "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . - "gfp sequence" . + "E0040 sequence" . "Sequence1" . . "E0040_Sequence1" . @@ -182,10 +189,12 @@ . . . + . . . "interlab16device2" . . + . "746" . "739" . . diff --git a/SBOL3/combine2020/combine2020.rdf b/SBOL3/combine2020/combine2020.rdf index 2355a79..341fa13 100644 --- a/SBOL3/combine2020/combine2020.rdf +++ b/SBOL3/combine2020/combine2020.rdf @@ -22,6 +22,7 @@ E0040 + j23106 @@ -98,6 +99,7 @@ + 826 747 @@ -120,6 +122,7 @@ + 746 739 @@ -131,7 +134,6 @@ SequenceFeature2 - @@ -140,6 +142,7 @@ + 18 13 @@ -157,7 +160,7 @@ - 11 + 12 1 @@ -174,6 +177,7 @@ i13504 + Screening plasmid intermediate @@ -217,17 +221,18 @@ + interlab16device1 - + RBS (Elowitz 1999) - B0034 + rbs B0034 @@ -260,11 +265,13 @@ + interlab16device2 + j23101 @@ -276,12 +283,6 @@ GFP_protein - - - aaagaggagaaa - - B0034_Sequence - aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc @@ -293,7 +294,7 @@ ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc - terminator sequence + B0015 sequence Sequence1 B0015_Sequence1 @@ -301,9 +302,17 @@ atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa - gfp sequence + E0040 sequence Sequence1 E0040_Sequence1 + + + aaagaggagaaa + B0034 sequence + Sequence1 + + B0034_Sequence1 + diff --git a/SBOL3/combine2020/combine2020.rj b/SBOL3/combine2020/combine2020.rj index fb6161a..7336727 100644 --- a/SBOL3/combine2020/combine2020.rj +++ b/SBOL3/combine2020/combine2020.rj @@ -28,6 +28,11 @@ "value" : "j23106" } ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -178,6 +183,11 @@ "value" : "interlab16device1" } ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -234,6 +244,11 @@ "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , "value" : "18" @@ -326,6 +341,11 @@ "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , "value" : "746" @@ -417,7 +437,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "terminator sequence" + "value" : "B0015 sequence" } ] } @@ -450,7 +470,7 @@ ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "11" + "value" : "12" } ] } @@ -473,12 +493,55 @@ ] } , + "https://synbiohub.org/public/igem/B0034_Sequence1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0034_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "aaagaggagaaa" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0034 sequence" + } + ] + } + , "https://synbiohub.org/public/igem/j23101" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "j23101" } ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -709,7 +772,7 @@ ] , "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/B0034_Sequence" + "value" : "https://synbiohub.org/public/igem/B0034_Sequence1" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -719,7 +782,7 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "B0034" + "value" : "rbs" } ] , "http://sbols.org/v3#description" : [ { @@ -767,7 +830,7 @@ ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "gfp sequence" + "value" : "E0040 sequence" } ] } @@ -801,6 +864,11 @@ "value" : "interlab16device2" } ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -885,6 +953,11 @@ "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , "value" : "826" @@ -943,34 +1016,6 @@ ] } , - "https://synbiohub.org/public/igem/B0034_Sequence" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "B0034_Sequence" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" - } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" - } - ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "aaagaggagaaa" - } - ] , - "http://sbols.org/v3#encoding" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] - } - , "https://synbiohub.org/public/igem/i13504/SubComponent3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , @@ -1058,7 +1103,7 @@ ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "value" : "https://identifiers.org/SO:0000804" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { diff --git a/SBOL3/combine2020/combine2020.ttl b/SBOL3/combine2020/combine2020.ttl index 4b1f00a..883ec57 100644 --- a/SBOL3/combine2020/combine2020.ttl +++ b/SBOL3/combine2020/combine2020.ttl @@ -1,13 +1,13 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:Interaction ; @@ -18,7 +18,7 @@ a sbol:Range ; sbol:displayId "Range1" ; - sbol:end "11" ; + sbol:end "12" ; sbol:hasSequence :i13504_Sequence1 ; sbol:orientation SO:0001030 ; sbol:start "1" . @@ -27,9 +27,18 @@ sbol:displayId "interlab16device1" ; sbol:hasConstraint ; sbol:hasFeature , , ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; + sbol:role SO:0000704 ; sbol:type SBO:0000251 . +:B0034_Sequence1 a sbol:Sequence ; + sbol:description "B0034 sequence" ; + sbol:displayId "B0034_Sequence1" ; + sbol:elements "aaagaggagaaa" ; + sbol:encoding EDAM:format_1207 ; + sbol:hasNamespace <../igem> ; + sbol:name "Sequence1" . + a sbol:Participation ; sbol:displayId "Participation1" ; @@ -47,18 +56,13 @@ sbol:displayId "Range1" ; sbol:end "18" ; sbol:hasSequence :i13504_Sequence1 ; + sbol:orientation SO:0001030 ; sbol:start "13" . -:B0034_Sequence a sbol:Sequence ; - sbol:displayId "B0034_Sequence" ; - sbol:elements "aaagaggagaaa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace . - :E0040 a sbol:Component ; sbol:description "gfp coding sequence" ; sbol:displayId "E0040" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :E0040_Sequence1 ; sbol:name "gfp" ; sbol:role SO:0000316 ; @@ -76,11 +80,11 @@ sbol:refersTo . :B0015_Sequence1 a sbol:Sequence ; - sbol:description "terminator sequence" ; + sbol:description "B0015 sequence" ; sbol:displayId "B0015_Sequence1" ; sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -98,7 +102,7 @@ :GFP_protein a sbol:Component ; sbol:description "GFP" ; sbol:displayId "GFP_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "GFP" ; sbol:type SBO:0000252 . @@ -106,20 +110,22 @@ sbol:description "Screening plasmid intermediate" ; sbol:displayId "i13504" ; sbol:hasFeature , , , , ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :i13504_Sequence1 ; sbol:name "i13504" ; - sbol:role SO:0000704 ; + sbol:role SO:0000804 ; sbol:type SBO:0000251 . :j23101 a sbol:Component ; sbol:displayId "j23101" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; + sbol:role SO:0000704 ; sbol:type SBO:0000251 . :j23106 a sbol:Component ; sbol:displayId "j23106" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; + sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -145,7 +151,7 @@ sbol:displayId "i13504_Sequence1" ; sbol:elements "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -158,9 +164,9 @@ :B0034 a sbol:Component ; sbol:description "RBS (Elowitz 1999)" ; sbol:displayId "B0034" ; - sbol:hasNamespace ; - sbol:hasSequence :B0034_Sequence ; - sbol:name "B0034" ; + sbol:hasNamespace <../igem> ; + sbol:hasSequence :B0034_Sequence1 ; + sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -168,7 +174,7 @@ sbol:displayId "i13504_system" ; sbol:hasFeature , , ; sbol:hasInteraction ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "i13504 system" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -178,12 +184,13 @@ sbol:displayId "Range1" ; sbol:end "826" ; sbol:hasSequence :i13504_Sequence1 ; + sbol:orientation SO:0001030 ; sbol:start "747" . :B0015 a sbol:Component ; sbol:description "B0015 double terminator" ; sbol:displayId "B0015" ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:hasSequence :B0015_Sequence1 ; sbol:name "terminator" ; sbol:role SO:0000141 ; @@ -202,11 +209,11 @@ sbol:orientation SO:0001030 . :E0040_Sequence1 a sbol:Sequence ; - sbol:description "gfp sequence" ; + sbol:description "E0040 sequence" ; sbol:displayId "E0040_Sequence1" ; sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" ; sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; sbol:name "Sequence1" . @@ -237,7 +244,8 @@ sbol:displayId "interlab16device2" ; sbol:hasConstraint ; sbol:hasFeature , , ; - sbol:hasNamespace ; + sbol:hasNamespace <../igem> ; + sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -245,6 +253,7 @@ sbol:displayId "Range1" ; sbol:end "746" ; sbol:hasSequence :i13504_Sequence1 ; + sbol:orientation SO:0001030 ; sbol:start "739" . diff --git a/SBOL3/combine2020/combine2020_ordered.nt b/SBOL3/combine2020/combine2020_ordered.nt index e89bcee..846d067 100644 --- a/SBOL3/combine2020/combine2020_ordered.nt +++ b/SBOL3/combine2020/combine2020_ordered.nt @@ -6,7 +6,7 @@ . . . - "terminator sequence" . + "B0015 sequence" . "B0015_Sequence1" . "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . . @@ -16,16 +16,18 @@ "RBS (Elowitz 1999)" . "B0034" . . - . - "B0034" . + . + "rbs" . . . . - "B0034_Sequence" . - "aaagaggagaaa" . - . - . - . + "B0034 sequence" . + "B0034_Sequence1" . + "aaagaggagaaa" . + . + . + "Sequence1" . + . "gfp coding sequence" . "E0040" . . @@ -34,7 +36,7 @@ . . . - "gfp sequence" . + "E0040 sequence" . "E0040_Sequence1" . "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . . @@ -50,6 +52,7 @@ "Range1" . "18" . . + . "13" . . "SequenceFeature1" . @@ -59,6 +62,7 @@ "Range1" . "746" . . + . "739" . . "SequenceFeature2" . @@ -66,7 +70,7 @@ . . "Range1" . - "11" . + "12" . . . "1" . @@ -90,6 +94,7 @@ "Range1" . "826" . . + . "747" . . "SubComponent3" . @@ -107,7 +112,7 @@ . . "i13504" . - . + . . . "i13504 sequence" . @@ -171,6 +176,7 @@ . . . + . . . "ComponentReference1" . @@ -194,13 +200,16 @@ . . . + . . . "j23101" . . + . . . "j23106" . . + . . . diff --git a/SBOL3/entity/annotation/annotation.jsonld b/SBOL3/entity/annotation/annotation.jsonld index f82e7f5..1ba995c 100644 --- a/SBOL3/entity/annotation/annotation.jsonld +++ b/SBOL3/entity/annotation/annotation.jsonld @@ -1,137 +1,129 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/BBa_J23119", - "@type" : "sbol:Component", - "belongsTo" : [ "https://sbolstandard.org/examples/iGEMRepository", "https://sbolstandard.org/examples/SynBioHubRepository" ], - "experienceURL" : "igem:Part:BBa_J23119:Experience", - "group" : "iGEM2006_Berkeley", - "hasInformation" : "https://sbolstandard.org/examples/BBa_J23119/information1", - "hasUsage" : "https://sbolstandard.org/examples/BBa_J23119/usage1", - "description" : "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library.", - "displayId" : "BBa_J23119", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "BBa_J23119 part", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/information1", - "@type" : [ "igem:Information", "sbol:Identified" ], - "regulation" : [ "//regulation/second_regulation", "//regulation/constitutive" ], - "sigmaFactor" : "//rnap/prokaryote/ecoli/sigma70", - "description" : "The experience page captures users' experience using the BBa_J23119 part", - "displayId" : "information1", - "name" : "BBa_J23119_experience" - }, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1", - "@type" : [ "sbol:Identified", "igem:IGEMUsage" ], - "inStock" : "true", - "registryStar" : "1", - "twinURLs" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts", - "twins" : "7", - "uses" : "442", - "description" : "BBa_J23119 usage statistics", - "displayId" : "usage1", - "name" : "BBa_J23119_usage" - }, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts", - "@type" : [ "igem:TwinPartUsage", "sbol:Identified" ], - "twinURL" : [ "igem:wiki/index.php?title=Part:BBa_M36800", "igem:wiki/index.php?title=Part:BBa_M1638", "igem:wiki/index.php?title=Part:BBa_J72073" ], - "displayId" : "twinParts", - "name" : "twin parts" - }, { - "@id" : "https://sbolstandard.org/examples/SynBioHubRepository", - "@type" : [ "igem:Repository", "sbol:TopLevel" ], - "displayId" : "SynBioHubRepository", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "SynBioHub" - }, { - "@id" : "https://sbolstandard.org/examples/iGEMRepository", - "@type" : [ "igem:Repository", "sbol:TopLevel" ], - "website" : "igem:Main_Page", - "description" : "Registry of Standard Biological Parts", - "displayId" : "iGEMRepository", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "iGEM Registry" - } ], - "@context" : { - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "registryStar" : { - "@id" : "http://parts.igem.org/registryStar" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "uses" : { - "@id" : "http://parts.igem.org/uses" - }, - "twinURLs" : { - "@id" : "http://parts.igem.org/twinURLs", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "twins" : { - "@id" : "http://parts.igem.org/twins" - }, - "inStock" : { - "@id" : "http://parts.igem.org/inStock" - }, - "website" : { - "@id" : "http://parts.igem.org/website", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "belongsTo" : { - "@id" : "http://parts.igem.org/belongsTo", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "hasInformation" : { - "@id" : "http://parts.igem.org/hasInformation", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "hasUsage" : { - "@id" : "http://parts.igem.org/hasUsage", - "@type" : "@id" - }, - "experienceURL" : { - "@id" : "http://parts.igem.org/experienceURL", - "@type" : "@id" - }, - "group" : { - "@id" : "http://parts.igem.org/group" - }, - "twinURL" : { - "@id" : "http://parts.igem.org/twinURL", - "@type" : "@id" - }, - "regulation" : { - "@id" : "http://parts.igem.org/regulation" - }, - "sigmaFactor" : { - "@id" : "http://parts.igem.org/sigmaFactor" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "igem" : "http://parts.igem.org/", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1", + "sbol:displayId": "usage1", + "igem:registryStar": "1", + "sbol:name": "BBa_J23119_usage", + "igem:uses": "442", + "igem:twinURLs": { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" + }, + "sbol:description": "BBa_J23119 usage statistics", + "@type": [ + "sbol:Identified", + "igem:IGEMUsage" + ], + "igem:twins": "7", + "igem:inStock": "true" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts", + "igem:twinURL": [ + { + "@id": "igem:wiki/index.php?title=Part:BBa_M36800" + }, + { + "@id": "igem:wiki/index.php?title=Part:BBa_M1638" + }, + { + "@id": "igem:wiki/index.php?title=Part:BBa_J72073" + } + ], + "sbol:name": "twin parts", + "@type": [ + "igem:TwinPartUsage", + "sbol:Identified" + ], + "sbol:displayId": "twinParts" + }, + { + "@id": "https://sbolstandard.org/examples/iGEMRepository", + "igem:website": { + "@id": "igem:Main_Page" + }, + "sbol:description": "Registry of Standard Biological Parts", + "sbol:name": "iGEM Registry", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "igem:Repository", + "sbol:TopLevel" + ], + "sbol:displayId": "iGEMRepository" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119", + "igem:belongsTo": [ + { + "@id": "https://sbolstandard.org/examples/iGEMRepository" + }, + { + "@id": "https://sbolstandard.org/examples/SynBioHubRepository" + } + ], + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:description": "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library.", + "igem:hasInformation": { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information1" + }, + "sbol:name": "BBa_J23119 part", + "sbol:type": { + "@id": "SBO:0000251" + }, + "igem:hasUsage": { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": "sbol:Component", + "igem:experienceURL": { + "@id": "igem:Part:BBa_J23119:Experience" + }, + "sbol:displayId": "BBa_J23119", + "igem:group": "iGEM2006_Berkeley" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information1", + "igem:regulation": [ + "//regulation/second_regulation", + "//regulation/constitutive" + ], + "igem:sigmaFactor": "//rnap/prokaryote/ecoli/sigma70", + "sbol:description": "The experience page captures users' experience using the BBa_J23119 part", + "sbol:name": "BBa_J23119_experience", + "@type": [ + "igem:Information", + "sbol:Identified" + ], + "sbol:displayId": "information1" + }, + { + "@id": "https://sbolstandard.org/examples/SynBioHubRepository", + "sbol:name": "SynBioHub", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "igem:Repository", + "sbol:TopLevel" + ], + "sbol:displayId": "SynBioHubRepository" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "igem": "http://parts.igem.org/", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/annotation/annotation.ttl b/SBOL3/entity/annotation/annotation.ttl index 67082b1..116033a 100644 --- a/SBOL3/entity/annotation/annotation.ttl +++ b/SBOL3/entity/annotation/annotation.ttl @@ -1,14 +1,14 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix igem: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . +@prefix igem: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:Identified , igem:IGEMUsage ; igem:inStock "true" ; @@ -24,7 +24,7 @@ igem:website igem:Main_Page ; sbol:description "Registry of Standard Biological Parts" ; sbol:displayId "iGEMRepository" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "iGEM Registry" . :BBa_J23119 a sbol:Component ; @@ -35,14 +35,14 @@ igem:hasUsage ; sbol:description "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." ; sbol:displayId "BBa_J23119" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "BBa_J23119 part" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . :SynBioHubRepository a igem:Repository , sbol:TopLevel ; sbol:displayId "SynBioHubRepository" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "SynBioHub" . diff --git a/SBOL3/entity/attachment/attachment.jsonld b/SBOL3/entity/attachment/attachment.jsonld index e57d3e4..f76ffb4 100644 --- a/SBOL3/entity/attachment/attachment.jsonld +++ b/SBOL3/entity/attachment/attachment.jsonld @@ -1,85 +1,78 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/attachment1", - "@type" : "sbol:Attachment", - "displayId" : "attachment1", - "format" : "EDAM:format_2585", - "hasNamespace" : "https://sbolstandard.org/examples", - "hash" : "aaa", - "hashAlgorithm" : "Alg1", - "size" : "1000", - "source" : "https://sbolstandard.org/attachment1" - }, { - "@id" : "https://sbolstandard.org/examples/impl1", - "@type" : "sbol:Implementation", - "built" : "https://sbolstandard.org/examples/TetR_protein", - "displayId" : "impl1", - "hasAttachment" : "https://sbolstandard.org/examples/attachment1", - "hasNamespace" : "https://sbolstandard.org/examples" - } ], - "@context" : { - "hashAlgorithm" : { - "@id" : "http://sbols.org/v3#hashAlgorithm" - }, - "hash" : { - "@id" : "http://sbols.org/v3#hash" - }, - "size" : { - "@id" : "http://sbols.org/v3#size" - }, - "format" : { - "@id" : "http://sbols.org/v3#format", - "@type" : "@id" - }, - "source" : { - "@id" : "http://sbols.org/v3#source", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "hasAttachment" : { - "@id" : "http://sbols.org/v3#hasAttachment", - "@type" : "@id" - }, - "built" : { - "@id" : "http://sbols.org/v3#built", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/attachment1", + "sbol:hash": "aaa", + "sbol:hashAlgorithm": "sha-256", + "sbol:size": "1000", + "sbol:format": { + "@id": "EDAM:format_2585" + }, + "sbol:source": { + "@id": "https://sbolstandard.org/attachment1" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "attachment1", + "@type": "sbol:Attachment" + }, + { + "@id": "https://sbolstandard.org/examples/impl1", + "sbol:hasAttachment": { + "@id": "https://sbolstandard.org/examples/attachment1" + }, + "sbol:built": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "impl1", + "@type": "sbol:Implementation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "TetR