lima demultiplexed

[tdfy]

hello,
I am starting with PacBio amplicon libraries generated by a colleague which were demultiplexed using lima. Could you describe the best workflow for this starting point? Thank you.

[SorenKarst]

Hi tdfy,

Again. Sorry about the late reply.

Without knowing the details of your experiment I would guess the following command can be run on each demultiplexed PB CCS fastq file.

longread_umi pacbio_pipeline \
  -d demultiplexed_pb_ccs.fq \
  -o test_pb_ccs \
  -v 3 \
  -m 3500 \ <- change to minimum amplicon length
  -M 6000 \ <- change to maximum amplicon length
  -s 60 \ 
  -e 60 \
  -f CAAGCAGAAGACGGCATACGAGAT \ 
  -F AGRGTTYGATYMTGGCTCAG \ <- change if you used a different fwd target primer 
  -r AATGATACGGCGACCACCGAGATC \
  -R CGACATCGAGGTGCCAAAC \ <- change if you used a different rev target primer 
  -c 2 \
  -t 1 <- change to use number of CPUS available