protein", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/attachment2", + "sbol:hash": "aaa", + "sbol:hashAlgorithm": "sha-256", + "sbol:size": "1000", + "sbol:format": { + "@id": "EDAM:format_2585" + }, + "sbol:source": { + "@id": "https://sbolstandard.org/attachment2" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "attachment2", + "@type": "sbol:Attachment" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/attachment/attachment.jsonld_expanded b/SBOL3/entity/attachment/attachment.jsonld_expanded index 0791a15..492ac19 100644 --- a/SBOL3/entity/attachment/attachment.jsonld_expanded +++ b/SBOL3/entity/attachment/attachment.jsonld_expanded @@ -21,12 +21,12 @@ "@type" : [ "http://sbols.org/v3#Component" ] }, { "@id" : "https://sbolstandard.org/examples/attachment1", - "http://sbols.org/v3#hashAlgorithm" : [ { - "@value" : "Alg1" - } ], "http://sbols.org/v3#hash" : [ { "@value" : "aaa" } ], + "http://sbols.org/v3#hashAlgorithm" : [ { + "@value" : "sha-256" + } ], "http://sbols.org/v3#size" : [ { "@value" : "1000" } ], @@ -43,6 +43,30 @@ "@value" : "attachment1" } ], "@type" : [ "http://sbols.org/v3#Attachment" ] +}, { + "@id" : "https://sbolstandard.org/examples/attachment2", + "http://sbols.org/v3#hash" : [ { + "@value" : "aaa" + } ], + "http://sbols.org/v3#hashAlgorithm" : [ { + "@value" : "sha-256" + } ], + "http://sbols.org/v3#size" : [ { + "@value" : "1000" + } ], + "http://sbols.org/v3#format" : [ { + "@id" : "https://identifiers.org/edam:format_2585" + } ], + "http://sbols.org/v3#source" : [ { + "@id" : "https://sbolstandard.org/attachment2" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "https://sbolstandard.org/examples" + } ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "attachment2" + } ], + "@type" : [ "http://sbols.org/v3#Attachment" ] }, { "@id" : "https://sbolstandard.org/examples/impl1", "http://sbols.org/v3#hasAttachment" : [ { diff --git a/SBOL3/entity/attachment/attachment.nt b/SBOL3/entity/attachment/attachment.nt index 695a4ab..c7e373b 100644 --- a/SBOL3/entity/attachment/attachment.nt +++ b/SBOL3/entity/attachment/attachment.nt @@ -1,5 +1,5 @@ - "Alg1" . "aaa" . + "sha-256" . "1000" . . . @@ -18,3 +18,11 @@ . "TetR_protein" . . + "aaa" . + "sha-256" . + "1000" . + . + . + . + "attachment2" . + . diff --git a/SBOL3/entity/attachment/attachment.rdf b/SBOL3/entity/attachment/attachment.rdf index 905b8e5..991e7a9 100644 --- a/SBOL3/entity/attachment/attachment.rdf +++ b/SBOL3/entity/attachment/attachment.rdf @@ -28,9 +28,18 @@ TetR_protein + + aaa + sha-256 + 1000 + + + + attachment2 + - Alg1 aaa + sha-256 1000 diff --git a/SBOL3/entity/attachment/attachment.rj b/SBOL3/entity/attachment/attachment.rj index 01b4f42..dadc50a 100644 --- a/SBOL3/entity/attachment/attachment.rj +++ b/SBOL3/entity/attachment/attachment.rj @@ -27,6 +27,49 @@ ] } , + "https://sbolstandard.org/examples/attachment2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "attachment2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Attachment" + } + ] , + "http://sbols.org/v3#format" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_2585" + } + ] , + "http://sbols.org/v3#hash" : [ { + "type" : "literal" , + "value" : "aaa" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#size" : [ { + "type" : "literal" , + "value" : "1000" + } + ] , + "http://sbols.org/v3#source" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/attachment2" + } + ] , + "http://sbols.org/v3#hashAlgorithm" : [ { + "type" : "literal" , + "value" : "sha-256" + } + ] + } + , "https://sbolstandard.org/examples/attachment1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , @@ -65,7 +108,7 @@ ] , "http://sbols.org/v3#hashAlgorithm" : [ { "type" : "literal" , - "value" : "Alg1" + "value" : "sha-256" } ] } diff --git a/SBOL3/entity/attachment/attachment.ttl b/SBOL3/entity/attachment/attachment.ttl index ae8bdb6..0482a46 100644 --- a/SBOL3/entity/attachment/attachment.ttl +++ b/SBOL3/entity/attachment/attachment.ttl @@ -1,33 +1,42 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :attachment1 a sbol:Attachment ; sbol:displayId "attachment1" ; sbol:format EDAM:format_2585 ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:hash "aaa" ; - sbol:hashAlgorithm "Alg1" ; + sbol:hashAlgorithm "sha-256" ; sbol:size "1000" ; - sbol:source . + sbol:source . :impl1 a sbol:Implementation ; sbol:built :TetR_protein ; sbol:displayId "impl1" ; sbol:hasAttachment :attachment1 ; - sbol:hasNamespace . + sbol:hasNamespace . :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . + +:attachment2 a sbol:Attachment ; + sbol:displayId "attachment2" ; + sbol:format EDAM:format_2585 ; + sbol:hasNamespace ; + sbol:hash "aaa" ; + sbol:hashAlgorithm "sha-256" ; + sbol:size "1000" ; + sbol:source . diff --git a/SBOL3/entity/attachment/attachment_ordered.nt b/SBOL3/entity/attachment/attachment_ordered.nt index c1ab5b9..e33856f 100644 --- a/SBOL3/entity/attachment/attachment_ordered.nt +++ b/SBOL3/entity/attachment/attachment_ordered.nt @@ -9,10 +9,18 @@ . . "aaa" . - "Alg1" . + "sha-256" . "1000" . . . + "attachment2" . + . + . + "aaa" . + "sha-256" . + "1000" . + . + . . "impl1" . . diff --git a/SBOL3/entity/collection/collection.jsonld b/SBOL3/entity/collection/collection.jsonld index ce854d7..7c718e7 100644 --- a/SBOL3/entity/collection/collection.jsonld +++ b/SBOL3/entity/collection/collection.jsonld @@ -1,62 +1,62 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "@type" : "sbol:Component", - "description" : "LacI protein", - "displayId" : "LacI_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LacI", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/col1", - "@type" : "sbol:Collection", - "displayId" : "col1", - "hasNamespace" : "https://sbolstandard.org/examples", - "member" : [ "https://sbolstandard.org/examples/LacI_protein", "https://sbolstandard.org/examples/TetR_protein" ] - } ], - "@context" : { - "member" : { - "@id" : "http://sbols.org/v3#member", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/col1", + "sbol:member": [ + { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "col1", + "@type": "sbol:Collection" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "LacI protein", + "sbol:name": "LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "LacI_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "TetR protein", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR_protein", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/collection/collection.ttl b/SBOL3/entity/collection/collection.ttl index 66e0475..93c841d 100644 --- a/SBOL3/entity/collection/collection.ttl +++ b/SBOL3/entity/collection/collection.ttl @@ -1,23 +1,23 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :col1 a sbol:Collection ; sbol:displayId "col1" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:member :LacI_protein , :TetR_protein . :LacI_protein a sbol:Component ; sbol:description "LacI protein" ; sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LacI" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -25,7 +25,7 @@ :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld index 748ec92..1acf3dc 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld @@ -1,28 +1,21 @@ { - "@id" : "urn:uuid:f8e709e1-2cac-43ab-bdca-796ee2d7755b", - "@type" : "sbol:Component", - "hasNamespace" : "urn:uuid:d8338ec9-2ec5-4231-9081-541d94efc7da", - "name" : "TetR", - "type" : "SBO:0000252", - "@context" : { - "name" : { - "@id" : "http://sbols.org/v3#name" + "@id": "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" + "sbol:type": { + "@id": "SBO:0000252" }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@type": "sbol:Component", + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded index 8f8a89a..38deb3b 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded @@ -1,10 +1,10 @@ [ { - "@id" : "urn:uuid:f8e709e1-2cac-43ab-bdca-796ee2d7755b", + "@id" : "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a", "http://sbols.org/v3#name" : [ { "@value" : "TetR" } ], "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "urn:uuid:d8338ec9-2ec5-4231-9081-541d94efc7da" + "@id" : "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" } ], "http://sbols.org/v3#type" : [ { "@id" : "https://identifiers.org/SBO:0000252" diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.nt b/SBOL3/entity/component_urn_uri/component_urn_uri.nt index 9020f38..788e865 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.nt @@ -1,4 +1,4 @@ - "TetR" . - . - . - . + "TetR" . + . + . + . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf index f69b309..ac39155 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf @@ -10,9 +10,9 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - + TetR - + diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rj b/SBOL3/entity/component_urn_uri/component_urn_uri.rj index 4477a8e..f1f6eb2 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rj +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rj @@ -1,5 +1,5 @@ { - "urn:uuid:f8e709e1-2cac-43ab-bdca-796ee2d7755b" : { + "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a" : { "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -7,7 +7,7 @@ ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "urn:uuid:d8338ec9-2ec5-4231-9081-541d94efc7da" + "value" : "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" } ] , "http://sbols.org/v3#name" : [ { diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl index cb3d729..4a48313 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl @@ -1,16 +1,16 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . - + a sbol:Component ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt index e12ac70..e623088 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt @@ -1,4 +1,4 @@ - . - "TetR" . - . - . + . + "TetR" . + . + . diff --git a/SBOL3/entity/implementation/implementation.jsonld b/SBOL3/entity/implementation/implementation.jsonld index a36ecd9..d9b2138 100644 --- a/SBOL3/entity/implementation/implementation.jsonld +++ b/SBOL3/entity/implementation/implementation.jsonld @@ -1,53 +1,41 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/impl1", - "@type" : "sbol:Implementation", - "built" : "https://sbolstandard.org/examples/TetR_protein", - "displayId" : "impl1", - "hasNamespace" : "https://sbolstandard.org/examples" - } ], - "@context" : { - "built" : { - "@id" : "http://sbols.org/v3#built", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/impl1", + "sbol:built": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "impl1", + "@type": "sbol:Implementation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "TetR protein", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR_protein", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/implementation/implementation.ttl b/SBOL3/entity/implementation/implementation.ttl index 733a25e..bed490a 100644 --- a/SBOL3/entity/implementation/implementation.ttl +++ b/SBOL3/entity/implementation/implementation.ttl @@ -1,23 +1,23 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :impl1 a sbol:Implementation ; sbol:built :TetR_protein ; sbol:displayId "impl1" ; - sbol:hasNamespace . + sbol:hasNamespace . :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/interface/interface.jsonld b/SBOL3/entity/interface/interface.jsonld index 36271e6..c8cd55c 100644 --- a/SBOL3/entity/interface/interface.jsonld +++ b/SBOL3/entity/interface/interface.jsonld @@ -1,118 +1,135 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer", - "@type" : "sbol:Component", - "description" : "LacI producer", - "displayId" : "LacI_producer", - "hasFeature" : [ "https://sbolstandard.org/examples/LacI_producer/SubComponent1", "https://sbolstandard.org/examples/LacI_producer/SubComponent2", "https://sbolstandard.org/examples/LacI_producer/SubComponent3" ], - "hasInterface" : "https://sbolstandard.org/examples/LacI_producer/Interface1", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LacI produce", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interface1", - "@type" : "sbol:Interface", - "displayId" : "Interface1", - "input" : [ "https://sbolstandard.org/examples/LacI_producer/SubComponent2", "https://sbolstandard.org/examples/LacI_producer/SubComponent1" ], - "nondirectional" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "output" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/LacI_protein" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/TetR_protein" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/aTC" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "@type" : "sbol:Component", - "description" : "LacI protein", - "displayId" : "LacI_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LacI", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/aTC", - "@type" : "sbol:Component", - "description" : "aTC", - "displayId" : "aTC", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "aTC", - "role" : "CHEBI:35224", - "type" : "SBO:0000247" - } ], - "@context" : { - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasInterface" : { - "@id" : "http://sbols.org/v3#hasInterface", - "@type" : "@id" - }, - "nondirectional" : { - "@id" : "http://sbols.org/v3#nondirectional", - "@type" : "@id" - }, - "output" : { - "@id" : "http://sbols.org/v3#output", - "@type" : "@id" - }, - "input" : { - "@id" : "http://sbols.org/v3#input", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "LacI protein", + "sbol:name": "LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "LacI_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "TetR protein", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + } + ], + "@type": "sbol:Component", + "sbol:description": "LacI producer", + "sbol:hasInterface": { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interface1" + }, + "sbol:displayId": "LacI_producer", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:name": "LacI produce" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interface1", + "sbol:nondirectional": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + "sbol:output": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + "sbol:input": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + } + ], + "sbol:displayId": "Interface1", + "@type": "sbol:Interface" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/aTC" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/aTC", + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:description": "aTC", + "sbol:name": "aTC", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:displayId": "aTC", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/interface/interface.ttl b/SBOL3/entity/interface/interface.ttl index f0f08f3..7abac2c 100644 --- a/SBOL3/entity/interface/interface.ttl +++ b/SBOL3/entity/interface/interface.ttl @@ -1,13 +1,13 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:SubComponent ; @@ -17,7 +17,7 @@ :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -27,7 +27,7 @@ sbol:displayId "LacI_producer" ; sbol:hasFeature , , ; sbol:hasInterface ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LacI produce" ; sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -47,7 +47,7 @@ :LacI_protein a sbol:Component ; sbol:description "LacI protein" ; sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LacI" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -60,7 +60,7 @@ :aTC a sbol:Component ; sbol:description "aTC" ; sbol:displayId "aTC" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "aTC" ; sbol:role CHEBI:35224 ; sbol:type SBO:0000247 . diff --git a/SBOL3/entity/model/model.jsonld b/SBOL3/entity/model/model.jsonld index 243181e..9b1550b 100644 --- a/SBOL3/entity/model/model.jsonld +++ b/SBOL3/entity/model/model.jsonld @@ -1,63 +1,47 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/model1", - "@type" : "sbol:Model", - "displayId" : "model1", - "framework" : "SBO:0000062", - "hasNamespace" : "https://sbolstandard.org", - "language" : "EDAM:format_2585", - "source" : "http://virtualparts.org" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "@type" : "sbol:Component", - "description" : "Toggle Switch genetic circuit", - "displayId" : "toggle_switch", - "hasModel" : "https://sbolstandard.org/examples/model1", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Toggle Switch", - "type" : "SBO:0000241" - } ], - "@context" : { - "hasModel" : { - "@id" : "http://sbols.org/v3#hasModel", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "framework" : { - "@id" : "http://sbols.org/v3#framework", - "@type" : "@id" - }, - "source" : { - "@id" : "http://sbols.org/v3#source", - "@type" : "@id" - }, - "language" : { - "@id" : "http://sbols.org/v3#language", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:hasModel": { + "@id": "https://sbolstandard.org/examples/model1" + }, + "sbol:description": "Toggle Switch genetic circuit", + "sbol:name": "Toggle Switch", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "toggle_switch", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/model1", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org" + }, + "sbol:framework": { + "@id": "SBO:0000062" + }, + "sbol:source": { + "@id": "http://virtualparts.org" + }, + "sbol:language": { + "@id": "EDAM:format_2585" + }, + "sbol:displayId": "model1", + "@type": "sbol:Model" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/entity/model/model.ttl b/SBOL3/entity/model/model.ttl index 641abda..c8c75db 100644 --- a/SBOL3/entity/model/model.ttl +++ b/SBOL3/entity/model/model.ttl @@ -1,19 +1,19 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :toggle_switch a sbol:Component ; sbol:description "Toggle Switch genetic circuit" ; sbol:displayId "toggle_switch" ; sbol:hasModel :model1 ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Toggle Switch" ; sbol:type SBO:0000241 . diff --git a/SBOL3/measurement_entity/measurement/measurement.jsonld b/SBOL3/measurement_entity/measurement/measurement.jsonld index c6c013e..e3743b7 100644 --- a/SBOL3/measurement_entity/measurement/measurement.jsonld +++ b/SBOL3/measurement_entity/measurement/measurement.jsonld @@ -1,212 +1,236 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA", - "@type" : "sbol:Component", - "description" : "M9 Glucose CAA growth media", - "displayId" : "M9_Glucose_CAA", - "hasFeature" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "M9 Glucose CAA", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "@type" : "sbol:ExternallyDefined", - "definition" : "CHEBI:3312", - "displayId" : "ExternallyDefined1", - "hasMeasure" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "@type" : [ "sbol:Identified", "om:Measure" ], - "displayId" : "measure1", - "type" : [ "SBO:0000197", "SBO:0000196" ], - "hasNumericalValue" : "0.1", - "hasUnit" : "https://sbolstandard.org/examples/millimolePerLitre" - }, { - "@id" : "https://sbolstandard.org/examples/cubicMeter", - "@type" : [ "sbol:TopLevel", "om:UnitExponentiation" ], - "displayId" : "cubicMeter", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "cubicMeter", - "hasBase" : "https://sbolstandard.org/examples/meter", - "hasExponent" : "3", - "label" : "cubicMeter", - "symbol" : "m3" - }, { - "@id" : "https://sbolstandard.org/examples/kelvin", - "@type" : [ "sbol:TopLevel", "om:SingularUnit" ], - "displayId" : "kelvin", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "kelvin", - "label" : "kelvin", - "symbol" : "kelvin" - }, { - "@id" : "https://sbolstandard.org/examples/kelvinMole", - "@type" : [ "sbol:TopLevel", "om:UnitMultiplication" ], - "displayId" : "kelvinMole", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "kelvinMole", - "hasTerm1" : "https://sbolstandard.org/examples/kelvin", - "hasTerm2" : "https://sbolstandard.org/examples/mole", - "label" : "kelvinMole", - "symbol" : "K mol" - }, { - "@id" : "https://sbolstandard.org/examples/litre", - "@type" : [ "sbol:TopLevel", "om:SingularUnit" ], - "description" : "The litre is a unit of volume defined as 1.0e-3 cubic metre.", - "displayId" : "litre", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "liter", - "alternativeLabel" : [ "litre2", "liter" ], - "alternativeSymbol" : [ "L2", "L" ], - "comment" : "The litre is a unit of volume defined as 1.0e-3 cubic metre.", - "hasFactor" : "0.001", - "label" : "liter", - "longcomment" : "This is an example long comment.", - "symbol" : "l" - }, { - "@id" : "https://sbolstandard.org/examples/meter", - "@type" : [ "sbol:TopLevel", "om:SingularUnit" ], - "displayId" : "meter", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "meter", - "label" : "meter", - "symbol" : "m" - }, { - "@id" : "https://sbolstandard.org/examples/milli", - "@type" : [ "om:SIPrefix", "sbol:TopLevel" ], - "description" : "Comment for the milli prefix.", - "displayId" : "milli", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "milli", - "alternativeLabel" : [ "milli1", "milli2" ], - "alternativeSymbol" : [ "m1", "m2" ], - "comment" : "Comment for the milli prefix.", - "hasFactor" : "0.001", - "label" : "milli", - "longcomment" : "This is an example long comment for the milli prefix.", - "symbol" : "m" - }, { - "@id" : "https://sbolstandard.org/examples/millimole", - "@type" : [ "sbol:TopLevel", "om:PrefixedUnit" ], - "displayId" : "millimole", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "millimole", - "hasPrefix" : "https://sbolstandard.org/examples/milli", - "hasUnit" : "https://sbolstandard.org/examples/mole", - "label" : "millimole", - "symbol" : "mmol" - }, { - "@id" : "https://sbolstandard.org/examples/millimolePerLitre", - "@type" : [ "sbol:TopLevel", "om:UnitDivision" ], - "displayId" : "millimolePerLitre", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "millimolar", - "hasDenominator" : "https://sbolstandard.org/examples/litre", - "hasNumerator" : "https://sbolstandard.org/examples/millimole", - "label" : "millimolar", - "symbol" : "mmol/l" - }, { - "@id" : "https://sbolstandard.org/examples/mole", - "@type" : [ "sbol:TopLevel", "om:SingularUnit" ], - "displayId" : "mole", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "mole", - "label" : "mole", - "symbol" : "mol" - } ], - "@context" : { - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "hasUnit" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit", - "@type" : "@id" - }, - "hasNumericalValue" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "hasMeasure" : { - "@id" : "http://sbols.org/v3#hasMeasure", - "@type" : "@id" - }, - "definition" : { - "@id" : "http://sbols.org/v3#definition", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "alternativeLabel" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" - }, - "symbol" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" - }, - "comment" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/comment" - }, - "label" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/label" - }, - "hasFactor" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" - }, - "longcomment" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" - }, - "alternativeSymbol" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" - }, - "hasExponent" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasExponent" - }, - "hasBase" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasBase", - "@type" : "@id" - }, - "hasTerm2" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm2", - "@type" : "@id" - }, - "hasTerm1" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm1", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasDenominator" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator", - "@type" : "@id" - }, - "hasNumerator" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator", - "@type" : "@id" - }, - "hasPrefix" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", + "sbol:type": [ + { + "@id": "SBO:0000197" + }, + { + "@id": "SBO:0000196" + } + ], + "om:hasUnit": { + "@id": "https://sbolstandard.org/examples/millimolePerLitre" + }, + "om:hasNumericalValue": "0.1", + "@type": [ + "sbol:Identified", + "om:Measure" + ], + "sbol:displayId": "measure1" + }, + { + "@id": "https://sbolstandard.org/examples/millimolePerLitre", + "om:hasDenominator": { + "@id": "https://sbolstandard.org/examples/litre" + }, + "om:hasNumerator": { + "@id": "https://sbolstandard.org/examples/millimole" + }, + "sbol:name": "millimolar", + "om:label": "millimolar", + "om:symbol": "mmol/l", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:UnitDivision" + ], + "sbol:displayId": "millimolePerLitre" + }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", + "sbol:hasMeasure": { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" + }, + "sbol:definition": { + "@id": "CHEBI:3312" + }, + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:displayId": "ExternallyDefined1", + "@type": "sbol:ExternallyDefined" + }, + { + "@id": "https://sbolstandard.org/examples/litre", + "sbol:description": "The litre is a unit of volume defined as 1.0e-3 cubic metre.", + "sbol:name": "liter", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "om:alternativeLabel": [ + "litre2", + "liter" + ], + "sbol:displayId": "litre", + "om:symbol": "l", + "om:comment": "The litre is a unit of volume defined as 1.0e-3 cubic metre.", + "om:label": "liter", + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "om:hasFactor": "0.001", + "om:longcomment": "This is an example long comment.", + "om:alternativeSymbol": [ + "L2", + "L" + ] + }, + { + "@id": "https://sbolstandard.org/examples/cubicMeter", + "om:hasExponent": "3", + "om:hasBase": { + "@id": "https://sbolstandard.org/examples/meter" + }, + "sbol:name": "cubicMeter", + "om:label": "cubicMeter", + "om:symbol": "m3", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:UnitExponentiation" + ], + "sbol:displayId": "cubicMeter" + }, + { + "@id": "https://sbolstandard.org/examples/meter", + "sbol:name": "meter", + "om:label": "meter", + "om:symbol": "m", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "meter" + }, + { + "@id": "https://sbolstandard.org/examples/kelvin", + "sbol:name": "kelvin", + "om:label": "kelvin", + "om:symbol": "kelvin", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "kelvin" + }, + { + "@id": "https://sbolstandard.org/examples/kelvinMole", + "om:hasTerm2": { + "@id": "https://sbolstandard.org/examples/mole" + }, + "om:hasTerm1": { + "@id": "https://sbolstandard.org/examples/kelvin" + }, + "sbol:name": "kelvinMole", + "om:label": "kelvinMole", + "om:symbol": "K mol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:UnitMultiplication" + ], + "sbol:displayId": "kelvinMole" + }, + { + "@id": "https://sbolstandard.org/examples/mole", + "sbol:name": "mole", + "om:label": "mole", + "om:symbol": "mol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "mole" + }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" + }, + "sbol:description": "M9 Glucose CAA growth media", + "sbol:name": "M9 Glucose CAA", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "M9_Glucose_CAA", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/millimole", + "om:hasPrefix": { + "@id": "https://sbolstandard.org/examples/milli" + }, + "om:hasUnit": { + "@id": "https://sbolstandard.org/examples/mole" + }, + "sbol:name": "millimole", + "om:label": "millimole", + "om:symbol": "mmol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "om:PrefixedUnit" + ], + "sbol:displayId": "millimole" + }, + { + "@id": "https://sbolstandard.org/examples/milli", + "om:alternativeLabel": [ + "milli1", + "milli2" + ], + "@type": [ + "om:SIPrefix", + "sbol:TopLevel" + ], + "om:alternativeSymbol": [ + "m1", + "m2" + ], + "om:longcomment": "This is an example long comment for the milli prefix.", + "om:label": "milli", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "milli", + "sbol:name": "milli", + "sbol:description": "Comment for the milli prefix.", + "om:symbol": "m", + "om:comment": "Comment for the milli prefix.", + "om:hasFactor": "0.001" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/measurement_entity/measurement/measurement.ttl b/SBOL3/measurement_entity/measurement/measurement.ttl index 1dd00c8..4bacb4e 100644 --- a/SBOL3/measurement_entity/measurement/measurement.ttl +++ b/SBOL3/measurement_entity/measurement/measurement.ttl @@ -1,13 +1,13 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:Identified , om:Measure ; @@ -26,7 +26,7 @@ :litre a sbol:TopLevel , om:SingularUnit ; sbol:description "The litre is a unit of volume defined as 1.0e-3 cubic metre." ; sbol:displayId "litre" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "liter" ; om:alternativeLabel "litre2" , "liter" ; om:alternativeSymbol "L2" , "L" ; @@ -38,7 +38,7 @@ :cubicMeter a sbol:TopLevel , om:UnitExponentiation ; sbol:displayId "cubicMeter" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "cubicMeter" ; om:hasBase :meter ; om:hasExponent "3" ; @@ -47,14 +47,14 @@ :kelvin a sbol:TopLevel , om:SingularUnit ; sbol:displayId "kelvin" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "kelvin" ; om:label "kelvin" ; om:symbol "kelvin" . :kelvinMole a sbol:TopLevel , om:UnitMultiplication ; sbol:displayId "kelvinMole" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "kelvinMole" ; om:hasTerm1 :kelvin ; om:hasTerm2 :mole ; @@ -65,27 +65,27 @@ sbol:description "M9 Glucose CAA growth media" ; sbol:displayId "M9_Glucose_CAA" ; sbol:hasFeature ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "M9 Glucose CAA" ; sbol:type SBO:0000241 . :mole a sbol:TopLevel , om:SingularUnit ; sbol:displayId "mole" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "mole" ; om:label "mole" ; om:symbol "mol" . :meter a sbol:TopLevel , om:SingularUnit ; sbol:displayId "meter" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "meter" ; om:label "meter" ; om:symbol "m" . :millimolePerLitre a sbol:TopLevel , om:UnitDivision ; sbol:displayId "millimolePerLitre" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "millimolar" ; om:hasDenominator :litre ; om:hasNumerator :millimole ; @@ -94,7 +94,7 @@ :millimole a sbol:TopLevel , om:PrefixedUnit ; sbol:displayId "millimole" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "millimole" ; om:hasPrefix :milli ; om:hasUnit :mole ; @@ -104,7 +104,7 @@ :milli a om:SIPrefix , sbol:TopLevel ; sbol:description "Comment for the milli prefix." ; sbol:displayId "milli" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "milli" ; om:alternativeLabel "milli1" , "milli2" ; om:alternativeSymbol "m1" , "m2" ; diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld index f0c4f37..e4f020e 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld @@ -1,71 +1,139 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA", - "@type" : "sbol:Component", - "description" : "M9 Glucose CAA growth media", - "displayId" : "M9_Glucose_CAA", - "hasFeature" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "M9 Glucose CAA", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "@type" : "sbol:ExternallyDefined", - "definition" : "CHEBI:3312", - "displayId" : "ExternallyDefined1", - "hasMeasure" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "@type" : [ "sbol:Identified", "om:Measure" ], - "displayId" : "measure1", - "hasNumericalValue" : "0.1", - "hasUnit" : "om:millimolePerLitre" - } ], - "@context" : { - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "hasMeasure" : { - "@id" : "http://sbols.org/v3#hasMeasure", - "@type" : "@id" - }, - "definition" : { - "@id" : "http://sbols.org/v3#definition", - "@type" : "@id" - }, - "hasUnit" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit", - "@type" : "@id" - }, - "hasNumericalValue" : { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "om:milli", + "om:hasFactor": "0.001", + "sbol:name": "milli", + "om:label": "milli", + "om:symbol": "m", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:SIPrefix" + ], + "sbol:displayId": "milli" + }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", + "om:hasUnit": { + "@id": "om:millimolePerLitre" + }, + "om:hasNumericalValue": "0.1", + "@type": [ + "sbol:Identified", + "om:Measure" + ], + "sbol:displayId": "measure1" + }, + { + "@id": "om:millimolePerLitre", + "om:hasDenominator": { + "@id": "om:litre" + }, + "om:hasNumerator": { + "@id": "om:millimole" + }, + "sbol:name": "millimolar", + "om:label": "millimolar", + "om:symbol": "mmol/l", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:UnitDivision" + ], + "sbol:displayId": "millimolePerLitre" + }, + { + "@id": "om:millimole", + "om:hasPrefix": { + "@id": "om:milli" + }, + "om:hasUnit": { + "@id": "om:mole" + }, + "sbol:name": "millimole", + "om:label": "millimole", + "om:symbol": "mmol", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:PrefixedUnit" + ], + "sbol:displayId": "millimole" + }, + { + "@id": "om:mole", + "sbol:name": "mole", + "om:label": "mole", + "om:symbol": "mol", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "mole" + }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", + "sbol:hasMeasure": { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" + }, + "sbol:definition": { + "@id": "CHEBI:3312" + }, + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:displayId": "ExternallyDefined1", + "@type": "sbol:ExternallyDefined" + }, + { + "@id": "om:litre", + "sbol:name": "liter", + "om:label": "liter", + "om:symbol": "l", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "litre" + }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" + }, + "sbol:description": "M9 Glucose CAA growth media", + "sbol:name": "M9 Glucose CAA", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "M9_Glucose_CAA", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded index 135a8ce..47e56a7 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded @@ -1,4 +1,109 @@ [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre", + "http://sbols.org/v3#name" : [ { + "@value" : "liter" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "@value" : "liter" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "@value" : "l" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } ], + "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "litre" + } ] +}, { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli", + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { + "@value" : "0.001" + } ], + "http://sbols.org/v3#name" : [ { + "@value" : "milli" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "@value" : "milli" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "@value" : "m" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } ], + "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "milli" + } ] +}, { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole", + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/mole" + } ], + "http://sbols.org/v3#name" : [ { + "@value" : "millimole" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "@value" : "millimole" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "@value" : "mmol" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } ], + "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "millimole" + } ] +}, { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre", + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" + } ], + "http://sbols.org/v3#name" : [ { + "@value" : "millimolar" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "@value" : "millimolar" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "@value" : "mmol/l" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } ], + "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "millimolePerLitre" + } ] +}, { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/mole", + "http://sbols.org/v3#name" : [ { + "@value" : "mole" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "@value" : "mole" + } ], + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "@value" : "mol" + } ], + "http://sbols.org/v3#hasNamespace" : [ { + "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } ], + "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "mole" + } ] +}, { "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA", "http://sbols.org/v3#hasFeature" : [ { "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt index 7edad6f..c8276c9 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt @@ -1,3 +1,44 @@ + "0.001" . + "milli" . + "milli" . + "m" . + . + . + "milli" . + . + . + "0.1" . + . + "measure1" . + . + . + . + "millimole" . + "millimole" . + "mmol" . + . + . + "millimole" . + . + . + . + . + "ExternallyDefined1" . + . + "mole" . + "mole" . + "mol" . + . + . + "mole" . + . + "liter" . + "liter" . + "l" . + . + . + "litre" . + . . "M9 Glucose CAA growth media" . "M9 Glucose CAA" . @@ -5,13 +46,12 @@ . "M9_Glucose_CAA" . . - . - . - . - "ExternallyDefined1" . - . - . - "0.1" . - . - "measure1" . - . + . + . + "millimolar" . + "millimolar" . + "mmol/l" . + . + . + "millimolePerLitre" . + . diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf index ad1172a..0ef58f6 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf @@ -15,7 +15,9 @@ - + + + 0.1 measure1 @@ -32,4 +34,51 @@ M9_Glucose_CAA + + liter + liter + l + + litre + + + + + + + + millimolar + millimolar + mmol/l + + millimolePerLitre + + + + 0.001 + milli + milli + m + + milli + + + + mole + mole + mol + + mole + + + + + + millimole + millimole + mmol + + millimole + + diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj index acabf99..2f5c372 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj @@ -1,4 +1,167 @@ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "litre" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "liter" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "liter" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "l" + } + ] + } + , + "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "millimolePerLitre" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "millimolar" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "millimolar" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "mmol/l" + } + ] + } + , + "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { + "type" : "literal" , + "value" : "0.001" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "milli" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "milli" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "milli" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "m" + } + ] + } + , + "http://www.ontology-of-units-of-measure.org/resource/om-2/mole" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "mole" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "mole" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "mole" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "mol" + } + ] + } + , "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , @@ -54,6 +217,53 @@ ] } , + "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "millimole" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "millimole" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/mole" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "millimole" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "mmol" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" + } + ] + } + , "https://sbolstandard.org/examples/M9_Glucose_CAA" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl index 6d56434..64a9c43 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl @@ -1,21 +1,36 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . -:M9_Glucose_CAA a sbol:Component ; - sbol:description "M9 Glucose CAA growth media" ; - sbol:displayId "M9_Glucose_CAA" ; - sbol:hasFeature ; - sbol:hasNamespace ; - sbol:name "M9 Glucose CAA" ; - sbol:type SBO:0000241 . +om:milli a sbol:TopLevel , om:SIPrefix ; + sbol:displayId "milli" ; + sbol:hasNamespace ; + sbol:name "milli" ; + om:hasFactor "0.001" ; + om:label "milli" ; + om:symbol "m" . + + + a sbol:Identified , om:Measure ; + sbol:displayId "measure1" ; + om:hasNumericalValue "0.1" ; + om:hasUnit om:millimolePerLitre . + +om:millimole a sbol:TopLevel , om:PrefixedUnit ; + sbol:displayId "millimole" ; + sbol:hasNamespace ; + sbol:name "millimole" ; + om:hasPrefix om:milli ; + om:hasUnit om:mole ; + om:label "millimole" ; + om:symbol "mmol" . a sbol:ExternallyDefined ; @@ -24,8 +39,33 @@ sbol:hasMeasure ; sbol:type SBO:0000247 . - - a sbol:Identified , om:Measure ; - sbol:displayId "measure1" ; - om:hasNumericalValue "0.1" ; - om:hasUnit om:millimolePerLitre . +om:mole a sbol:TopLevel , om:SingularUnit ; + sbol:displayId "mole" ; + sbol:hasNamespace ; + sbol:name "mole" ; + om:label "mole" ; + om:symbol "mol" . + +om:litre a sbol:TopLevel , om:SingularUnit ; + sbol:displayId "litre" ; + sbol:hasNamespace ; + sbol:name "liter" ; + om:label "liter" ; + om:symbol "l" . + +:M9_Glucose_CAA a sbol:Component ; + sbol:description "M9 Glucose CAA growth media" ; + sbol:displayId "M9_Glucose_CAA" ; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:name "M9 Glucose CAA" ; + sbol:type SBO:0000241 . + +om:millimolePerLitre a sbol:TopLevel , om:UnitDivision ; + sbol:displayId "millimolePerLitre" ; + sbol:hasNamespace ; + sbol:name "millimolar" ; + om:hasDenominator om:litre ; + om:hasNumerator om:millimole ; + om:label "millimolar" ; + om:symbol "mmol/l" . diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM_ordered.nt b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM_ordered.nt index 92590ff..b73b2b5 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM_ordered.nt +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM_ordered.nt @@ -1,3 +1,43 @@ + "litre" . + . + "liter" . + "liter" . + "l" . + . + . + "milli" . + . + "milli" . + "0.001" . + "milli" . + "m" . + . + . + "millimole" . + . + "millimole" . + . + . + "millimole" . + "mmol" . + . + . + "millimolePerLitre" . + . + "millimolar" . + . + . + "millimolar" . + "mmol/l" . + . + . + "mole" . + . + "mole" . + "mole" . + "mol" . + . + . "measure1" . "0.1" . . diff --git a/SBOL3/multicellular/multicellular.jsonld b/SBOL3/multicellular/multicellular.jsonld index a389bc4..c379b56 100644 --- a/SBOL3/multicellular/multicellular.jsonld +++ b/SBOL3/multicellular/multicellular.jsonld @@ -1,604 +1,1100 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/AHL", - "@type" : "sbol:Component", - "description" : "AHL", - "displayId" : "AHL", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "AHL", - "role" : "CHEBI:35224", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer", - "@type" : "sbol:Component", - "description" : "AHL producer", - "displayId" : "AHL_producer", - "hasFeature" : [ "https://sbolstandard.org/examples/AHL_producer/SubComponent3", "https://sbolstandard.org/examples/AHL_producer/SubComponent2", "https://sbolstandard.org/examples/AHL_producer/SubComponent1", "https://sbolstandard.org/examples/AHL_producer/SubComponent4", "https://sbolstandard.org/examples/AHL_producer/SubComponent5" ], - "hasInteraction" : "https://sbolstandard.org/examples/AHL_producer/Interaction1", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "AHL producer", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1", "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/pConstLuxI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/rbs_luxI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/luxI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent4", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent4", - "instanceOf" : "https://sbolstandard.org/examples/ter_luxI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent5", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver", - "@type" : "sbol:Component", - "description" : "AHL receiver", - "displayId" : "AHL_receiver", - "hasFeature" : [ "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", "https://sbolstandard.org/examples/AHL_receiver/SubComponent9", "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", "https://sbolstandard.org/examples/AHL_receiver/SubComponent2", "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" ], - "hasInteraction" : [ "https://sbolstandard.org/examples/AHL_receiver/Interaction4", "https://sbolstandard.org/examples/AHL_receiver/Interaction1", "https://sbolstandard.org/examples/AHL_receiver/Interaction2", "https://sbolstandard.org/examples/AHL_receiver/Interaction3" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "AHL receiver", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2", - "@type" : "sbol:Interaction", - "displayId" : "Interaction2", - "hasParticipation" : [ "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3", - "@type" : "sbol:Interaction", - "displayId" : "Interaction3", - "hasParticipation" : [ "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" ], - "type" : "SBO:0000170" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", - "role" : "SBO:0000643" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", - "role" : "SBO:0000459" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4", - "@type" : "sbol:Interaction", - "displayId" : "Interaction4", - "hasParticipation" : [ "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2", "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" ], - "type" : "SBO:0000177" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3", - "@type" : "sbol:Participation", - "displayId" : "Participation3", - "participant" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/pConstLuxR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent10", - "instanceOf" : "https://sbolstandard.org/examples/LuxR_protein" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent11", - "instanceOf" : "https://sbolstandard.org/examples/GFP_protein" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent12", - "instanceOf" : "https://sbolstandard.org/examples/LuxR_AHL" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/rbs_luxR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/luxR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent4", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent4", - "instanceOf" : "https://sbolstandard.org/examples/ter_luxR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent5", - "instanceOf" : "https://sbolstandard.org/examples/pLuxR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent6", - "instanceOf" : "https://sbolstandard.org/examples/rbs_gfp", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent7", - "instanceOf" : "https://sbolstandard.org/examples/gfp", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent8", - "instanceOf" : "https://sbolstandard.org/examples/ter_gfp", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent9", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - }, { - "@id" : "https://sbolstandard.org/examples/GFP_protein", - "@type" : "sbol:Component", - "description" : "GFP", - "displayId" : "GFP_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "GFP", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/LuxR_AHL", - "@type" : "sbol:Component", - "description" : "LuxR_AHL complex", - "displayId" : "LuxR_AHL", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LuxR_AHL", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/LuxR_protein", - "@type" : "sbol:Component", - "description" : "LuxR", - "displayId" : "LuxR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LuxR_protein", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem", - "@type" : "sbol:Component", - "description" : "Multicellular System", - "displayId" : "MulticellularSystem", - "hasConstraint" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "hasFeature" : [ "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "MulticellularSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "refersTo" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference2", - "inChildOf" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "refersTo" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/SenderSystem" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/ReceiverSystem" - }, { - "@id" : "https://sbolstandard.org/examples/OrganismA", - "@type" : "sbol:Component", - "description" : "Organism A", - "displayId" : "OrganismA", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "OrganismA", - "role" : "SBO:0000290", - "type" : "GO:0005623" - }, { - "@id" : "https://sbolstandard.org/examples/OrganismB", - "@type" : "sbol:Component", - "description" : "Organism B", - "displayId" : "OrganismB", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "OrganismB", - "role" : "SBO:0000290", - "type" : "GO:0005623" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem", - "@type" : "sbol:Component", - "description" : "Receiver System", - "displayId" : "ReceiverSystem", - "hasConstraint" : [ "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" ], - "hasFeature" : [ "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "ReceiverSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", - "refersTo" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint2", - "@type" : "sbol:Constraint", - "displayId" : "Constraint2", - "object" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", - "@type" : "sbol:Constraint", - "displayId" : "Constraint3", - "object" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/OrganismB" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/AHL_receiver" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem", - "@type" : "sbol:Component", - "description" : "Sender System", - "displayId" : "SenderSystem", - "hasConstraint" : [ "https://sbolstandard.org/examples/SenderSystem/Constraint1", "https://sbolstandard.org/examples/SenderSystem/Constraint3", "https://sbolstandard.org/examples/SenderSystem/Constraint2" ], - "hasFeature" : [ "https://sbolstandard.org/examples/SenderSystem/SubComponent1", "https://sbolstandard.org/examples/SenderSystem/ComponentReference1", "https://sbolstandard.org/examples/SenderSystem/SubComponent3", "https://sbolstandard.org/examples/SenderSystem/SubComponent2" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "SenderSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3", - "refersTo" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint2", - "@type" : "sbol:Constraint", - "displayId" : "Constraint2", - "object" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint3", - "@type" : "sbol:Constraint", - "displayId" : "Constraint3", - "object" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/OrganismA" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/AHL_producer" - }, { - "@id" : "https://sbolstandard.org/examples/gfp", - "@type" : "sbol:Component", - "description" : "gfp coding sequence", - "displayId" : "gfp", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "gfp", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/luxI", - "@type" : "sbol:Component", - "description" : "luxI coding sequence", - "displayId" : "luxI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "luxI", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/luxR", - "@type" : "sbol:Component", - "description" : "luxR coding sequence", - "displayId" : "luxR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "luxR", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/pConstLuxI", - "@type" : "sbol:Component", - "description" : "Constitutive promoter", - "displayId" : "pConstLuxI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "pConstLuxI", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/pConstLuxR", - "@type" : "sbol:Component", - "description" : "Constituve promoter", - "displayId" : "pConstLuxR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "pLuxR", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/pLuxR", - "@type" : "sbol:Component", - "description" : "LuxR inducible promoter", - "displayId" : "pLuxR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "pLuxR", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_gfp", - "@type" : "sbol:Component", - "description" : "RBS", - "displayId" : "rbs_gfp", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_luxI", - "@type" : "sbol:Component", - "description" : "RBS", - "displayId" : "rbs_luxI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_luxR", - "@type" : "sbol:Component", - "description" : "RBS", - "displayId" : "rbs_luxR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/ter_gfp", - "@type" : "sbol:Component", - "description" : "Terminator", - "displayId" : "ter_gfp", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "gfp terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/ter_luxI", - "@type" : "sbol:Component", - "description" : "Terminator", - "displayId" : "ter_luxI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "luxI terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/ter_luxR", - "@type" : "sbol:Component", - "description" : "Terminator", - "displayId" : "ter_luxR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "luxR terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - } ], - "@context" : { - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "hasParticipation" : { - "@id" : "http://sbols.org/v3#hasParticipation", - "@type" : "@id" - }, - "participant" : { - "@id" : "http://sbols.org/v3#participant", - "@type" : "@id" - }, - "refersTo" : { - "@id" : "http://sbols.org/v3#refersTo", - "@type" : "@id" - }, - "inChildOf" : { - "@id" : "http://sbols.org/v3#inChildOf", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasConstraint" : { - "@id" : "http://sbols.org/v3#hasConstraint", - "@type" : "@id" - }, - "subject" : { - "@id" : "http://sbols.org/v3#subject", - "@type" : "@id" - }, - "restriction" : { - "@id" : "http://sbols.org/v3#restriction", - "@type" : "@id" - }, - "object" : { - "@id" : "http://sbols.org/v3#object", - "@type" : "@id" - }, - "orientation" : { - "@id" : "http://sbols.org/v3#orientation", - "@type" : "@id" - }, - "hasInteraction" : { - "@id" : "http://sbols.org/v3#hasInteraction", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/rbs_luxR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_luxR", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "AHL", + "sbol:description": "AHL", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LuxR_protein" + }, + "sbol:displayId": "SubComponent10", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + }, + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/GFP_protein" + }, + "sbol:displayId": "SubComponent11", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000459" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LuxR_AHL" + }, + "sbol:displayId": "SubComponent12", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent9", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:description": "Multicellular System", + "@type": "sbol:Component", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + }, + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:name": "MulticellularSystem", + "sbol:displayId": "MulticellularSystem" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/SenderSystem" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + } + ], + "sbol:description": "Sender System", + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint3" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2" + } + ], + "sbol:name": "SenderSystem", + "sbol:displayId": "SenderSystem", + "@type": "sbol:Component", + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:type": { + "@id": "SBO:0000241" + } + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/OrganismA" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint3", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:displayId": "Constraint3", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + }, + "sbol:displayId": "Constraint2", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL_producer" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:description": "AHL producer", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + } + ], + "sbol:displayId": "AHL_producer", + "sbol:hasInteraction": { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "@type": "sbol:Component", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:name": "AHL producer" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pLuxR" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/pLuxR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pLuxR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pLuxR", + "sbol:description": "LuxR inducible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ter_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "gfp terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_gfp", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_gfp", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pConstLuxI" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/pConstLuxI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pConstLuxI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pConstLuxI", + "sbol:description": "Constitutive promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/luxR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "luxR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "luxR", + "sbol:description": "luxR coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000643" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/pConstLuxR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pLuxR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pConstLuxR", + "sbol:description": "Constituve promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3" + } + ], + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" + } + ], + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:name": "AHL receiver", + "@type": "sbol:Component", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "AHL_receiver", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:description": "AHL receiver" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4", + "sbol:type": { + "@id": "SBO:0000177" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" + } + ], + "sbol:displayId": "Interaction4", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/gfp" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_gfp" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_gfp" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pConstLuxR" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/luxR" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_luxR" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_luxR" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3", + "sbol:type": { + "@id": "SBO:0000170" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/OrganismB" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/OrganismB", + "sbol:type": { + "@id": "GO:0005623" + }, + "sbol:role": { + "@id": "SBO:0000290" + }, + "sbol:name": "OrganismB", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "OrganismB", + "sbol:description": "Organism B", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint3", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/ter_luxR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "luxR terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_luxR", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + }, + "sbol:displayId": "Constraint2", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL_receiver" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/OrganismA", + "sbol:type": { + "@id": "GO:0005623" + }, + "sbol:role": { + "@id": "SBO:0000290" + }, + "sbol:name": "OrganismA", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "OrganismA", + "sbol:description": "Organism A", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LuxR_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "LuxR_protein", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "LuxR_protein", + "sbol:description": "LuxR", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "gfp", + "sbol:description": "gfp coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem", + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:description": "Receiver System", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + } + ], + "sbol:name": "ReceiverSystem", + "@type": "sbol:Component", + "sbol:displayId": "ReceiverSystem", + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" + } + ], + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/LuxR_AHL", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "LuxR_AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "LuxR_AHL", + "sbol:description": "LuxR_AHL complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_luxI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_luxI", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_luxI" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/ter_luxI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "luxI terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_luxI", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/luxI" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/GFP_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "GFP_protein", + "sbol:description": "GFP", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/luxI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "luxI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "luxI", + "sbol:description": "luxI coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_luxI" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/multicellular/multicellular.ttl b/SBOL3/multicellular/multicellular.ttl index 949d8f8..ca08577 100644 --- a/SBOL3/multicellular/multicellular.ttl +++ b/SBOL3/multicellular/multicellular.ttl @@ -1,18 +1,18 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :rbs_luxR a sbol:Component ; sbol:description "RBS" ; sbol:displayId "rbs_luxR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -63,7 +63,7 @@ sbol:displayId "MulticellularSystem" ; sbol:hasConstraint ; sbol:hasFeature , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "MulticellularSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -73,7 +73,7 @@ sbol:displayId "SenderSystem" ; sbol:hasConstraint , , ; sbol:hasFeature , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "SenderSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -106,7 +106,7 @@ :ter_gfp a sbol:Component ; sbol:description "Terminator" ; sbol:displayId "ter_gfp" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "gfp terminator" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . @@ -125,7 +125,7 @@ :rbs_gfp a sbol:Component ; sbol:description "RBS" ; sbol:displayId "rbs_gfp" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -139,7 +139,7 @@ :luxR a sbol:Component ; sbol:description "luxR coding sequence" ; sbol:displayId "luxR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "luxR" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -153,7 +153,7 @@ :pConstLuxR a sbol:Component ; sbol:description "Constituve promoter" ; sbol:displayId "pConstLuxR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "pLuxR" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . @@ -175,7 +175,7 @@ sbol:displayId "AHL_receiver" ; sbol:hasFeature , , , , , , , , , , , ; sbol:hasInteraction , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "AHL receiver" ; sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -213,7 +213,7 @@ :ter_luxR a sbol:Component ; sbol:description "Terminator" ; sbol:displayId "ter_luxR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "luxR terminator" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . @@ -232,7 +232,7 @@ :OrganismB a sbol:Component ; sbol:description "Organism B" ; sbol:displayId "OrganismB" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "OrganismB" ; sbol:role SBO:0000290 ; sbol:type GO:0005623 . @@ -262,7 +262,7 @@ :LuxR_protein a sbol:Component ; sbol:description "LuxR" ; sbol:displayId "LuxR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LuxR_protein" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -282,7 +282,7 @@ :gfp a sbol:Component ; sbol:description "gfp coding sequence" ; sbol:displayId "gfp" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "gfp" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -292,7 +292,7 @@ sbol:displayId "ReceiverSystem" ; sbol:hasConstraint , , ; sbol:hasFeature , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "ReceiverSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -300,7 +300,7 @@ :LuxR_AHL a sbol:Component ; sbol:description "LuxR_AHL complex" ; sbol:displayId "LuxR_AHL" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LuxR_AHL" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -308,7 +308,7 @@ :rbs_luxI a sbol:Component ; sbol:description "RBS" ; sbol:displayId "rbs_luxI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -321,7 +321,7 @@ :OrganismA a sbol:Component ; sbol:description "Organism A" ; sbol:displayId "OrganismA" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "OrganismA" ; sbol:role SBO:0000290 ; sbol:type GO:0005623 . @@ -348,7 +348,7 @@ :pLuxR a sbol:Component ; sbol:description "LuxR inducible promoter" ; sbol:displayId "pLuxR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "pLuxR" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . @@ -374,14 +374,14 @@ :GFP_protein a sbol:Component ; sbol:description "GFP" ; sbol:displayId "GFP_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "GFP" ; sbol:type SBO:0000252 . :luxI a sbol:Component ; sbol:description "luxI coding sequence" ; sbol:displayId "luxI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "luxI" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -403,7 +403,7 @@ sbol:displayId "AHL_producer" ; sbol:hasFeature , , , , ; sbol:hasInteraction ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "AHL producer" ; sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -417,7 +417,7 @@ :AHL a sbol:Component ; sbol:description "AHL" ; sbol:displayId "AHL" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "AHL" ; sbol:role CHEBI:35224 ; sbol:type SBO:0000247 . @@ -431,7 +431,7 @@ :pConstLuxI a sbol:Component ; sbol:description "Constitutive promoter" ; sbol:displayId "pConstLuxI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "pConstLuxI" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . @@ -445,7 +445,7 @@ :ter_luxI a sbol:Component ; sbol:description "Terminator" ; sbol:displayId "ter_luxI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "luxI terminator" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . diff --git a/SBOL3/multicellular_simple/multicellular_simple.jsonld b/SBOL3/multicellular_simple/multicellular_simple.jsonld index f796607..6142055 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.jsonld +++ b/SBOL3/multicellular_simple/multicellular_simple.jsonld @@ -1,189 +1,261 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/AHL", - "@type" : "sbol:Component", - "description" : "AHL", - "displayId" : "AHL", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "AHL", - "role" : "CHEBI:35224", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem", - "@type" : "sbol:Component", - "description" : "Multicellular System", - "displayId" : "MulticellularSystem", - "hasConstraint" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "hasFeature" : [ "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "MulticellularSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "refersTo" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference2", - "inChildOf" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "refersTo" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/SenderSystem" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/ReceiverSystem" - }, { - "@id" : "https://sbolstandard.org/examples/OrganismA", - "@type" : "sbol:Component", - "description" : "Organism A", - "displayId" : "OrganismA", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "OrganismA", - "role" : "SBO:0000290", - "type" : "GO:0005623" - }, { - "@id" : "https://sbolstandard.org/examples/OrganismB", - "@type" : "sbol:Component", - "description" : "Organism B", - "displayId" : "OrganismB", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "OrganismB", - "role" : "SBO:0000290", - "type" : "GO:0005623" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem", - "@type" : "sbol:Component", - "description" : "Receiver System", - "displayId" : "ReceiverSystem", - "hasConstraint" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "hasFeature" : [ "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "ReceiverSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/OrganismB" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem", - "@type" : "sbol:Component", - "description" : "Sender System", - "displayId" : "SenderSystem", - "hasConstraint" : "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "hasFeature" : [ "https://sbolstandard.org/examples/SenderSystem/SubComponent1", "https://sbolstandard.org/examples/SenderSystem/SubComponent2" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "SenderSystem", - "role" : "SBO:0000289", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "restriction" : "sbol:contains", - "subject" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/OrganismA" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/AHL" - } ], - "@context" : { - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasConstraint" : { - "@id" : "http://sbols.org/v3#hasConstraint", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "subject" : { - "@id" : "http://sbols.org/v3#subject", - "@type" : "@id" - }, - "restriction" : { - "@id" : "http://sbols.org/v3#restriction", - "@type" : "@id" - }, - "object" : { - "@id" : "http://sbols.org/v3#object", - "@type" : "@id" - }, - "refersTo" : { - "@id" : "http://sbols.org/v3#refersTo", - "@type" : "@id" - }, - "inChildOf" : { - "@id" : "http://sbols.org/v3#inChildOf", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/OrganismB" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/OrganismB", + "sbol:type": { + "@id": "GO:0005623" + }, + "sbol:role": { + "@id": "SBO:0000290" + }, + "sbol:name": "OrganismB", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "OrganismB", + "sbol:description": "Organism B", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem", + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:description": "Receiver System", + "sbol:name": "ReceiverSystem", + "@type": "sbol:Component", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + } + ], + "sbol:displayId": "ReceiverSystem", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:description": "Multicellular System", + "@type": "sbol:Component", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + }, + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:name": "MulticellularSystem", + "sbol:displayId": "MulticellularSystem" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + }, + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/SenderSystem" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/OrganismA" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/OrganismA", + "sbol:type": { + "@id": "GO:0005623" + }, + "sbol:role": { + "@id": "SBO:0000290" + }, + "sbol:name": "OrganismA", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "OrganismA", + "sbol:description": "Organism A", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "AHL", + "sbol:description": "AHL", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + } + ], + "sbol:description": "Sender System", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" + }, + "sbol:name": "SenderSystem", + "sbol:displayId": "SenderSystem", + "@type": "sbol:Component", + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:type": { + "@id": "SBO:0000241" + } + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/multicellular_simple/multicellular_simple.ttl b/SBOL3/multicellular_simple/multicellular_simple.ttl index 3b3ff89..ea2b3aa 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.ttl +++ b/SBOL3/multicellular_simple/multicellular_simple.ttl @@ -1,13 +1,13 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . a sbol:SubComponent ; @@ -19,7 +19,7 @@ sbol:displayId "ReceiverSystem" ; sbol:hasConstraint ; sbol:hasFeature , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "ReceiverSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -29,7 +29,7 @@ sbol:displayId "MulticellularSystem" ; sbol:hasConstraint ; sbol:hasFeature , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "MulticellularSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -67,7 +67,7 @@ :OrganismA a sbol:Component ; sbol:description "Organism A" ; sbol:displayId "OrganismA" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "OrganismA" ; sbol:role SBO:0000290 ; sbol:type GO:0005623 . @@ -94,7 +94,7 @@ sbol:displayId "SenderSystem" ; sbol:hasConstraint ; sbol:hasFeature , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "SenderSystem" ; sbol:role SBO:0000289 ; sbol:type SBO:0000241 . @@ -102,7 +102,7 @@ :AHL a sbol:Component ; sbol:description "AHL" ; sbol:displayId "AHL" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "AHL" ; sbol:role CHEBI:35224 ; sbol:type SBO:0000247 . @@ -110,7 +110,7 @@ :OrganismB a sbol:Component ; sbol:description "Organism B" ; sbol:displayId "OrganismB" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "OrganismB" ; sbol:role SBO:0000290 ; sbol:type GO:0005623 . diff --git a/SBOL3/provenance_entity/activity/activity.jsonld b/SBOL3/provenance_entity/activity/activity.jsonld index a3bb69d..a28b416 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld +++ b/SBOL3/provenance_entity/activity/activity.jsonld @@ -1,144 +1,165 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "@type" : [ "sbol:TopLevel", "prov:Plan" ], - "description" : "Optimisation protocol to improve the translation of mRNAs.", - "displayId" : "CodonOptimisationProtocol", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Codon Optimisation Protocol" - }, { - "@id" : "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "@type" : [ "sbol:TopLevel", "prov:Agent" ], - "description" : "Used to optimise bacterial DNA sequences.", - "displayId" : "CodonOptimiserSoftware", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Codon Optimiser Software" - }, { - "@id" : "https://sbolstandard.org/examples/RBS_optimisation_activity", - "@type" : [ "sbol:TopLevel", "prov:Activity" ], - "description" : "An activity that is used to RBSs", - "displayId" : "RBS_optimisation_activity", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "RBS optimization activity", - "type" : "sbol:design", - "wasInformedBy" : "https://sbolstandard.org/examples/codon_optimization_activity" - }, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity", - "@type" : [ "sbol:TopLevel", "prov:Activity" ], - "description" : "An activity that is used to optimise codons", - "displayId" : "codon_optimization_activity", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Codon optimization activity", - "type" : "sbol:design", - "endedAtTime" : "2020-08-30T15:42:23.277Z", - "qualifiedAssociation" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1", - "qualifiedUsage" : [ "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" ], - "startedAtTime" : "2019-07-29T15:42:23.277Z" - }, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1", - "@type" : [ "sbol:Identified", "prov:Association" ], - "displayId" : "Association1", - "agent" : "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "hadPlan" : "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "hadRole" : "sbol:design" - }, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", - "@type" : [ "sbol:Identified", "prov:Usage" ], - "displayId" : "Usage1", - "entity" : "https://sbolstandard.org/examples/toggle_switch", - "hadRole" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", - "@type" : [ "sbol:Identified", "prov:Usage" ], - "displayId" : "Usage2", - "entity" : "https://sbolstandard.org/examples/toggle_switch_optimised", - "hadRole" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "@type" : "sbol:Component", - "description" : "Toggle Switch genetic circuit", - "displayId" : "toggle_switch", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Toggle Switch", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch_optimised", - "@type" : "sbol:Component", - "description" : "Toggle Switch genetic circuit - codon optimised", - "displayId" : "toggle_switch_optimised", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Toggle Switch Optimised", - "type" : "SBO:0000241", - "wasDerivedFrom" : "https://sbolstandard.org/examples/toggle_switch", - "wasGeneratedBy" : "https://sbolstandard.org/examples/codon_optimization_activity" - } ], - "@context" : { - "wasDerivedFrom" : { - "@id" : "http://www.w3.org/ns/prov#wasDerivedFrom", - "@type" : "@id" - }, - "wasGeneratedBy" : { - "@id" : "http://www.w3.org/ns/prov#wasGeneratedBy", - "@type" : "@id" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "wasInformedBy" : { - "@id" : "http://www.w3.org/ns/prov#wasInformedBy", - "@type" : "@id" - }, - "hadRole" : { - "@id" : "http://www.w3.org/ns/prov#hadRole", - "@type" : "@id" - }, - "hadPlan" : { - "@id" : "http://www.w3.org/ns/prov#hadPlan", - "@type" : "@id" - }, - "agent" : { - "@id" : "http://www.w3.org/ns/prov#agent", - "@type" : "@id" - }, - "entity" : { - "@id" : "http://www.w3.org/ns/prov#entity", - "@type" : "@id" - }, - "startedAtTime" : { - "@id" : "http://www.w3.org/ns/prov#startedAtTime" - }, - "endedAtTime" : { - "@id" : "http://www.w3.org/ns/prov#endedAtTime" - }, - "qualifiedUsage" : { - "@id" : "http://www.w3.org/ns/prov#qualifiedUsage", - "@type" : "@id" - }, - "qualifiedAssociation" : { - "@id" : "http://www.w3.org/ns/prov#qualifiedAssociation", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch_optimised", + "prov:wasDerivedFrom": { + "@id": "https://sbolstandard.org/examples/toggle_switch" + }, + "prov:wasGeneratedBy": { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity" + }, + "sbol:description": "Toggle Switch genetic circuit - codon optimised", + "sbol:name": "Toggle Switch Optimised", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "toggle_switch_optimised", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:description": "Toggle Switch genetic circuit", + "sbol:name": "Toggle Switch", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "toggle_switch", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity", + "sbol:type": { + "@id": "sbol:design" + }, + "prov:startedAtTime": "2019-07-29T12:48:00.149Z", + "@type": [ + "sbol:TopLevel", + "prov:Activity" + ], + "sbol:name": "Codon optimization activity", + "sbol:description": "An activity that is used to optimise codons", + "prov:qualifiedUsage": [ + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" + }, + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" + } + ], + "sbol:displayId": "codon_optimization_activity", + "prov:endedAtTime": "2020-08-30T12:48:00.149Z", + "prov:qualifiedAssociation": { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } + }, + { + "@id": "https://sbolstandard.org/examples/CodonOptimiserSoftware", + "sbol:description": "Used to optimise bacterial DNA sequences.", + "sbol:name": "Codon Optimiser Software", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "prov:Agent" + ], + "sbol:displayId": "CodonOptimiserSoftware" + }, + { + "@id": "https://sbolstandard.org/examples/RBS_optimisation_activity", + "prov:wasInformedBy": { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity" + }, + "sbol:description": "An activity that is used to RBSs", + "sbol:name": "RBS optimization activity", + "sbol:type": { + "@id": "sbol:design" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "prov:Activity" + ], + "sbol:displayId": "RBS_optimisation_activity" + }, + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1", + "prov:hadRole": { + "@id": "sbol:design" + }, + "prov:hadPlan": { + "@id": "https://sbolstandard.org/examples/CodonOptimisationProtocol" + }, + "prov:agent": { + "@id": "https://sbolstandard.org/examples/CodonOptimiserSoftware" + }, + "@type": [ + "sbol:Identified", + "prov:Association" + ], + "sbol:displayId": "Association1" + }, + { + "@id": "https://sbolstandard.org/examples/CodonOptimisationProtocol", + "sbol:description": "Optimisation protocol to improve the translation of mRNAs.", + "sbol:name": "Codon Optimisation Protocol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "prov:Plan" + ], + "sbol:displayId": "CodonOptimisationProtocol" + }, + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", + "prov:hadRole": { + "@id": "sbol:learn" + }, + "prov:entity": { + "@id": "https://sbolstandard.org/examples/toggle_switch" + }, + "@type": [ + "sbol:Identified", + "prov:Usage" + ], + "sbol:displayId": "Usage1" + }, + { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", + "prov:hadRole": { + "@id": "sbol:design" + }, + "prov:entity": { + "@id": "https://sbolstandard.org/examples/toggle_switch_optimised" + }, + "@type": [ + "sbol:Identified", + "prov:Usage" + ], + "sbol:displayId": "Usage2" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/provenance_entity/activity/activity.jsonld_expanded b/SBOL3/provenance_entity/activity/activity.jsonld_expanded index b487823..2dda253 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld_expanded +++ b/SBOL3/provenance_entity/activity/activity.jsonld_expanded @@ -55,12 +55,9 @@ "@id" : "http://sbols.org/v3#design" } ], "http://www.w3.org/ns/prov#startedAtTime" : [ { - "@value" : "2019-07-29T15:42:23.277Z" + "@value" : "2019-07-29T12:48:00.149Z" } ], "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Activity" ], - "http://www.w3.org/ns/prov#endedAtTime" : [ { - "@value" : "2020-08-30T15:42:23.277Z" - } ], "http://sbols.org/v3#name" : [ { "@value" : "Codon optimization activity" } ], @@ -75,6 +72,9 @@ "http://sbols.org/v3#displayId" : [ { "@value" : "codon_optimization_activity" } ], + "http://www.w3.org/ns/prov#endedAtTime" : [ { + "@value" : "2020-08-30T12:48:00.149Z" + } ], "http://www.w3.org/ns/prov#qualifiedAssociation" : [ { "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1" } ], @@ -99,7 +99,7 @@ }, { "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", "http://www.w3.org/ns/prov#hadRole" : [ { - "@id" : "https://identifiers.org/SBO:0000645" + "@id" : "http://sbols.org/v3#learn" } ], "http://www.w3.org/ns/prov#entity" : [ { "@id" : "https://sbolstandard.org/examples/toggle_switch" @@ -111,7 +111,7 @@ }, { "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", "http://www.w3.org/ns/prov#hadRole" : [ { - "@id" : "https://identifiers.org/SBO:0000011" + "@id" : "http://sbols.org/v3#design" } ], "http://www.w3.org/ns/prov#entity" : [ { "@id" : "https://sbolstandard.org/examples/toggle_switch_optimised" diff --git a/SBOL3/provenance_entity/activity/activity.nt b/SBOL3/provenance_entity/activity/activity.nt index 5d9a849..e8ae900 100644 --- a/SBOL3/provenance_entity/activity/activity.nt +++ b/SBOL3/provenance_entity/activity/activity.nt @@ -32,12 +32,12 @@ . "toggle_switch" . . - . + . . . "Usage1" . . - . + . . . "Usage2" . @@ -49,14 +49,14 @@ "CodonOptimisationProtocol" . . . - "2019-07-29T15:42:23.277Z" . + "2019-07-29T12:48:00.149Z" . . - "2020-08-30T15:42:23.277Z" . "Codon optimization activity" . "An activity that is used to optimise codons" . . . "codon_optimization_activity" . + "2020-08-30T12:48:00.149Z" . . . . diff --git a/SBOL3/provenance_entity/activity/activity.rdf b/SBOL3/provenance_entity/activity/activity.rdf index 9f244d9..d3b36c0 100644 --- a/SBOL3/provenance_entity/activity/activity.rdf +++ b/SBOL3/provenance_entity/activity/activity.rdf @@ -55,13 +55,12 @@ - 2019-07-29T15:42:23.277Z - 2020-08-30T15:42:23.277Z + 2019-07-29T12:48:00.149Z Codon optimization activity An activity that is used to optimise codons - + Usage2 @@ -69,6 +68,7 @@ codon_optimization_activity + 2020-08-30T12:48:00.149Z @@ -81,7 +81,7 @@ - + Usage1 diff --git a/SBOL3/provenance_entity/activity/activity.rj b/SBOL3/provenance_entity/activity/activity.rj index e65f5e8..5c9e14e 100644 --- a/SBOL3/provenance_entity/activity/activity.rj +++ b/SBOL3/provenance_entity/activity/activity.rj @@ -146,12 +146,12 @@ ] , "http://www.w3.org/ns/prov#endedAtTime" : [ { "type" : "literal" , - "value" : "2020-08-30T15:42:23.277Z" + "value" : "2020-08-30T12:48:00.149Z" } ] , "http://www.w3.org/ns/prov#startedAtTime" : [ { "type" : "literal" , - "value" : "2019-07-29T15:42:23.277Z" + "value" : "2019-07-29T12:48:00.149Z" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { @@ -296,7 +296,7 @@ ] , "http://www.w3.org/ns/prov#hadRole" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "http://sbols.org/v3#learn" } ] } @@ -323,7 +323,7 @@ ] , "http://www.w3.org/ns/prov#hadRole" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "http://sbols.org/v3#design" } ] } diff --git a/SBOL3/provenance_entity/activity/activity.ttl b/SBOL3/provenance_entity/activity/activity.ttl index e47bdce..d88f497 100644 --- a/SBOL3/provenance_entity/activity/activity.ttl +++ b/SBOL3/provenance_entity/activity/activity.ttl @@ -1,19 +1,19 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :toggle_switch_optimised a sbol:Component ; sbol:description "Toggle Switch genetic circuit - codon optimised" ; sbol:displayId "toggle_switch_optimised" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Toggle Switch Optimised" ; sbol:type SBO:0000241 ; prov:wasDerivedFrom :toggle_switch ; @@ -23,14 +23,14 @@ a sbol:TopLevel , prov:Agent ; sbol:description "Used to optimise bacterial DNA sequences." ; sbol:displayId "CodonOptimiserSoftware" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Codon Optimiser Software" . :RBS_optimisation_activity a sbol:TopLevel , prov:Activity ; sbol:description "An activity that is used to RBSs" ; sbol:displayId "RBS_optimisation_activity" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "RBS optimization activity" ; sbol:type sbol:design ; prov:wasInformedBy :codon_optimization_activity . @@ -45,7 +45,7 @@ :toggle_switch a sbol:Component ; sbol:description "Toggle Switch genetic circuit" ; sbol:displayId "toggle_switch" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Toggle Switch" ; sbol:type SBO:0000241 . @@ -53,29 +53,29 @@ a sbol:Identified , prov:Usage ; sbol:displayId "Usage1" ; prov:entity :toggle_switch ; - prov:hadRole SBO:0000645 . + prov:hadRole sbol:learn . a sbol:Identified , prov:Usage ; sbol:displayId "Usage2" ; prov:entity :toggle_switch_optimised ; - prov:hadRole SBO:0000011 . + prov:hadRole sbol:design . :CodonOptimisationProtocol a sbol:TopLevel , prov:Plan ; sbol:description "Optimisation protocol to improve the translation of mRNAs." ; sbol:displayId "CodonOptimisationProtocol" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Codon Optimisation Protocol" . :codon_optimization_activity a sbol:TopLevel , prov:Activity ; sbol:description "An activity that is used to optimise codons" ; sbol:displayId "codon_optimization_activity" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Codon optimization activity" ; sbol:type sbol:design ; - prov:endedAtTime "2020-08-30T15:42:23.277Z" ; + prov:endedAtTime "2020-08-30T12:48:00.149Z" ; prov:qualifiedAssociation ; prov:qualifiedUsage , ; - prov:startedAtTime "2019-07-29T15:42:23.277Z" . + prov:startedAtTime "2019-07-29T12:48:00.149Z" . diff --git a/SBOL3/provenance_entity/activity/activity_ordered.nt b/SBOL3/provenance_entity/activity/activity_ordered.nt index 194a068..02e9855 100644 --- a/SBOL3/provenance_entity/activity/activity_ordered.nt +++ b/SBOL3/provenance_entity/activity/activity_ordered.nt @@ -28,12 +28,12 @@ . . . - . + . "Usage2" . . . . - . + . "An activity that is used to optimise codons" . "codon_optimization_activity" . . @@ -41,11 +41,11 @@ . . . - "2020-08-30T15:42:23.277Z" . + "2020-08-30T12:48:00.149Z" . . . . - "2019-07-29T15:42:23.277Z" . + "2019-07-29T12:48:00.149Z" . "Toggle Switch genetic circuit" . "toggle_switch" . . diff --git a/SBOL3/provenance_entity/agent/agent.jsonld b/SBOL3/provenance_entity/agent/agent.jsonld index 7065dfa..12212b8 100644 --- a/SBOL3/provenance_entity/agent/agent.jsonld +++ b/SBOL3/provenance_entity/agent/agent.jsonld @@ -1,45 +1,40 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "@type" : [ "sbol:TopLevel", "prov:Agent" ], - "description" : "Used to optimise bacterial DNA sequences.", - "displayId" : "CodonOptimiserSoftware", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Codon Optimiser Software" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "@type" : "sbol:Component", - "description" : "Toggle Switch genetic circuit", - "displayId" : "toggle_switch", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Toggle Switch", - "type" : "SBO:0000241" - } ], - "@context" : { - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:description": "Toggle Switch genetic circuit", + "sbol:name": "Toggle Switch", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "toggle_switch", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/CodonOptimiserSoftware", + "sbol:description": "Used to optimise bacterial DNA sequences.", + "sbol:name": "Codon Optimiser Software", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "prov:Agent" + ], + "sbol:displayId": "CodonOptimiserSoftware" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/provenance_entity/agent/agent.ttl b/SBOL3/provenance_entity/agent/agent.ttl index b826643..da34eaf 100644 --- a/SBOL3/provenance_entity/agent/agent.ttl +++ b/SBOL3/provenance_entity/agent/agent.ttl @@ -1,18 +1,18 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :toggle_switch a sbol:Component ; sbol:description "Toggle Switch genetic circuit" ; sbol:displayId "toggle_switch" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Toggle Switch" ; sbol:type SBO:0000241 . @@ -20,5 +20,5 @@ a sbol:TopLevel , prov:Agent ; sbol:description "Used to optimise bacterial DNA sequences." ; sbol:displayId "CodonOptimiserSoftware" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Codon Optimiser Software" . diff --git a/SBOL3/provenance_entity/plan/plan.jsonld b/SBOL3/provenance_entity/plan/plan.jsonld index bca2b5f..659af73 100644 --- a/SBOL3/provenance_entity/plan/plan.jsonld +++ b/SBOL3/provenance_entity/plan/plan.jsonld @@ -1,31 +1,23 @@ { - "@id" : "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "@type" : [ "sbol:TopLevel", "prov:Plan" ], - "description" : "Optimisation protocol to improve the translation of mRNAs.", - "displayId" : "CodonOptimisationProtocol", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Codon Optimisation Protocol", - "@context" : { - "description" : { - "@id" : "http://sbols.org/v3#description" + "@id": "https://sbolstandard.org/examples/CodonOptimisationProtocol", + "sbol:description": "Optimisation protocol to improve the translation of mRNAs.", + "sbol:name": "Codon Optimisation Protocol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@type": [ + "sbol:TopLevel", + "prov:Plan" + ], + "sbol:displayId": "CodonOptimisationProtocol", + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/provenance_entity/plan/plan.ttl b/SBOL3/provenance_entity/plan/plan.ttl index dcfa2fa..47af01a 100644 --- a/SBOL3/provenance_entity/plan/plan.ttl +++ b/SBOL3/provenance_entity/plan/plan.ttl @@ -1,17 +1,17 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :CodonOptimisationProtocol a sbol:TopLevel , prov:Plan ; sbol:description "Optimisation protocol to improve the translation of mRNAs." ; sbol:displayId "CodonOptimisationProtocol" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Codon Optimisation Protocol" . diff --git a/SBOL3/toggle_switch/toggle_switch.jsonld b/SBOL3/toggle_switch/toggle_switch.jsonld index b4aa629..070dac7 100644 --- a/SBOL3/toggle_switch/toggle_switch.jsonld +++ b/SBOL3/toggle_switch/toggle_switch.jsonld @@ -1,555 +1,1003 @@ { - "@graph" : [ { - "@id" : "https://sbolstandard.org/examples/GFP_protein", - "@type" : "sbol:Component", - "description" : "GFP", - "displayId" : "GFP_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "GFP", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/IPTG", - "@type" : "sbol:Component", - "description" : "IPTG", - "displayId" : "IPTG", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "IPTG", - "role" : "CHEBI:35224", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/IPTG_LacI", - "@type" : "sbol:Component", - "description" : "IPTG_LacI complex", - "displayId" : "IPTG_LacI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "IPTG_LacI", - "type" : "SBO:0000253" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer", - "@type" : "sbol:Component", - "description" : "LacI producer", - "displayId" : "LacI_producer", - "hasFeature" : [ "https://sbolstandard.org/examples/LacI_producer/SubComponent1", "https://sbolstandard.org/examples/LacI_producer/SubComponent5", "https://sbolstandard.org/examples/LacI_producer/SubComponent10", "https://sbolstandard.org/examples/LacI_producer/SubComponent2", "https://sbolstandard.org/examples/LacI_producer/SubComponent8", "https://sbolstandard.org/examples/LacI_producer/SubComponent9", "https://sbolstandard.org/examples/LacI_producer/SubComponent3", "https://sbolstandard.org/examples/LacI_producer/SubComponent6", "https://sbolstandard.org/examples/LacI_producer/SubComponent7", "https://sbolstandard.org/examples/LacI_producer/SubComponent4" ], - "hasInteraction" : [ "https://sbolstandard.org/examples/LacI_producer/Interaction3", "https://sbolstandard.org/examples/LacI_producer/Interaction2", "https://sbolstandard.org/examples/LacI_producer/Interaction1", "https://sbolstandard.org/examples/LacI_producer/Interaction4" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LacI producer", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2", - "@type" : "sbol:Interaction", - "displayId" : "Interaction2", - "hasParticipation" : [ "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3", - "@type" : "sbol:Interaction", - "displayId" : "Interaction3", - "hasParticipation" : [ "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" ], - "type" : "SBO:0000169" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "role" : "SBO:0000642" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9", - "role" : "SBO:0000019" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4", - "@type" : "sbol:Interaction", - "displayId" : "Interaction4", - "hasParticipation" : [ "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" ], - "type" : "SBO:0000177" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", - "@type" : "sbol:Participation", - "displayId" : "Participation3", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/pTetR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent10", - "instanceOf" : "https://sbolstandard.org/examples/aTC" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/rbs_lacI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/lacI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent4", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent4", - "instanceOf" : "https://sbolstandard.org/examples/rbs_gfp", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent5", - "instanceOf" : "https://sbolstandard.org/examples/gfp", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent6", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent6", - "instanceOf" : "https://sbolstandard.org/examples/ter_lacI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent7", - "instanceOf" : "https://sbolstandard.org/examples/LacI_protein" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent8", - "instanceOf" : "https://sbolstandard.org/examples/GFP_protein" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent9", - "instanceOf" : "https://sbolstandard.org/examples/TetR_protein" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "@type" : "sbol:Component", - "description" : "LacI protein", - "displayId" : "LacI_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "LacI", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer", - "@type" : "sbol:Component", - "description" : "TetR producer", - "displayId" : "TetR_producer", - "hasFeature" : [ "https://sbolstandard.org/examples/TetR_producer/SubComponent2", "https://sbolstandard.org/examples/TetR_producer/SubComponent7", "https://sbolstandard.org/examples/TetR_producer/SubComponent5", "https://sbolstandard.org/examples/TetR_producer/SubComponent3", "https://sbolstandard.org/examples/TetR_producer/SubComponent8", "https://sbolstandard.org/examples/TetR_producer/SubComponent1", "https://sbolstandard.org/examples/TetR_producer/SubComponent6", "https://sbolstandard.org/examples/TetR_producer/SubComponent4", "https://sbolstandard.org/examples/TetR_producer/SubComponent9" ], - "hasInteraction" : [ "https://sbolstandard.org/examples/TetR_producer/Interaction2", "https://sbolstandard.org/examples/TetR_producer/Interaction1", "https://sbolstandard.org/examples/TetR_producer/Interaction3" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR device", - "role" : "SO:0000704", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1", - "@type" : "sbol:Interaction", - "displayId" : "Interaction1", - "hasParticipation" : [ "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" ], - "type" : "SBO:0000589" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3", - "role" : "SBO:0000645" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2", - "@type" : "sbol:Interaction", - "displayId" : "Interaction2", - "hasParticipation" : [ "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" ], - "type" : "SBO:0000169" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1", - "role" : "SBO:0000642" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6", - "role" : "SBO:0000019" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3", - "@type" : "sbol:Interaction", - "displayId" : "Interaction3", - "hasParticipation" : [ "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" ], - "type" : "SBO:0000177" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", - "@type" : "sbol:Participation", - "displayId" : "Participation1", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", - "@type" : "sbol:Participation", - "displayId" : "Participation2", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7", - "role" : "SBO:0000010" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", - "@type" : "sbol:Participation", - "displayId" : "Participation3", - "participant" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8", - "role" : "SBO:0000011" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/pLacI", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/rbs_tetR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent3", - "instanceOf" : "https://sbolstandard.org/examples/tetR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent4", - "instanceOf" : "https://sbolstandard.org/examples/ter_tetR", - "orientation" : "SO:0001030" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent5", - "instanceOf" : "https://sbolstandard.org/examples/TetR_protein" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent6", - "instanceOf" : "https://sbolstandard.org/examples/LacI_protein" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent7", - "instanceOf" : "https://sbolstandard.org/examples/IPTG" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent8", - "instanceOf" : "https://sbolstandard.org/examples/IPTG_LacI" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent9", - "instanceOf" : "https://sbolstandard.org/examples/atC_TetR" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "@type" : "sbol:Component", - "description" : "TetR protein", - "displayId" : "TetR_protein", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "TetR", - "role" : "GO:0003700", - "type" : "SBO:0000252" - }, { - "@id" : "https://sbolstandard.org/examples/aTC", - "@type" : "sbol:Component", - "description" : "aTC", - "displayId" : "aTC", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "aTC", - "role" : "CHEBI:35224", - "type" : "SBO:0000247" - }, { - "@id" : "https://sbolstandard.org/examples/atC_TetR", - "@type" : "sbol:Component", - "description" : "atC_TetR complex", - "displayId" : "atC_TetR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "atC_TetR", - "type" : "SBO:0000253" - }, { - "@id" : "https://sbolstandard.org/examples/gfp", - "@type" : "sbol:Component", - "description" : "gfp coding sequence", - "displayId" : "gfp", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "gfp", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/lacI", - "@type" : "sbol:Component", - "description" : "lacI coding sequence", - "displayId" : "lacI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "lacI", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/pLacI", - "@type" : "sbol:Component", - "description" : "LacI repressible promoter", - "displayId" : "pLacI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "pLacI promoter", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/pTetR", - "@type" : "sbol:Component", - "description" : "TetR repressible promoter", - "displayId" : "pTetR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "pTetR", - "role" : "SO:0000167", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_gfp", - "@type" : "sbol:Component", - "description" : "RBS", - "displayId" : "rbs_gfp", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_lacI", - "@type" : "sbol:Component", - "description" : "RBS", - "displayId" : "rbs_lacI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/rbs_tetR", - "@type" : "sbol:Component", - "description" : "tetR RBS", - "displayId" : "rbs_tetR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "rbs", - "role" : "SO:0000139", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/ter_lacI", - "@type" : "sbol:Component", - "description" : "Terminator", - "displayId" : "ter_lacI", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "lacI terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/ter_tetR", - "@type" : "sbol:Component", - "description" : "Terminator", - "displayId" : "ter_tetR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "tetR terminator", - "role" : "SO:0000141", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/tetR", - "@type" : "sbol:Component", - "description" : "tetR coding sequence", - "displayId" : "tetR", - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "tetR", - "role" : "SO:0000316", - "type" : "SBO:0000251" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "@type" : "sbol:Component", - "description" : "Toggle Switch genetic circuit", - "displayId" : "toggle_switch", - "hasConstraint" : [ "https://sbolstandard.org/examples/toggle_switch/Constraint1", "https://sbolstandard.org/examples/toggle_switch/Constraint2" ], - "hasFeature" : [ "https://sbolstandard.org/examples/toggle_switch/SubComponent1", "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", "https://sbolstandard.org/examples/toggle_switch/SubComponent2" ], - "hasNamespace" : "https://sbolstandard.org/examples", - "name" : "Toggle Switch", - "type" : "SBO:0000241" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference1", - "inChildOf" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1", - "refersTo" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference2", - "inChildOf" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2", - "refersTo" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference3", - "inChildOf" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1", - "refersTo" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", - "@type" : "sbol:ComponentReference", - "displayId" : "ComponentReference4", - "inChildOf" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2", - "refersTo" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint1", - "@type" : "sbol:Constraint", - "displayId" : "Constraint1", - "object" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint2", - "@type" : "sbol:Constraint", - "displayId" : "Constraint2", - "object" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", - "restriction" : "sbol:verifyIdentical", - "subject" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent1", - "instanceOf" : "https://sbolstandard.org/examples/LacI_producer" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2", - "@type" : "sbol:SubComponent", - "displayId" : "SubComponent2", - "instanceOf" : "https://sbolstandard.org/examples/TetR_producer" - } ], - "@context" : { - "type" : { - "@id" : "http://sbols.org/v3#type", - "@type" : "@id" - }, - "role" : { - "@id" : "http://sbols.org/v3#role", - "@type" : "@id" - }, - "name" : { - "@id" : "http://sbols.org/v3#name" - }, - "hasNamespace" : { - "@id" : "http://sbols.org/v3#hasNamespace", - "@type" : "@id" - }, - "displayId" : { - "@id" : "http://sbols.org/v3#displayId" - }, - "description" : { - "@id" : "http://sbols.org/v3#description" - }, - "instanceOf" : { - "@id" : "http://sbols.org/v3#instanceOf", - "@type" : "@id" - }, - "subject" : { - "@id" : "http://sbols.org/v3#subject", - "@type" : "@id" - }, - "restriction" : { - "@id" : "http://sbols.org/v3#restriction", - "@type" : "@id" - }, - "object" : { - "@id" : "http://sbols.org/v3#object", - "@type" : "@id" - }, - "orientation" : { - "@id" : "http://sbols.org/v3#orientation", - "@type" : "@id" - }, - "participant" : { - "@id" : "http://sbols.org/v3#participant", - "@type" : "@id" - }, - "hasParticipation" : { - "@id" : "http://sbols.org/v3#hasParticipation", - "@type" : "@id" - }, - "refersTo" : { - "@id" : "http://sbols.org/v3#refersTo", - "@type" : "@id" - }, - "inChildOf" : { - "@id" : "http://sbols.org/v3#inChildOf", - "@type" : "@id" - }, - "hasFeature" : { - "@id" : "http://sbols.org/v3#hasFeature", - "@type" : "@id" - }, - "hasConstraint" : { - "@id" : "http://sbols.org/v3#hasConstraint", - "@type" : "@id" - }, - "hasInteraction" : { - "@id" : "http://sbols.org/v3#hasInteraction", - "@type" : "@id" - }, - "SBO" : "https://identifiers.org/SBO:", - "CHEBI" : "https://identifiers.org/CHEBI:", - "GO" : "https://identifiers.org/GO:", - "sbol" : "http://sbols.org/v3#", - "EDAM" : "https://identifiers.org/edam:", - "SO" : "https://identifiers.org/SO:", - "prov" : "http://www.w3.org/ns/prov#", - "om" : "http://www.ontology-of-units-of-measure.org/resource/om-2/" - } + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "lacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "lacI", + "sbol:description": "lacI coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "LacI_protein", + "sbol:description": "LacI protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ter_tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "tetR terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_tetR", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/IPTG_LacI", + "sbol:type": { + "@id": "SBO:0000253" + }, + "sbol:name": "IPTG_LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "IPTG_LacI", + "sbol:description": "IPTG_LacI complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + }, + "sbol:displayId": "Constraint2", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + }, + "sbol:displayId": "ComponentReference3", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + }, + "sbol:displayId": "ComponentReference4", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/ter_lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "lacI terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_lacI", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_lacI" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/IPTG", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "IPTG", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "IPTG", + "sbol:description": "IPTG", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000642" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pLacI" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/pTetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pTetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pTetR", + "sbol:description": "TetR repressible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_gfp", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "TetR_protein", + "sbol:description": "TetR protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/atC_TetR" + }, + "sbol:displayId": "SubComponent11", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/atC_TetR", + "sbol:type": { + "@id": "SBO:0000253" + }, + "sbol:name": "atC_TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "atC_TetR", + "sbol:description": "atC_TetR complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4", + "sbol:type": { + "@id": "SBO:0000177" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" + } + ], + "sbol:displayId": "Interaction4", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + }, + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/gfp" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "gfp", + "sbol:description": "gfp coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_producer" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_tetR" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3", + "sbol:type": { + "@id": "SBO:0000177" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/aTC" + }, + "sbol:displayId": "SubComponent10", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/aTC", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "aTC", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "aTC", + "sbol:description": "aTC", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3", + "sbol:type": { + "@id": "SBO:0000169" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000642" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000020" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "toggle_switch", + "sbol:description": "Toggle Switch genetic circuit", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2" + } + ], + "@type": "sbol:Component", + "sbol:name": "Toggle Switch" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_producer" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_gfp" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/pLacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pLacI promoter", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pLacI", + "sbol:description": "LacI repressible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:displayId": "SubComponent9", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_tetR", + "sbol:description": "tetR RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4" + } + ], + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4" + } + ], + "@type": "sbol:Component", + "sbol:description": "LacI producer", + "sbol:displayId": "LacI_producer", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:name": "LacI producer", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:type": { + "@id": "SBO:0000251" + } + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pTetR" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_lacI" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/GFP_protein" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/lacI" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/tetR" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "tetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "tetR", + "sbol:description": "tetR coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2", + "sbol:type": { + "@id": "SBO:0000169" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000020" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4" + } + ], + "sbol:displayId": "TetR_producer", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": "sbol:Component", + "sbol:description": "TetR producer", + "sbol:name": "TetR device", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000704" + } + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_lacI", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_tetR" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/IPTG" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/IPTG_LacI" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/GFP_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "GFP_protein", + "sbol:description": "GFP", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } } diff --git a/SBOL3/toggle_switch/toggle_switch.jsonld_expanded b/SBOL3/toggle_switch/toggle_switch.jsonld_expanded index 91d213a..55cecba 100644 --- a/SBOL3/toggle_switch/toggle_switch.jsonld_expanded +++ b/SBOL3/toggle_switch/toggle_switch.jsonld_expanded @@ -68,6 +68,8 @@ } ], "http://sbols.org/v3#hasFeature" : [ { "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, { + "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" }, { "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" }, { @@ -211,7 +213,7 @@ }, { "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000019" + "@id" : "https://identifiers.org/SBO:0000020" } ], "http://sbols.org/v3#participant" : [ { "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" @@ -266,7 +268,7 @@ "@id" : "https://identifiers.org/SBO:0000011" } ], "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9" + "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" } ], "http://sbols.org/v3#displayId" : [ { "@value" : "Participation3" @@ -293,6 +295,15 @@ "@value" : "SubComponent10" } ], "@type" : [ "http://sbols.org/v3#SubComponent" ] +}, { + "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11", + "http://sbols.org/v3#instanceOf" : [ { + "@id" : "https://sbolstandard.org/examples/atC_TetR" + } ], + "http://sbols.org/v3#displayId" : [ { + "@value" : "SubComponent11" + } ], + "@type" : [ "http://sbols.org/v3#SubComponent" ] }, { "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2", "http://sbols.org/v3#orientation" : [ { @@ -419,8 +430,6 @@ "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" }, { "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9" } ], "http://sbols.org/v3#displayId" : [ { "@value" : "TetR_producer" @@ -515,7 +524,7 @@ }, { "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2", "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000019" + "@id" : "https://identifiers.org/SBO:0000020" } ], "http://sbols.org/v3#participant" : [ { "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" @@ -660,15 +669,6 @@ "@value" : "SubComponent8" } ], "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/atC_TetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent9" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] }, { "@id" : "https://sbolstandard.org/examples/TetR_protein", "http://sbols.org/v3#type" : [ { @@ -941,6 +941,9 @@ "@type" : [ "http://sbols.org/v3#Component" ] }, { "@id" : "https://sbolstandard.org/examples/toggle_switch", + "http://sbols.org/v3#type" : [ { + "@id" : "https://identifiers.org/SBO:0000251" + } ], "http://sbols.org/v3#hasFeature" : [ { "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" }, { @@ -963,6 +966,9 @@ "http://sbols.org/v3#description" : [ { "@value" : "Toggle Switch genetic circuit" } ], + "http://sbols.org/v3#role" : [ { + "@id" : "https://identifiers.org/SO:0000704" + } ], "http://sbols.org/v3#hasConstraint" : [ { "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint1" }, { @@ -971,9 +977,6 @@ "@type" : [ "http://sbols.org/v3#Component" ], "http://sbols.org/v3#name" : [ { "@value" : "Toggle Switch" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" } ] }, { "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", diff --git a/SBOL3/toggle_switch/toggle_switch.nt b/SBOL3/toggle_switch/toggle_switch.nt index d67e540..873c523 100644 --- a/SBOL3/toggle_switch/toggle_switch.nt +++ b/SBOL3/toggle_switch/toggle_switch.nt @@ -76,6 +76,9 @@ . "SubComponent5" . . + . + "SubComponent11" . + . . . . @@ -120,7 +123,7 @@ "Interaction3" . . . - . + . "Participation3" . . . @@ -130,11 +133,13 @@ "TetR_protein" . "TetR protein" . . + . . . . "toggle_switch" . "Toggle Switch genetic circuit" . + . . . . @@ -142,7 +147,6 @@ . . "Toggle Switch" . - . . . . @@ -155,9 +159,6 @@ "pLacI" . "LacI repressible promoter" . . - . - "SubComponent9" . - . . . "ComponentReference3" . @@ -178,6 +179,7 @@ . . . + . . . . @@ -222,7 +224,7 @@ . "Interaction2" . . - . + . . "Participation2" . . @@ -257,7 +259,6 @@ . "TetR device" . . - . . . . @@ -360,7 +361,7 @@ . "SubComponent1" . . - . + . . "Participation2" . . diff --git a/SBOL3/toggle_switch/toggle_switch.rdf b/SBOL3/toggle_switch/toggle_switch.rdf index 9b127b2..1d5ad3f 100644 --- a/SBOL3/toggle_switch/toggle_switch.rdf +++ b/SBOL3/toggle_switch/toggle_switch.rdf @@ -107,7 +107,7 @@ - + @@ -184,14 +184,6 @@ TetR device - - - - - - SubComponent9 - - @@ -234,6 +226,7 @@ TetR repressible promoter + @@ -257,6 +250,7 @@ toggle_switch Toggle Switch genetic circuit + @@ -307,7 +301,6 @@ Toggle Switch - @@ -369,7 +362,7 @@ - + Participation2 @@ -378,6 +371,12 @@ + + + + SubComponent11 + + @@ -475,7 +474,7 @@ - + Participation3 diff --git a/SBOL3/toggle_switch/toggle_switch.rj b/SBOL3/toggle_switch/toggle_switch.rj index 3ab03ac..ebc4392 100644 --- a/SBOL3/toggle_switch/toggle_switch.rj +++ b/SBOL3/toggle_switch/toggle_switch.rj @@ -213,7 +213,7 @@ "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" : { "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" } ] , "http://sbols.org/v3#displayId" : [ { @@ -330,7 +330,7 @@ ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000019" + "value" : "https://identifiers.org/SBO:0000020" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { @@ -654,10 +654,6 @@ } ] , "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent9" - } - , { "type" : "uri" , "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" } @@ -1080,6 +1076,10 @@ "type" : "uri" , "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent4" } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + } , { "type" : "uri" , "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" @@ -1194,24 +1194,6 @@ ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent9" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent9" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/atC_TetR" - } - ] - } - , "https://sbolstandard.org/examples/LacI_producer/SubComponent6" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , @@ -1443,6 +1425,24 @@ ] } , + "https://sbolstandard.org/examples/LacI_producer/SubComponent11" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent11" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/atC_TetR" + } + ] + } + , "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" : { "http://sbols.org/v3#participant" : [ { "type" : "uri" , @@ -1938,6 +1938,11 @@ "value" : "toggle_switch" } ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -1994,7 +1999,7 @@ ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "https://identifiers.org/SBO:0000251" } ] } @@ -2012,7 +2017,7 @@ ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000019" + "value" : "https://identifiers.org/SBO:0000020" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { diff --git a/SBOL3/toggle_switch/toggle_switch.ttl b/SBOL3/toggle_switch/toggle_switch.ttl index a0713bf..09e55de 100644 --- a/SBOL3/toggle_switch/toggle_switch.ttl +++ b/SBOL3/toggle_switch/toggle_switch.ttl @@ -1,18 +1,18 @@ @base . @prefix : . -@prefix SBO: . @prefix CHEBI: . -@prefix GO: . -@prefix sbol: . @prefix EDAM: . +@prefix GO: . +@prefix SBO: . @prefix SO: . -@prefix prov: . @prefix om: . +@prefix prov: . +@prefix sbol: . :lacI a sbol:Component ; sbol:description "lacI coding sequence" ; sbol:displayId "lacI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "lacI" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -25,7 +25,7 @@ :ter_tetR a sbol:Component ; sbol:description "Terminator" ; sbol:displayId "ter_tetR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "tetR terminator" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . @@ -33,7 +33,7 @@ :IPTG_LacI a sbol:Component ; sbol:description "IPTG_LacI complex" ; sbol:displayId "IPTG_LacI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "IPTG_LacI" ; sbol:type SBO:0000253 . @@ -47,7 +47,7 @@ :ter_lacI a sbol:Component ; sbol:description "Terminator" ; sbol:displayId "ter_lacI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "lacI terminator" ; sbol:role SO:0000141 ; sbol:type SBO:0000251 . @@ -61,7 +61,7 @@ :IPTG a sbol:Component ; sbol:description "IPTG" ; sbol:displayId "IPTG" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "IPTG" ; sbol:role CHEBI:35224 ; sbol:type SBO:0000247 . @@ -81,7 +81,7 @@ :pTetR a sbol:Component ; sbol:description "TetR repressible promoter" ; sbol:displayId "pTetR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "pTetR" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . @@ -89,7 +89,7 @@ :LacI_protein a sbol:Component ; sbol:description "LacI protein" ; sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LacI" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -97,7 +97,7 @@ :rbs_gfp a sbol:Component ; sbol:description "RBS" ; sbol:displayId "rbs_gfp" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -107,6 +107,11 @@ sbol:displayId "SubComponent5" ; sbol:instanceOf :TetR_protein . + + a sbol:SubComponent ; + sbol:displayId "SubComponent11" ; + sbol:instanceOf :atC_TetR . + a sbol:Interaction ; sbol:displayId "Interaction4" ; @@ -116,7 +121,7 @@ :atC_TetR a sbol:Component ; sbol:description "atC_TetR complex" ; sbol:displayId "atC_TetR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "atC_TetR" ; sbol:type SBO:0000253 . @@ -165,13 +170,13 @@ a sbol:Participation ; sbol:displayId "Participation3" ; - sbol:participant ; + sbol:participant ; sbol:role SBO:0000011 . :TetR_protein a sbol:Component ; sbol:description "TetR protein" ; sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:role GO:0003700 ; sbol:type SBO:0000252 . @@ -181,9 +186,10 @@ sbol:displayId "toggle_switch" ; sbol:hasConstraint , ; sbol:hasFeature , , , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "Toggle Switch" ; - sbol:type SBO:0000241 . + sbol:role SO:0000704 ; + sbol:type SBO:0000251 . a sbol:SubComponent ; @@ -194,16 +200,11 @@ :pLacI a sbol:Component ; sbol:description "LacI repressible promoter" ; sbol:displayId "pLacI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "pLacI promoter" ; sbol:role SO:0000167 ; sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent9" ; - sbol:instanceOf :atC_TetR . - a sbol:ComponentReference ; sbol:displayId "ComponentReference3" ; @@ -213,7 +214,7 @@ :rbs_tetR a sbol:Component ; sbol:description "tetR RBS" ; sbol:displayId "rbs_tetR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -221,7 +222,7 @@ :gfp a sbol:Component ; sbol:description "gfp coding sequence" ; sbol:displayId "gfp" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "gfp" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -229,9 +230,9 @@ :LacI_producer a sbol:Component ; sbol:description "LacI producer" ; sbol:displayId "LacI_producer" ; - sbol:hasFeature , , , , , , , , , ; + sbol:hasFeature , , , , , , , , , , ; sbol:hasInteraction , , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "LacI producer" ; sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -275,7 +276,7 @@ a sbol:Participation ; sbol:displayId "Participation2" ; sbol:participant ; - sbol:role SBO:0000019 . + sbol:role SBO:0000020 . a sbol:Participation ; @@ -291,7 +292,7 @@ :rbs_lacI a sbol:Component ; sbol:description "RBS" ; sbol:displayId "rbs_lacI" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "rbs" ; sbol:role SO:0000139 ; sbol:type SBO:0000251 . @@ -299,9 +300,9 @@ :TetR_producer a sbol:Component ; sbol:description "TetR producer" ; sbol:displayId "TetR_producer" ; - sbol:hasFeature , , , , , , , , ; + sbol:hasFeature , , , , , , , ; sbol:hasInteraction , , ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR device" ; sbol:role SO:0000704 ; sbol:type SBO:0000251 . @@ -326,7 +327,7 @@ :tetR a sbol:Component ; sbol:description "tetR coding sequence" ; sbol:displayId "tetR" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "tetR" ; sbol:role SO:0000316 ; sbol:type SBO:0000251 . @@ -392,7 +393,7 @@ :GFP_protein a sbol:Component ; sbol:description "GFP" ; sbol:displayId "GFP_protein" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "GFP" ; sbol:type SBO:0000252 . @@ -411,7 +412,7 @@ :aTC a sbol:Component ; sbol:description "aTC" ; sbol:displayId "aTC" ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "aTC" ; sbol:role CHEBI:35224 ; sbol:type SBO:0000247 . @@ -454,7 +455,7 @@ a sbol:Participation ; sbol:displayId "Participation2" ; sbol:participant ; - sbol:role SBO:0000019 . + sbol:role SBO:0000020 . a sbol:Participation ; diff --git a/SBOL3/toggle_switch/toggle_switch_ordered.nt b/SBOL3/toggle_switch/toggle_switch_ordered.nt index 0bb8134..cf38833 100644 --- a/SBOL3/toggle_switch/toggle_switch_ordered.nt +++ b/SBOL3/toggle_switch/toggle_switch_ordered.nt @@ -49,7 +49,7 @@ . "Participation2" . . - . + . . "Interaction3" . . @@ -65,7 +65,7 @@ . . "Participation3" . - . + . . . "Interaction4" . @@ -77,6 +77,9 @@ "SubComponent10" . . . + "SubComponent11" . + . + . "SubComponent1" . . . @@ -113,6 +116,7 @@ "LacI producer" . "LacI_producer" . . + . . . . @@ -157,7 +161,7 @@ . "Participation2" . . - . + . . "Interaction2" . . @@ -210,9 +214,6 @@ "SubComponent8" . . . - "SubComponent9" . - . - . "TetR producer" . "TetR_producer" . . @@ -223,7 +224,6 @@ . . . - . . . . @@ -366,5 +366,6 @@ . . "Toggle Switch" . - . + . + . . From ed7810dc27df81fed7ff83181ba4d6bbf1c38671 Mon Sep 17 00:00:00 2001 From: goksel <> Date: Fri, 28 Apr 2023 13:19:40 +0100 Subject: [PATCH 2/2] Updated start and end dates --- .../component_urn_uri/component_urn_uri.jsonld | 4 ++-- .../component_urn_uri.jsonld_expanded | 4 ++-- SBOL3/entity/component_urn_uri/component_urn_uri.nt | 8 ++++---- SBOL3/entity/component_urn_uri/component_urn_uri.rdf | 4 ++-- SBOL3/entity/component_urn_uri/component_urn_uri.rj | 4 ++-- SBOL3/entity/component_urn_uri/component_urn_uri.ttl | 4 ++-- .../component_urn_uri/component_urn_uri_ordered.nt | 8 ++++---- SBOL3/provenance_entity/activity/activity.jsonld | 4 ++-- .../activity/activity.jsonld_expanded | 8 ++++---- SBOL3/provenance_entity/activity/activity.nt | 4 ++-- SBOL3/provenance_entity/activity/activity.rdf | 4 ++-- SBOL3/provenance_entity/activity/activity.rj | 12 ++++++------ SBOL3/provenance_entity/activity/activity.ttl | 4 ++-- SBOL3/provenance_entity/activity/activity_ordered.nt | 4 ++-- 14 files changed, 38 insertions(+), 38 deletions(-) diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld index 1acf3dc..efd7eea 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld @@ -1,8 +1,8 @@ { - "@id": "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a", + "@id": "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1", "sbol:name": "TetR", "sbol:hasNamespace": { - "@id": "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" + "@id": "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" }, "sbol:type": { "@id": "SBO:0000252" diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded index 38deb3b..5fe226d 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded @@ -1,10 +1,10 @@ [ { - "@id" : "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a", + "@id" : "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1", "http://sbols.org/v3#name" : [ { "@value" : "TetR" } ], "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" + "@id" : "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" } ], "http://sbols.org/v3#type" : [ { "@id" : "https://identifiers.org/SBO:0000252" diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.nt b/SBOL3/entity/component_urn_uri/component_urn_uri.nt index 788e865..1b4b831 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.nt @@ -1,4 +1,4 @@ - "TetR" . - . - . - . + "TetR" . + . + . + . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf index ac39155..087b650 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf @@ -10,9 +10,9 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - + TetR - + diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rj b/SBOL3/entity/component_urn_uri/component_urn_uri.rj index f1f6eb2..b791bb6 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rj +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rj @@ -1,5 +1,5 @@ { - "urn:uuid:0536365c-9ff0-4d45-927c-8bde1665355a" : { + "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1" : { "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" @@ -7,7 +7,7 @@ ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "urn:uuid:c3354ff3-9779-4bfa-a185-7fe6ac7471a2" + "value" : "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" } ] , "http://sbols.org/v3#name" : [ { diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl index 4a48313..2cfdc43 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl @@ -9,8 +9,8 @@ @prefix prov: . @prefix sbol: . - + a sbol:Component ; - sbol:hasNamespace ; + sbol:hasNamespace ; sbol:name "TetR" ; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt index e623088..5c8d283 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt @@ -1,4 +1,4 @@ - . - "TetR" . - . - . + . + "TetR" . + . + . diff --git a/SBOL3/provenance_entity/activity/activity.jsonld b/SBOL3/provenance_entity/activity/activity.jsonld index a28b416..67baec2 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld +++ b/SBOL3/provenance_entity/activity/activity.jsonld @@ -37,7 +37,6 @@ "sbol:type": { "@id": "sbol:design" }, - "prov:startedAtTime": "2019-07-29T12:48:00.149Z", "@type": [ "sbol:TopLevel", "prov:Activity" @@ -53,7 +52,8 @@ } ], "sbol:displayId": "codon_optimization_activity", - "prov:endedAtTime": "2020-08-30T12:48:00.149Z", + "prov:startedAtTime": "2019-07-29T16:50:59Z", + "prov:endedAtTime": "2019-08-30T00:00:00Z", "prov:qualifiedAssociation": { "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1" }, diff --git a/SBOL3/provenance_entity/activity/activity.jsonld_expanded b/SBOL3/provenance_entity/activity/activity.jsonld_expanded index 2dda253..32b9a88 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld_expanded +++ b/SBOL3/provenance_entity/activity/activity.jsonld_expanded @@ -54,9 +54,6 @@ "http://sbols.org/v3#type" : [ { "@id" : "http://sbols.org/v3#design" } ], - "http://www.w3.org/ns/prov#startedAtTime" : [ { - "@value" : "2019-07-29T12:48:00.149Z" - } ], "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Activity" ], "http://sbols.org/v3#name" : [ { "@value" : "Codon optimization activity" @@ -72,8 +69,11 @@ "http://sbols.org/v3#displayId" : [ { "@value" : "codon_optimization_activity" } ], + "http://www.w3.org/ns/prov#startedAtTime" : [ { + "@value" : "2019-07-29T16:50:59Z" + } ], "http://www.w3.org/ns/prov#endedAtTime" : [ { - "@value" : "2020-08-30T12:48:00.149Z" + "@value" : "2019-08-30T00:00:00Z" } ], "http://www.w3.org/ns/prov#qualifiedAssociation" : [ { "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1" diff --git a/SBOL3/provenance_entity/activity/activity.nt b/SBOL3/provenance_entity/activity/activity.nt index e8ae900..cd4030e 100644 --- a/SBOL3/provenance_entity/activity/activity.nt +++ b/SBOL3/provenance_entity/activity/activity.nt @@ -49,14 +49,14 @@ "CodonOptimisationProtocol" . . . - "2019-07-29T12:48:00.149Z" . . "Codon optimization activity" . "An activity that is used to optimise codons" . . . "codon_optimization_activity" . - "2020-08-30T12:48:00.149Z" . + "2019-07-29T16:50:59Z" . + "2019-08-30T00:00:00Z" . . . . diff --git a/SBOL3/provenance_entity/activity/activity.rdf b/SBOL3/provenance_entity/activity/activity.rdf index d3b36c0..a8685a7 100644 --- a/SBOL3/provenance_entity/activity/activity.rdf +++ b/SBOL3/provenance_entity/activity/activity.rdf @@ -55,7 +55,6 @@ - 2019-07-29T12:48:00.149Z Codon optimization activity An activity that is used to optimise codons @@ -68,7 +67,8 @@ codon_optimization_activity - 2020-08-30T12:48:00.149Z + 2019-07-29T16:50:59Z + 2019-08-30T00:00:00Z diff --git a/SBOL3/provenance_entity/activity/activity.rj b/SBOL3/provenance_entity/activity/activity.rj index 5c9e14e..4bcbcef 100644 --- a/SBOL3/provenance_entity/activity/activity.rj +++ b/SBOL3/provenance_entity/activity/activity.rj @@ -146,12 +146,7 @@ ] , "http://www.w3.org/ns/prov#endedAtTime" : [ { "type" : "literal" , - "value" : "2020-08-30T12:48:00.149Z" - } - ] , - "http://www.w3.org/ns/prov#startedAtTime" : [ { - "type" : "literal" , - "value" : "2019-07-29T12:48:00.149Z" + "value" : "2019-08-30T00:00:00Z" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { @@ -163,6 +158,11 @@ "value" : "http://www.w3.org/ns/prov#Activity" } ] , + "http://www.w3.org/ns/prov#startedAtTime" : [ { + "type" : "literal" , + "value" : "2019-07-29T16:50:59Z" + } + ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" diff --git a/SBOL3/provenance_entity/activity/activity.ttl b/SBOL3/provenance_entity/activity/activity.ttl index d88f497..9515ea2 100644 --- a/SBOL3/provenance_entity/activity/activity.ttl +++ b/SBOL3/provenance_entity/activity/activity.ttl @@ -75,7 +75,7 @@ sbol:hasNamespace ; sbol:name "Codon optimization activity" ; sbol:type sbol:design ; - prov:endedAtTime "2020-08-30T12:48:00.149Z" ; + prov:endedAtTime "2019-08-30T00:00:00Z" ; prov:qualifiedAssociation ; prov:qualifiedUsage , ; - prov:startedAtTime "2019-07-29T12:48:00.149Z" . + prov:startedAtTime "2019-07-29T16:50:59Z" . diff --git a/SBOL3/provenance_entity/activity/activity_ordered.nt b/SBOL3/provenance_entity/activity/activity_ordered.nt index 02e9855..e67f97a 100644 --- a/SBOL3/provenance_entity/activity/activity_ordered.nt +++ b/SBOL3/provenance_entity/activity/activity_ordered.nt @@ -41,11 +41,11 @@ . . . - "2020-08-30T12:48:00.149Z" . + "2019-08-30T00:00:00Z" . . . . - "2019-07-29T12:48:00.149Z" . + "2019-07-29T16:50:59Z" . "Toggle Switch genetic circuit" . "toggle_switch" . .